Allele Report for DRB1*07:26N

DRB1*07:26N View HGVS Report
Pre-2010 Nomenclature: Local Names: HLA-DRB1
IMGT/HLA Acc No: HLA09680 OMIM Entry: *142857
Assigned: 2013-05-29 Sequence Last Modified: 2015-01-19
Source Entries: HF937425  
Cells Sequence Derived From: DKMS-LSL-DRB1-41  
Known Ethnic Origin Of Source: Unknown
CWD v2.0 Status: Not defined
ISO OID: 2.16.840.1.113883.13.252 (HL7 Registered Organisational OID)
2.16.840.1.113883.13.252.1.1.9680 (Allele OID)
Publications
Unpublished
Confirmatory Data
Sequence Status: Partial CDS Confirmed: Confirmed
Cells: 1 Laboratories: 2
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (28 aa)
RFLWQGKYKCHFFNGTERVQFLEKTLLX
Nucleotide Sequence Data (553 bps)
CACGTTTCCTGTGGCAGGGTAAGTATAAGTGTCATTTCTTCAACGGGACGGAGCGGGTGCAGTTCCTGGAAAAGACTCTT
CTATAACCAGGAGGAGTTCGTGCGCTTCGACAGCGACGTGGGGGAGTACCGGGCGGTGACGGAGCTAGGGCGGCCTGTCG
CCGAGTCCTGGAACAGCCAGAAGGACATCCTGGAGGACAGGCGGGGCCAGGTGGACACCGTGTGCAGACACAACTACGGG
GTTGGTGAGAGCTTCACAGTGCAGCGGCGAGTCCATCCTGAGGTGACTGTGTATCCTGCCAAGACTCAGCCCCTGCAGCA
CCACAACCTCCTGGTCTGCTCTGTGAGTGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCGGAACGGCCAGGAAG
AGAAGGCTGGGGTGGTGTCCACAGGCCTGATCCAGAATGGAGACTGGACCTTCCAGACCCTGGTGATGCTGGAAACAGTT
CCTCGGAGTGGAGAAGTTTACACCTGCCAAGTGGAGCACCCAAGTGTGATGAGCCCTCTCACAGTGGAATGGA
Genomic Sequence Data (0 bps)
Not Currently Available

IMGT/HLA

Sponsors

Animated Sponsors Logo