Allele Report for A*11:99N

A*11:99N View HGVS Report
Pre-2010 Nomenclature: Local Names: bankit1417955
IMGT/HLA Acc No: HLA06375 OMIM Entry: *142800
Assigned: 2011-01-31 Sequence Last Modified: 2011-04-08
Source Entries: HQ733854  
Cells Sequence Derived From: 2201022199003090722  
Known Ethnic Origin Of Source: Oriental
Publications
Unpublished
Confirmatory Data
Sequence Status: Partial CDS Confirmed: Unconfirmed
Cells: 1 Laboratories: 1
HLA Dictionary Data
Not currently included in the HLA Dictionary Data
Protein Sequence (26 aa)
SHSMRYFYTSVSRPGRGEPRFIAVGX
Nucleotide Sequence Data (545 bps)
GCTCCCACTCCATGAGGTATTTCTACACCTCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTAG
TGGACGACACGCAGTTCGTGCGGTTCGACAGCGACGCCGCGAGCCAGAGGATGGAGCCGCGGGCGCCGTGGATAGAGCAG
GAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATGTGAAGGCCCAGTCACAGACTGACCGAGTGGACCTGGGGACCCT
GCGCGGCTACTACAACCAGAGCGAGGACGGTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGC
GCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGCGCTCTTGGACC
GCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGCCCATGCGGCGGAGCAGCAGAGAGCCTACCTGGA
GGGCCGGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG
Genomic Sequence Data (0 bps)
Not Currently Available

IMGT/HLA

Sponsors

Animated Sponsors Logo