Allele Report for DRB1*07:10N

DRB1*07:10N View HGVS Report
Pre-2010 Nomenclature: DRB1*0710N Local Names: DRB1*07ERN0405N
IMGT/HLA Acc No: HLA02203 OMIM Entry: *142857
Assigned: 2005-05-31 Sequence Last Modified: 2005-07-12
Source Entries: AJ968418  
Cells Sequence Derived From: Z-00013883  
Known Ethnic Origin Of Source: Unknown
Publications
Eiz-Vesper B et al. Immunogenetics 59:507-10 2007. (View abstract)
Confirmatory Data
Sequence Status: Partial CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
HLA Dictionary Data
Expert Assigned Type: Not expressed WHO Assigned Type: Null
Tested by: No. Cells Tested: Assigned Type:
International Cell Exchange UCLA (2008) - -
NMDP (2008) - -
13 IHWC (2002) Not tested Not tested
Neural Network Assigned Type: Not tested
Comments:
Protein Sequence (27 aa)
RFLWQGKYKCHFFNGTERVQFLERLLX
Nucleotide Sequence Data (268 bps)
CACGTTTCCTGTGGCAGGGTAAGTATAAGTGTCATTTCTTCAACGGGACGGAGCGGGTGCAGTTCCTGGAAAGACTTCTA
TAACCAGGAGGAGTTCGTGCGCTTCGACAGCGACGTGGGGGAGTACCGGGCGGTGACGGAGCTAGGGCGGCCTGTCGCCG
AGTCCTGGAACAGCCAGAAGGACATCCTGGAGGACAGGCGGGGCCAGGTGGACACCGTGTGCAGACACAACTACGGGGTT
GGTGAGAGCTTCACAGTGCAGCGGCGAG
Genomic Sequence Data (0 bps)
Not Currently Available

IMGT/HLA

Sponsors

Animated Sponsors Logo