Allele Report for H*01:01:01:01

H*01:01:01:01 View HGVS Report
Pre-2010 Nomenclature: H*01010101 Local Names: HLA-H
IMGT/HLA Acc No: HLA02546 OMIM Entry: Not Listed
Assigned: 2006-04-30 Sequence Last Modified: 2006-07-14
Source Entries: AF055066 , CR388220 , M32106  
Cells Sequence Derived From: BOLETH , DBB , LCL721  
Known Ethnic Origin Of Source: Caucasoid
Publications
Zemmour J et al. J Immunol 144:3619-29 1990. (View abstract)
Hampe A et al. DNA Seq 10:263-99 1999. (View abstract)
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Confirmed
Cells: 3 Laboratories: 3
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (1096 bps)
ATGGTGCTCATGGCGCCCCGAACCCTCCTCCTGCTGCTCTCAGGGGCCCTGGCCCTGACCCAGACCTGGGCGCGCTCCCA
CTCCATGAGGTATTTCTACACCACCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCTCCGTCGGCTACGTGGACG
ATACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAGGATGGAGCCGCGGGCGCCGTGGATGGAGCGGGAGGGG
CCGGAGTATTGGGACCGGAACACACAGATCTGCAAGGCCCAGGCACAGACTGAACGAGAGAACCTGCGGATCGCGCTCCG
CTACTACAACCAGAGCGAGGGCGGTTCTCACACCATGCAGGTGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCTTCC
TCCGCGGGTATGAACAGCACGCCTACGACAGCAAGGATTACATCGCTCTGAACGAGGACCTGCGCTCCTGGACCGCGGCG
GACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGCCCGTCAGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCGA
GTTCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGGACCCCCCCAAGACACATATGA
CCCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACC
TGGCAGCGGGATGGGGAGGACCAGACCCACACACGGAGCTCATGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAG
TGGGCGGCTGTGGTGGTGCCTTCTGGAGAGGAGCAGAGATACACCTGCCATGTGCAGCATGAGGGTCTGCCAGAGCCCCT
CACCCTGAGATGGGAGCCATCTTCCCAGCCCACCATCCCCATCGTGGGCATCGTTGCTGGCCTGGTTCTACTTGTAGCTG
TGGTCACTGGAGCTGTGGTCGCTGCTGTAATGTGGAGGAAGAAGAGCTCAGATAGAAAAGGAGGGAGCTACTCTCAGGCT
GCAAGCGGCAACAGTGCCCAGGGCTCTGATGTGTCTCTCACGGCGTGAAAGTGTGA
Genomic Sequence Data (3498 bps)
GCACAGGAGGAGCGGGGTCAGGGCGAAGTCCCAGGGCCCCAGGCGTGGCTCTCAGGGTCTCAGGCCCCGAAGGCGGTGTA
TGGATTGGGGAGGCCCCGCCTTGGGGATTCGCCACCTCCGCAGTTTCTCTTCTTCTCACAACCTGCGACGGGTCCTTTTT
CCTGGATACTCAGGAAGCGGGCACAGTTCTCATTCCCACTAGGTGTCGGGTTTCTAGAGAAGCCAATCGGTGCCGCCGCG
GTCCCGGTTCTAAAGTCCCCACGCACCCACCGGGACTCAGATTCTCCCCAGACGCCGAGGATGGTGCTCATGGCGCCCCG
AACCCTCCTCCTGCTGCTCTCAGGGGCCCTGGCCCTGACCCAGACCTGGGCGCGTGAGTGCAGGGTCTGCAGGGAAATGG
TCGGGAGGAGCGAGGGGCCCGCCCGGCGGGGGCGCAGGACCCAGGGAGCCGCGCAGGGAGGAGGGTCGGGCGGGTCTCAG
CTCCTCCTCGCTCCCAGGCTCCCACTCCATGAGGTATTTCTACACCACCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCT
TCATCTCCGTCGGCTACGTGGACGATACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAGGATGGAGCCGCGG
GCGCCGTGGATGGAGCGGGAGGGGCCGGAGTATTGGGACCGGAACACACAGATCTGCAAGGCCCAGGCACAGACTGAACG
AGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGGCGGTGAGTGACCCCGGCCCGGGACGCAGGTCACGA
CCCCTCCCCATCCCCCACGGAGGGCCGGGTCGCCTCGAGTCTCTGGGTCCGAGATCCTCCCCGAAACCGCGGGACCCCGA
GACCCTTGACCTGGGAGAGGCCCAGGCGCCTTTACCCGGTTTCATTTTCAGTTTAGGCCAAAATCCCCGCGGGTTGGTCG
GGGCAGGGCGGGGCTCGGGGGACCGGGCTGACCGCGGGGGCGGGGCCAGGTTCTCACACCATGCAGGTGATGTATGGCTG
CGACGTGGGGCCCGACGGGCGCTTCCTCCGCGGGTATGAACAGCACGCCTACGACAGCAAGGATTACATCGCTCTGAACG
AGGACCTGCGCTCCTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGCCCGTCAGGCGGAG
CAGCTGAGAGCCTACCTGGAGGGCGAGTTCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCG
CGCGGGTACCAGGGGCCACAGGGCGCCTCCCGGATGGCCTGTAGATCTCCGGGGCTGGCCTCCCACAAGAAAGGGAGACA
AATGGGACCAACACTATAATATCGCCCTCCCTCTGGTCCTGAGGGAGAAGAATCCTCCTGGGTTTCCAGAGAGTGACTCT
GAGGGTCCGCCGTGCTCTTTGACACAATTAAGGGATGAAATCTCTGAGGAAATGAAGGGAAGACAATCCCTGGAATACTG
ATGAGTGGTTCCCTTTGACACTGGCAGCAGCCTTGGGCCCCGTGACTTTTCCTCTCAGGCCTTGTTCTCTGCTTCACACT
CAATGTGCCTGGGGGTCTGAGTCCAGCTCTTCTGAGTCCCTCAGCCTCCACTCAGGTCAGGACCAGAAGTCGCTGTTCCC
TCCTCAGGGACTAGAATTTTCCACGGAATAGGAGATTATCCCAGGTGCCTGTGTCCAGGCTGTTGTCTGGGTTCTGTGCT
CCCTTCCCCACCCCAGGCGTCCTGTCCATTCTCAAGATGGCCACATGCGTGCTGGTGGAGTGTCCCATGACAGATGCAAA
ATGCCTGAATTTTCTGACTCTTCCTGTCAGACCCCCCCAAGACACATATGACCCACCACCCCATCTCTGACCATGAGGCC
ACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACCTGGCAGCGGGATGGGGAGGACCAGACCCA
CACACGGAGCTCATGGAGACCAGGCCTGCAGGGGATGGAACCTTCCAGAAGTGGGCGGCTGTGGTGGTGCCTTCTGGAGA
GGAGCAGAGATACACCTGCCATGTGCAGCATGAGGGTCTGCCAGAGCCCCTCACCCTGAGATGGGGTAAGGAGGGAGATG
GGGGTGTCATGTCCCTTAGGGAAAGCCGGAGCCTCTCTGGAGAGCTTTAGCAGGGTCAGGGTCCCTCACCTTCCCCCCTT
TTCCCAGAGCCATCTTCCCAGCCCACCATCCCCATCGTGGGCATCGTTGCTGGCCTGGTTCTACTTGTAGCTGTGGTCAC
TGGAGCTGTGGTCGCTGCTGTAATGTGGAGGAAGAAGAGCTCAGGTAAGGAAGGGGTGAGGAGTGTGGTCTGAGATTTCT
TGTCTCACTGAGAGTTCCAAGCCCCAGGTAGAAGTGCCCTGCCTGGTTACTGGGAAGCACCATCCACACTCATGGGCCTA
CCCAGCCTGGGCCCTGTGTGCCAGCACTTACTCTTTTGTAAAGCACCTGTTACAATGAGGGACAGATTTATCACCTTGAT
GACTGTGGTGATGGGACCTGATCCCAGCAGTCACAAGTCACAGGGGAAGGTCCCCGAGGACAGACCTCAGAAGGGCGGTT
GGTCCAGGACCCACATCTGCTTTCCTCATGTTTCCTGATCCCGCCCTGGGTCTGCAGTTGCACATTTCTGGAAACTTCTC
TGGGGTCCAAGACTTGGAGGTTCCTCTAGGACCTTATGGCCCTGGCTTCTTTCTGGCATCTCACAGGACATTTTCTTCCC
ACAGATAGAAAAGGAGGGAGCTACTCTCAGGCTGCAAGTAAGTATGAAGGAGGCTGATCCCTGAAATCCTTTGGATATTG
TGTTTGGGAGCCCATGGGGGAGCTCACCCACCCCACAATTCTTCCTCTAGCCACATCTACTGTGGGATCTGACCAGGTCC
TGTTTTTATTCTACTCCAGGCGGCAACAGTGCCCAGGGCTCTGATGTGTCTCTCACGGCGTGAAAGGTGAGACCTTGGGG
GGCCTGATGTGTGGGGGGTGTTGGGGGGGAACAGTGGACACAGCTGTGCTATGGGGTTCTTTGAATTTGATGTTTTGAGC
ATGCGATGGGCTGCCAAAGTGTCATCCATTACTGGGACAGATATGAATTTGTTCATGAATATTTTTTCTATAGTGTGAGA
CAGCTGCCTTGTGTGGGACTGAGAGGCAAGATTTGTTCACACCTTCCCTTTGTGACTTGAAGAACCCTGACTTTCTGCAA
AGGCACCTGAATGTGTCTGTGTTCCTGTAGGCATAATGTGTGGAGGAGGGGAGACCAACCCACCCTCATGTCCACCATGA
CCCTCTTCCCCACGCTGATCTGTGTTCCCTCCCCAATCATCTTTCCTGTTCCAGAGAGGCGGGGCTGAGATGTCTCCATC
TTTTTCTCAACTTTATGTGCACTGAGCTGTAACTTCTTACTTCCCTCTTAAAATTAGA

IMGT/HLA

Sponsors

Animated Sponsors Logo