Allele Report for B*18:17N

B*18:17N View HGVS Report
Pre-2010 Nomenclature: B*1817N Local Names: hla-b*1801 null
IMGT/HLA Acc No: HLA01532 OMIM Entry: *142830
Assigned: 2001-09-30 Sequence Last Modified: 2001-10-26
Source Entries: AF416771  
Cells Sequence Derived From: avan , wvan  
Known Ethnic Origin Of Source: Caucasoid
CWD v2.0 Status: Not defined
Publications
den Hollander N et al. Tissue Antigens 59:341-3 2002. (View abstract)
Confirmatory Data
Sequence Status: Complete CDS Confirmed: Confirmed
Cells: 2 Laboratories: 1
HLA Dictionary Data
Expert Assigned Type: Not expressed WHO Assigned Type: Null
Tested by: No. Cells Tested: Assigned Type:
International Cell Exchange UCLA (2008) - -
NMDP (2008) - -
13 IHWC (2002) - -
Neural Network Assigned Type: Not tested
Comments:
Protein Sequence (14 aa)
MRVTAPRTLLLLLX
Nucleotide Sequence Data (1089 bps)
ATGCGGGTCACGGCGCCCCGAACCCTCCTCCTGCTGCTCTAGGGGGCAGTGGCCCTGACCGAGACCTGGGCTGGCTCCCA
CTCCATGAGGTATTTCCACACCTCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCTCAGTGGGCTACGTGGACG
GCACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGACGGAGCCCCGGGCGCCGTGGATAGAGCAAGAGGGG
CCGGAGTATTGGGACCGGAACACACAGATCTCCAAGACCAACACACAGACTTACCGAGAGAGCCTGCGGAACCTGCGCGG
CTACTACAACCAGAGCGAGGCCGGGTCTCACACCCTCCAGAGGATGTACGGCTGCGACGTGGGGCCGGACGGGCGCCTCC
TCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCG
GACACCGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCAC
GTGCGTGGAGTGGCTCCGCAGACACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGGACCCCCCAAAGACACATGTGA
CCCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTGGGCTTCTACCCTGCGGAGATCACACTGACC
TGGCAGCGGGATGGCGAGGACCAAACTCAGGACACCGAGCTTGTGGAGACCAGACCAGCAGGAGATAGAACCTTCCAGAA
GTGGGCAGCTGTGGTGGTGCCTTCTGGAGAAGAGCAGAGATACACATGCCATGTACAGCATGAGGGGCTGCCGAAGCCCC
TCACCCTGAGATGGGAGCCATCTTCCCAGTCCACCATCCCCATCGTGGGCATTGTTGCTGGCCTGGCTGTCCTAGCAGTT
GTGGTCATCGGAGCTGTGGTCGCTACTGTGATGTGTAGGAGGAAGAGCTCAGGTGGAAAAGGAGGGAGCTACTCTCAGGC
TGCGTCCAGCGACAGTGCCCAGGGCTCTGATGTGTCTCTCACAGCTTGA
Genomic Sequence Data (2979 bps)
GATCAGGACGAAGTCCCAGGCCCCGGGCGGGGCTCTCAGGGTCTCAGGCTCCGAGAGCCTTGTCTGCATTGGGGAGGCGC
AGCATTGGGGATTCCCCACTCCCACGAGTTTCACTTCTTCTCCCAACCTATGTCGGGTCCTTCTTCCAGGATACTCGTGA
CGCGTCCCCATTTCCCACTCCCATTGGGTGTCGGGTGTCTAGAGAAGCCAATCAGTGTCGCCGGGGTCCCAGTTCTAAAG
TCCCCACGCACCCACCCGGACTCAGAATCTCCTCAGACGCCGAGATGCGGGTCACGGCGCCCCGAACCCTCCTCCTGCTG
CTCTAGGGGGCAGTGGCCCTGACCGAGACCTGGGCTGGTGAGTGCGGGGTCGGCAGGGAAATGGCCTCTGTGGGGAGGAG
CGAGGGGACCGCAGGCGGGGGCGCAGGACCCGGGGAGCCGCGCCGGGAGGAGGGTCGGGCGGGTCTCAGCCCCTCCTTGC
CCCAGGCTCCCACTCCATGAGGTATTTCCACACCTCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCTCAGTGG
GCTACGTGGACGGCACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGACGGAGCCCCGGGCGCCGTGGATA
GAGCAAGAGGGGCCGGAGTATTGGGACCGGAACACACAGATCTCCAAGACCAACACACAGACTTACCGAGAGAGCCTGCG
GAACCTGCGCGGCTACTACAACCAGAGCGAGGCCGGTGAGTGACCCCGGCCCGGGGCGCAGGTCACGACTCCCCATCCCC
CACGTACGGCCCGGGTCGCCCCGAGTCTCCGGGTCCGAGATCCGCCCCCCTGAGGCCGCGGGACCCGCCCAGACCCTCGA
CCGGCGAGAGCCCCAGGCGCGTTTACCCGGTTTCATTTTCAGTTGAGGCCAAAATCCCCGCGGGTTGGTCGGGGCGGGGC
GGGGCTCGGGGGGACGGGGCTGACCGCGGGGCCGGGGCCAGGGTCTCACACCCTCCAGAGGATGTACGGCTGCGACGTGG
GGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTG
AGCTCCTGGACCGCGGCGGACACCGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGGCGGAGCAGCTGAG
AGCCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGACACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGGGTA
CCAGGGGCAGTGGGGAGCCTTCCCCATCTCCTATAGGTCGCCGGGGATGGCCTCCCACGAGAAGAGGAGGAAAATGGGAT
CAGCGCTAGAATGTCGCCCTCCCTTGAATGGAGAATGGCATGAGTTTTCCTGAGTTTCCTCTGAGGGCCCCCTCTTCTCT
CTAGGACAATTAAGGGATGACGTCTCTGAGGAAATGGAGGGGAAGACAGTCCCTAGAATACTGATCAGGGGTCCCCTTTG
ACCCCTGCAGCAGCCTTGGGAACCATGACTTTTCCTCTCAGGCCTTGTTCTCTGCCTCACACTCAGTGTGTTTGGGGCTC
TGATTCCAGCACTTTTGAGTCACTTTACCTCCACTCAGATCAGGAGCAGAAGTCTCTGTTCCCCGCTCAGAGACTCGAAC
TTTCCAATGAATAGATTATCCCAGGTGCCTGCGTCCAGGCTGGTGTTTGGGTTCTGTGCCCCTTCCCCACCCCAGGTGTC
CTGTCCATTCTCAGGCTGGTCACATGGGTGGTCCTAGGGTGTCCCATGAGAGATGCAAAGCGCCTGAATTTTCTGACTCT
TCCCATCAGACCCCCCAAAGACACATGTGACCCACCACCCCATCTCTGACCATGAGGCCACCCTGAGGTGCTGGGCCCTG
GGCTTCTACCCTGCGGAGATCACACTGACCTGGCAGCGGGATGGCGAGGACCAAACTCAGGACACCGAGCTTGTGGAGAC
CAGACCAGCAGGAGATAGAACCTTCCAGAAGTGGGCAGCTGTGGTGGTGCCTTCTGGAGAAGAGCAGAGATACACATGCC
ATGTACAGCATGAGGGGCTGCCGAAGCCCCTCACCCTGAGATGGGGTAAGGAGGGGGATGAGGGGTCATATCTCTTCTCA
GGGAAAGCAGGAGCCCTTCTGGAGCCCTTCAGCAGGGTCAGGGCCCCTCATCTTCCCCTCCTTTCCCAGAGCCATCTTCC
CAGTCCACCATCCCCATCGTGGGCATTGTTGCTGGCCTGGCTGTCCTAGCAGTTGTGGTCATCGGAGCTGTGGTCGCTAC
TGTGATGTGTAGGAGGAAGAGCTCAGGTAGGGAAGGGGTGAGGGGTGGGGTCTGGGTTTTCTTGTCCCACTGGGGGTTTC
AAGCCCCAGGTAGAAGTGTTCCCTGCCTCATTACTGGGAAGCAGCATCCACACAGGGGCTAACACAGCCTGGGACCCTGT
GTGCCAGCACTTACTCTTTTGTGCAGCACATGTGACAATGAAGGACGGATGTATCACCTTGATGGTTGTGGTGTTGGGGT
CCTGATTCCAGCATTCATGAGTCAGGGGAAGGTCCCTGCTAAGGACAGACCTTAGGAGGGCAGTTGGTCCAGGACCCACA
CTTGCTTTCCTCGTGTTTCCTGATCCTGCCTTGGGTCTGTAGTCATACTTCTGGAAATTCCTTTTGGTTCCAAGACGAGG
AGGTTCCTCTAAGATCTCATGGCCCTGCTTCCTCCCAGTCCCCTCACAGGACATTTTCTTCCCACAGGTGGAAAAGGAGG
GAGCTACTCTCAGGCTGCGTGTAAGTGGTGGGGGTGGGAGTGTGGAGGAGCTCACCCACCCCATAATTCCTCCTGTCCCA
CGTCTCCTGCGGGCTCTGACCAGGTCCTGTTTTTGTTCTACTCCAGCCAGCGACAGTGCCCAGGGCTCTGATGTGTCTCT
CACAGCTTGAAAAGGTGAG

IMGT/HLA

Sponsors

Animated Sponsors Logo