Allele Report for DRB4*01:03:01:02N

DRB4*01:03:01:02N View HGVS Report
Pre-2010 Nomenclature: DRB4*01030102N Local Names: DRB4*0103102N, DRB4 null
IMGT/HLA Acc No: HLA00909 OMIM Entry: Not Listed
Assigned: 1996-12-12 Sequence Last Modified: 2003-07-12
Source Entries: D89918 , M30694  
Cells Sequence Derived From: DBB  
Known Ethnic Origin Of Source: Caucasoid
CWD v2.0 Status: Common
Publications
Sutton VR et al. Immunogenetics 31:112-7 1990. (View abstract)
Naruse TK et al. Tissue Antigens 49:152-9 1997. (View abstract)
Confirmatory Data
Sequence Status: Partial CDS Confirmed: Confirmed
Cells: 1 Laboratories: 2
HLA Dictionary Data
Expert Assigned Type: Not expressed WHO Assigned Type: Null
Tested by: No. Cells Tested: Assigned Type:
International Cell Exchange UCLA (2008) 23 Refer to Comments
NMDP (2008) Not tested Not tested
13 IHWC (2002) Not tested Not tested
Neural Network Assigned Type: DR53 [20-54], false positive assignments
Comments:
Protein Sequence (0 aa)
Nucleotide Sequence Data (489 bps)
CACGTTTCTTGGAGCAGGCTAAGTGTGAGTGTCATTTCCTCAATGGGACGGAGCGAGTGTGGAACCTGATCAGATACATC
TATAACCAAGAGGAGTACGCGCGCTACAACAGTGACCTGGGGGAGTACCAGGCGGTGACGGAGCTGGGGCGGCCTGACGC
TGAGTACTGGAACAGCCAGAAGGACCTCCTGGAGCGGAGGCGGGCCGAGGTGGACACCTACTGCAGATACAACTACGGGG
TTGTGGAGAGCTTCACAGTGCAGCGGCGAGAAAGACCCAGCCCCTGCAGCACCACAACCTCCTGGTCTGCTCTGTGAATG
GTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCGGAACGGCCAGGAAGAGAAGGCTGGGGTGGTGTCCACAGGCCTG
ATCCAGAATGGAGACTGGACCTTCCAGACCCTGGTGATGCTGGAAACAGTTCCTCGGAGTGGAGAGGTTTACACCTGCCA
AGTGGAGCA
Genomic Sequence Data (0 bps)
Not Currently Available

IMGT/HLA

Sponsors

Animated Sponsors Logo