Allele Report for C*03:20N

C*03:20N View HGVS Report
Pre-2010 Nomenclature: Cw*0320N Local Names: Cw*03NE
IMGT/HLA Acc No: HLA02346 OMIM Entry: *142840
Assigned: 2005-09-23 Sequence Last Modified: 2005-10-07
Source Entries: DQ188807  
Cells Sequence Derived From: CTM5745799  
Known Ethnic Origin Of Source: Caucasoid
Publications
Unpublished
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
HLA Dictionary Data
Expert Assigned Type: Not expressed WHO Assigned Type: Null
Tested by: No. Cells Tested: Assigned Type:
International Cell Exchange UCLA (2008) - -
NMDP (2008) - -
13 IHWC (2002) - -
Neural Network Assigned Type: Not tested
Comments:
Protein Sequence (7 aa)
MRVMAPX
Nucleotide Sequence Data (1101 bps)
ATGCGGGTCATGGCGCCCTGAACCCTCATCCTGCTGCTCTCGGGAGCCCTGGCCCTGACCGAGACCTGGGCCGGCTCCCA
CTCCATGAGGTATTTCTACACCGCTGTGTCCCGGCCCGGCCGCGGGGAGCCCCACTTCATCGCAGTGGGCTACGTGGACG
ACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGG
CCGGAGTATTGGGACCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGG
CTACTACAACCAGAGCGAGGCCAGGTCTCACATCATCCAGAGGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCCTCC
TCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGATCTGCGCTCCTGGACCGCCGCG
GACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCT
GTGCGTGGAGTGGCTCCGCAGATACCTGAAGAATGGGAAGGAGACGCTGCAGCGCGCGGAACACCCAAAGACACACGTGA
CCCACCATCCCGTCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACC
TGGCAGTGGGATGGGGAGGACCAAACTCAGGACACTGAGCTTGTGGAGACCAGGCCAGCAGGAGATGGAACCTTCCAGAA
GTGGGCAGCTGTGGTGGTGCCTTCTGGAGAAGAGCAGAGATACACGTGCCATGTGCAGCACGAGGGGCTGCCGGAGCCCC
TCACCCTGAGATGGGAGCCGTCTTCCCAGCCCACCATCCCCATCGTGGGCATCGTTGCTGGCCTGGCTGTCCTGGCTGTC
CTAGCTGTCCTAGGAGCTGTGGTGGCTGTTGTGATGTGTAGGAGGAAGAGCTCAGGTGGAAAAGGAGGGAGCTGCTCTCA
GGCTGCGTCCAGCAACAGTGCCCAGGGCTCTGATGAGTCTCTCATCGCTTGTAAAGCCTGA
Genomic Sequence Data (3321 bps)
CGGGGCTCTCAGGGTCTCAGGCTCCAAGGGCCGTGTCTGCACTGGGGAGGCGCCGCGTTGAGGATTCTCCACTCCCCTGA
GTTTCACTTCTTCTCCCAACCTGCGTCGGGTCCTTCTTCCTGAATACTCATGACGCGTCCCCAATTCCCACTCCCATTGG
GTGTCGGATTCTAGAGAAGCCAATCAGCGTCTCCGCAGTCCCGGTTCTGAAGTCCCCAGTCACCCACCCGGACTCAGATT
CTCCCCAGACGCCGAGATGCGGGTCATGGCGCCCTGAACCCTCATCCTGCTGCTCTCGGGAGCCCTGGCCCTGACCGAGA
CCTGGGCCGGTGAGTGCGGGGTTGGGAGGGAATCGGCCTCTGCGGAGAGGAGCGAGGGGCCCGCCCGGCGAGGGCGCAGG
ACCCGGGGAGCCGCGCAGGGAGGAGGGTCGGGCGGGTCTCAGCCCCTCCTCGCCCCCAGGCTCCCACTCCATGAGGTATT
TCTACACCGCTGTGTCCCGGCCCGGCCGCGGGGAGCCCCACTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGTG
CGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGA
CCGGGAGACACAGAAGTACAAGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGA
GCGAGGCCAGTGAGTGACCCCGGCCCGGGGCGCAGGTCACGACCCCTCCTCATCCCCCACGGACGGCCCGGGTCGCCCCA
AGTCTCCCGGTCTGAGATCCACCCCGAGGCTGCGGAACCCGCCCAGACCCTCGACCGGAGAGAGCCCCAGTCACCTTTAC
CCGGTTTCATTTTCAGTTTAGGCCAAAATCCCCGCGGGTTGGTCGGGGCGGGGCGGGGCTCGGGGGACGGGGCTGACCGC
GGGGGCGGGGCCAGGGTCTCACATCATCCAGAGGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCCTCCTCCGCGGGT
ATGACCAGTACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGATCTGCGCTCCTGGACCGCCGCGGACACGGCG
GCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGA
GTGGCTCCGCAGATACCTGAAGAATGGGAAGGAGACGCTGCAGCGCGCGGGTACCAGGGGCAGTGGGGAGCCTTCCCCAT
CTCCTGTAGATCTCCCGGGATGGCCTCCCACGAGGAGGGGAGGAAAATGGGATCAGCGCTAGAATATCGCCCTCCCTTGA
ATGGAGAATGGGATGAGTTTTCCTGAGTTTCCTCTGAGGGCCCCCTCTGCTCTCTAGGACAATTAAGGGATGAAGTCCTT
GAGGAAATGGAGGGGAAGACAGTCCCTAGAATACTGATCAGGGGTCCCCTTTGACCACTTTGACCACTGCAGCAGCTGTG
GTCAGGCTGCTGACCTTTCTCTCAGGCCTTGTTCTCTGCCTCACGCTCAATGTGTTTGAAGGTTTGATTCCAGCTTTTCT
GAGTCCTTCGGCCTCCACTCAGGTCAGGACCAGAAGTCGCTGTTCCTCCCTCAGAGACTAGAACTTTCCAATGAATAGGA
GATTATCCCAGGTGCCTGTGTCCAGGCTGGCGTCTGGGTTCTGTGCCCCCTTCCCCACCCCAGGTGTCCTGTCCGTTCTC
AGGATGGTCACATGGGCGCTGTTGGAGTGTCGCAAGAGAGATACAAAGTGTCTGAATTTTCTGACTCTTCCCGTCAGAAC
ACCCAAAGACACACGTGACCCACCATCCCGTCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCT
GCGGAGATCACACTGACCTGGCAGTGGGATGGGGAGGACCAAACTCAGGACACTGAGCTTGTGGAGACCAGGCCAGCAGG
AGATGGAACCTTCCAGAAGTGGGCAGCTGTGGTGGTGCCTTCTGGAGAAGAGCAGAGATACACGTGCCATGTGCAGCACG
AGGGGCTGCCGGAGCCCCTCACCCTGAGATGGGGTAAGGAGGGGGATGAGGGGTGATGTGTCTTCTCAGGGAAAGCAGAA
GTCCTGGAGCCCTTCAGCCAGGTCAGGGCTGAGGCTTGGGGGTCAGGGCCCCTCACCTTCCCCTCCTTTCCCAGAGCCGT
CTTCCCAGCCCACCATCCCCATCGTGGGCATCGTTGCTGGCCTGGCTGTCCTGGCTGTCCTAGCTGTCCTAGGAGCTGTG
GTGGCTGTTGTGATGTGTAGGAGGAAGAGCTCAGGTAGGGAAGGGGTGAGGAGTGGGGTCTGGGTTTTCTTGTTCCACTG
GGAGTTTCAAGCCCCAGGTAGAAGTGTGCCCCACCTCGTTACTGGAAGCACCATCCACACATGGGCCATCCCAGCCTGGG
ACCCTGTGTGCCAGCACTTACTCTGTTGTGAAGCACATGACAATGAAGGACAGATGTATCACCTTGATGATTATGGTGTT
GGGGTCCTTGATTCCAGCATTCATGAGTCAGGGGAAGGTCCCTGCTAAGGACAGACCTTAGGAGGGCAGTTGCTCCAGAA
CCCACAGCTGCTTTCCCCGTGTTTCCTGATCCTGCCCTGGGTCTGCAGTCATAGTTCTGGAAACTTCTCTTGGGTCCAAG
ACTAGGAGGTTCCCCTAAGATCGCATGGCCCTGACTCCTCCCTGTCCCCTCACAGGGCATTTTCTTCCCACAGGTGGAAA
AGGAGGGAGCTGCTCTCAGGCTGCGTGTAAGTGATGGCGGTGGGCGTGTGGAGGAGCTCACCCACCCCATAATTCCTCTT
GTCCCACATCTCCTGCGGGCTCTGACCAGGTCTTTTTTTTTGTTCTACCCCAGCCAGCAACAGTGCCCAGGGCTCTGATG
AGTCTCTCATCGCTTGTAAAGGTGAGATTCTGGGGAGCTGAAGTGGTCGGGGGTGGGGCAGAGGGAAAAGGCCTAGGTAA
TGGGGATCCTTTGATTGGGACGTTTCGAATGTGTGGTGAGCTGTTCAGAGTGTGATCACTTACCATGACTGACCTGAATT
TGTTCATGACTATTGTGTTCTGTAGCCTGAGACAGCTGCCTGTGTGGGACTGAGATGCAGGATTTCTTCACACCTCTCCT
TTGTGACTTCAAGAGCCTCTGGCATCTCTTTCTGCAAAGGCATCTGAATGTGTCTGCGTTCCTGTTAGCATAATGTGAGG
AGGTGGACAGACAGCCCACCCCCGTGTCCACCGTGACCCCT

IMGT/HLA

Sponsors

Animated Sponsors Logo