Allele Report for DRB9*01:01

DRB9*01:01 View HGVS Report
Pre-2010 Nomenclature: DRB9*0101 Local Names: M4.2 b exon
IMGT/HLA Acc No: HLA01030 OMIM Entry: Not Listed
Assigned: 1999-05-01 Sequence Last Modified: 1999-04-08
Source Entries: M15563  
Cells Sequence Derived From: MOU  
Known Ethnic Origin Of Source: Caucasoid
Publications
Meunier HF et al. Immunogenetics 23:172-80 1986. (View abstract)
Confirmatory Data
Sequence Status: Partial CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (270 bps)
CACATTTCTTGGAGCAGATTAAACACGAGTGCTATTTCTGCAATGGGACAGAGCGGATGCGGTTTGTGCAGAGACTCGTC
CACACCGGAAGGAGTATGCGCGCTTCCATAGGGACGTCAGAAAGTTCCGGGCGGTGGCGGAGCTGGAGCGGAGAAGAGTC
CAGGAATGCAAACAGCCAGAAGAACCTCTTGGGCTGCTTGCGGGGTCTGTTGGACACCTACTGCAGACACAACTACGGGG
TTTTTGAGAGCTTCTCCATGCACAGGCGAG
Genomic Sequence Data (0 bps)
Not Currently Available

IMGT/HLA

Sponsors

Animated Sponsors Logo