Allele Report for DRB7*01:01:01

DRB7*01:01:01 View HGVS Report
Pre-2010 Nomenclature: DRB7*010101 Local Names: DRB7*01011, DRBy1
IMGT/HLA Acc No: HLA00932 OMIM Entry: Not Listed
Assigned: 1994-04-20 Sequence Last Modified: 1999-04-08
Source Entries: K02772 , K02773 , K02774 , L31617  
Cells Sequence Derived From: BH , BOLETH  
Known Ethnic Origin Of Source: Caucasoid
Publications
Day S et al. Eur J Immunogenet 21:383-6 1994. (View abstract)
Larhammar D et al. Proc Natl Acad Sci U S A 82:1475-9 1985. (View abstract)
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Confirmed
Cells: 2 Laboratories: 2
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (0 aa)
Nucleotide Sequence Data (797 bps)
ATGGTGTGTCTGAAGCCCCCTGGAGGCTCCTGCATGGCAGCTCTGACAGTGACACTGATGGTGCTGAGCTCCCCACTGGC
TTTGGCTGGGGACACCCGACCACGTTTCTTGGAGCAGGCTAAGTCTGAGTGTCATTTCTTCAATGGGACGGAGCGGTACC
TGTAAAGATACTTCTATAACCAAGAGGAGTACGTGCGCTTCAACAGCGACATGGGGGAGTTCCGGGCGGTGACTGAGCTG
GGGCGGCCTGACGCTGAGTACTGGAACAGCCAGAAGGACATCCTGGAGCAGAAGCGGGCCGAAGTGGACAACTAATGCAG
ACACAACTATGGGGTTGTGGAGAGATTCACAGTGCAGCGGCGAATCCAACCTAAGGTGACTGTGTATCCTTCAAAAGACC
AGCCCCTGCAGCACCACAACCTCCTGGTCTGCTCTGTGAGTGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCAG
AATGGCCAGGAAGAGAAGGCTGGGGTGGTGTCCACAGGCCTGATCCAGAATGGAGACTGGACCTTCCAGACCCTGGTGAT
GCTGGAAACAGTTCCTCAGAATGCAGAGGTTTACACCTGTCAACTGGAGCACCCAAGCATGATGAGCCTTCTCATGCAGT
GGAATGGAGAGCATGGTCTGAATCTGCACAGAGCAAGATGCTGAGTGGAGTCGGGGGCTTCGTGCTGGGCCTGCTCTTCC
TTGGGGCCGGGCTGTTCATCTACTTCAGGAATCAGAAAGGACACTCTGGACTTCAACCAACAGGACTCCTGAGCTGA
Genomic Sequence Data (0 bps)
Not Currently Available

IMGT/HLA

Sponsors

Animated Sponsors Logo