 |
|
Disease TablesDiseases and their association with the AltSplice database are shown in this web document or can be downloaded/viewed as a Microsoft Word document (180kb). The associated disease entries and OMIM records are hyperlinked.We are trying to keep this list up to date. If your disease is missing, please contact Stefan Stamm.
>Name of the disease:Metachromatic leukodystrophy
OMIM accession:250100
Keywords:MLD,METACHROMATIC LEUKOENCEPHALOPATHY CEREBRAL SCLEROSIS,
DIFFUSE, METACHROMATIC FORM SULFATIDE LIPIDOSIS ARYLSULFATASE A DEFICIENCY ARSA
DEFICIENCY CEREBROSIDE SULFATASE DEFICIENCY PSEUDOARYLSULFATASE A DEFICIENCY,
INCLUDED METACHROMATIC LEUKODYSTROPHY, LATE INFANTILE,
INCLUDED METACHROMATIC LEUKODYSTROPHY, JUVENILE,
INCLUDED METACHROMATIC LEUKODYSTROPHY, ADULT, INCLUDED
Effect on splicing:1/disrupting a potential exonic splicing enhancer (ESE) and causing a complete exon 7
skipping.
2/27-nucleotide
deletion from the usual exon 8 splice acceptor site
of Arylsulfatase A, rare case of an exon mutation affecting splice site selection
Exon sequence:AGCCCTCGGCAGTCTCTCTTCTTCTACCCGTCCTACCCAGACGAGGTCCGTGGGGTTTTTGCTGT
GCGGACTGGAAAGTACAAGGCTC
ACTTCTTCACCCAGG
EMBL accession:S68669
RefSeq accession:NM_000487
AEDB accession:
AEDB motif accession:
AEDB function accession:
AltSplice accession: ENSG00000100299
Disease causing mechanism:exonic mutation
Wild type sequence:GACGAGGT
Mutated sequence:GACAAGGT
Effect on exon usage:Exon-> intron (exon 7 skipping mutation in exon: 1144 G/A, 2330 C/T)
1) 1144G>A
mutation was located in the middle of exon 7 and
previously assumed to be deleterious by causing an amino acid change, E382K
2) designated 2330T C-to-T substitution, 22 nucleotides
downstream from the exon 8 splice acceptor site.2)
References: 1) ASA E382K disrupts a potential exonic splicing enhancer and causes exon skipping, but missense mutations in ASA are not associated with ESEs. Shotelersuk V, Desudchit T, Tongkobpetch S Int J Mol Med. 2004 Oct;14(4):683-9.
PID: 15375602
2) Single exon mutation in arylsulfatase A gene has two effects: loss of enzyme activity and aberrant splicing.Hasegawa Y, Kawame H, Ida H, Ohashi T, Eto Y. Hum Genet. 1994 Apr;93(4):415-20. PID : 7909527
3) Heinisch, U.; Zlotogora, J.; Kafert, S.; Gieselmann, V.Multiple mutations
are responsible for the high frequency of metachromatic leukodystrophy in a small geographic area. Am. J.
Hum. Genet. 56: 51-57, 1995. Description:Metachromatic leukodystrophy (MLD), a lysosomal storage disease caused by the
deficiency of arylsulfatase A (ASA)
Clinical features:Clinical features are motor symptoms, rigidity,
mental deterioration, and sometimes convulsions. Early development is normal
but onset occurs before 30 months of age. In the adult form of metachromatic leukodystrophy,
initial symptoms, which begin after age 16, have usually been psychiatric,
leading to a diagnosis of schizophrenia. Disorders of movement and posture
appear late.
Incidence:Although MLD occurs panethnically,
with an estimated frequency of 1/40,000, (2) found it to be more frequent among
Arabs living in 2 restricted areas in
Internet links for the disease:http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=250100
END
>Name of the disease:Menkes Disease
OMIM accession:309400
Keywords:MK,MNK,MENKEA SYNDROME,KINKY HAIR DISEASE,STEELY HAIR
DISEASE,COPPER TRANSPORT DISEASE
Effect on splicing:Skipping of exons 20 and
21
Exon sequence:AATGATCTTCTGGATGTAGTGGCAAGTATTGACTTATCAAGAgAGACAGTCAA
GAGGATTCGGATAAATTTTGTCTTTGCTCTAATTTATAATCTGGTTGGAATTCCCATAGCTGCTG
EMBL accession:
RefSeq accession:
AEDB accession:
AEdB motif accession:
AEdB function accession:
Altsplice accession:ENSMUSG00000033792
Disease causing mechanism:Genetic disorder in which copper maldistribution is the basic matebolic effect. Most of the phenoptypic features of the
disorder can be explained by malfunctioning of several-copper-dependent enzymes
caused by a general copper deficiency.
Wild type sequence:
Mutated sequence:
Effect on exon usage:Exon-> intron
References:1)Gu, Y.-H.; Kodama, H.;
Murata, Y.; Mochizuki, D.; Yanagawa, Y.; Ushijima,
H.; Shiba, T.; Lee, C.-C. : ATP7A gene
mutations in 16 patients with Menkes disease and a
patient with occipital horn syndrome. Am. J. Med. Genet. 99: 217-222, 2001.
PID: 11241493
Description:Menkes disease is
an X-linked recessive disorder resulting in a connective-tissue disturbance and
profound neurodegeneration in early childhood. The
gene for Menkes disease has been isolated and
predicted to code for copper transporting ATPase.X-linked recessive disorder characterized by
early retardation in growth, peculiar hair, and focal cerebral and cerebellar degeneration. Severe neurologic impairment began within a month or two of birth and progressed rapidly to decerebration.
Clinical features:In addition to the severe classic form of MD leading to
death in early childhood, milder forms are observed in
Incidence:
Internet links for the disease:http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=309400
END
>Name of the disease:Protein tyrosine phosphatase receptor type C (PTPRC) -> Susceptibility
to Multiple Sclerosis (MS)
OMIM accession:151460
Keywords: Leukocyte-common
antigen,LCA,T200 glycoprotein
Effect on splicing: Constitutive inclusion of exon 4
Exon sequence: GGCAAAGCCCAACACCTTCCCCCACTG
EMBL accession:
RefSeq accession:
AEDB accession:
AEdB motif accession:
AEdB function accession:
Altsplice accession:
Disease causing
mechanism: In a patient with multiple sclerosis (MS), a heterozygous C-to-G transversion at nucleotide 77 of exon 4 of the PTPRC gene was identified. Although the mutation does not change the
encoded amino acids, it prohibits splicing of exon 4
pre-mRNA.
Wild type sequence:AGCCCAACA
Mutated sequence:AGCCGAACA
Effect on exon usage: alternative exon constitutive exon
References: 1) Thude, H., Hundrieser, J., Wonigeit, K. and Schwinzer, R. (1995) A point mutation in the human CD45
gene associated with defective splicing of exon A. Eur. J. Immunol., 25, 2101-21016.PID : 7621884
2) Jacobsen, M., Schweer, D., Ziegler, A., Gaber,
R., Schock, S., Schwinzer,
R., Wonigeit, K., Lindert,
R.B., Kantarci, O., Schaefer-Klein, J., Schipper, H.I., Oertel, W.H., Heidenreich, F., Weinshenker,
B.G., Sommer, N. and Hemmer, B. (2000) A point
mutation in PTPRC is associated with the development of multiple sclerosis.
Nat. Genet., 26, 495-499.PID : 11101853
3) Lynch, K.W. and
Weiss, A. (2001) A CD45 Polymorphism Associated with Multiple Sclerosis
Disrupts an Exonic Splicing Silencer. J. Biol. Chem.,
276, 24341-24347.PID: 11306584
4).Ballerini, C., Rosati, E., Salvetti, M., Ristori, G., Cannoni, S., Biagioli, T., Massacesi, L., Sorbi, S. and Vergelli, M. (2002) Protein tyrosine phosphatase receptor-type C exon 4 gene mutation distribution in
an Italian multiple sclerosis population. Neurosci. Lett., 328, 325-327.PID: 12147336
5) Vyshkina, T., Leist, T.P., Shugart, Y.Y. and Kalman, B.
(2004) CD45 (PTPRC) as a candidate gene in multiple sclerosis. Mult. Scler., 10, 614-617.PID: 15584483
6) Miterski, B., Sindern, E., Haupts, M., Schimrigk, S. and Epplen, J. (2002) PTPRC (CD45) is not associated with
multiple sclerosis in a large cohort of German patients. BMC Medical Genetics,
3, 3.PID: 12028593
7) Cocco, E., Murru, M.R., Melis, C., Schirru, L., Solla, E., Lai, M., Rolesu, M.
and Marrosu, M.G. (2004) PTPRC (CD45) C77G mutation
does not contribute to multiple sclerosis susceptibility in Sardinian patients.
J. Neurol., 251, 1085-1088.PID: 15372250
8) Barcellos, L.F., Caillier, S., Dragone, L., Elder, M., Vittinghoff,
E., Bucher, P., Lincoln, R.R., Pericak-Vance, M.,
Haines, J.L., Weiss, A., Hauser, S.L. and Oksenberg,
J.R. (2001) PTPRC (CD45) is not associated with the development of multiple
sclerosis in U.S. patients. Nat. Genet., 29, 23-24.PID: 11528386
Description: Multiple sclerosis (MS) is the most common demyelinating disease of the central nervous system. It is
widely accepted that a dysregulated immune response
against brain resident antigens.
Clinical features:
Incidence:
Internet links for the disease:http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=151460
http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=126200
http://uwcmml1s.uwcm.ac.uk/uwcm/mg/search/119768.html
http://www.ensembl.org/Homo_sapiens/geneview?gene=ENSG00000081237
END
>Name of the disease: Spinal Muscular Atrophy
OMIM accession: 253300
Keywords: SMA I,SMA, INFANTILE ACUTE FORM MUSCULAR
ATROPHY,INFANTILE,WERDNIG-HOFFMANN DISEASE
Effect son splicing:The mutation probably inhibits Exonic splicing enhancers (ESE) within exon 7 (3) that is ultimately leading to skipping of exon 7.
Exon sequence: GGUUUCAGACAAAAUCAAAAAGAAGGAAGGUGCUCACAUUCCUUAAAUUAAGGA
EMBL accession:
RefSeq accession:
AEDB accession:
AEdB motif accession: 109, 237
AEdB function accession:
Altsplice accession: ENSG00000172062
Disease causing mechanism: exonic mutation. Typically
the mutations are caused by deletion within SMN1, or when SMN1 is replaced by
nearly identical copy named SMN2 (known as SMNc, SMNcen). The crusial difference
between these two proteins that SMN1 produces the full length protein whereas
SMN2 produces truncated, less stable protein, which has a reduced ability to oligomerize.(1,2) SMN2 carries a silent mutation in exon 7 (nucleotide transition C is substituted by T). This
silent mutation probably inhibits Exonic splicing
enhancers (ESE) within exon 7 (3) that is ultimately leading to skipping of exon 7.
Wild type sequence:GUUUCAGAC
Mutated sequence:GUUUTAGAC
Effect on exon usage: Exon-> intron
References: 1) Lorson CL, Androphy EJ. Hum Mol Genet. 2000 Jan 22;9(2):259-65
2) Lorson CL, Strasswimmer J,
3) Lorson, C.L., Hahnen, E.,Androphy,E.J., and Wirth,B. (1999)PNAS U.S.A 97, 9618-9623.
4) Lancet. (1980) Classification spinal muscular atrophies.8174, 919-922.
Description: The disorder causes weakness and wasting of the
voluntary muscles.The childhood of SMAs are all autosomal recessive
diseases. The adult onset of SMA affects lower motor neurons. Adult SMA may
begin between 40 and 60 years of age and progresses rapidly, with an average
life expectancy of about 5 years
Clinical features: SMA is autosomal reccesive neuromuscular disease characterized by
progressive lost of spinal cord motor neurons resulting in paralysis. The
disorder is characterized by degeneration of the anterior horn cells leading to
symmetrical muscle weakness and wasting of voluntary muscles.
Incidence: This is a second common fatal autosomal recessive disorder and the most frequent genetic cause of infantile death. The
disease has an incidense of 1 in 10.000 newborns (1).
Internet links for the disease: http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=253300
END
>Name of the disease: Adenosine deaminase deficiency
OMIM accession: 102700
Keywords: SCID (SEVERE COMBINED IMMUNODEFICIENCY), Adenosine deaminase
Effect on splicing: Skipping of exon 5,
generation of a Stop codon in the exon
Exon sequence: AGGGGACCTCACCCCAGACGAGGTGGTGGCCCTAGTGGGCCAGGGCC
TGCAGGAGGGGGAGCGAGACTTCGGGGTCAAGGCCCGGTCCATCCTGTGCTGCATGCG
CCACCAGCCCA
EMBL accession:
RefSeq accession:
AEDB accession:
AEdB motif accession: 153, 154
AEdB function accession:
Altsplice accession: ENSG00000065457
Disease causing mechanism: exonic mutation
Wild type sequence: GAGCGAGAC
Mutated sequence: GAGTGAGAC
Effect on exon usage: Exon-> intron
References: 1) Santisteban,
Description:
Clinical features: Inherited
Incidence:
Internet links for the disease: http://srs.wehi.edu.au/srs6bin/cgi-bin/wgetz?-id+4mK7x1PXK5U+e+[OMIM:'102700']
END
>Name of the disease: Cerebrotendinous xanthomatosis(CTX)
OMIM accession: 213700
Keywords: CTX,CEREBRAL CHOLESTERINOSIS
Effect on splicing: Creates a cryptic splice site. In addition it causes
skipping of the entire exon 2.
Exon sequence: GTGCTTTACAAGGCCAAGTACGGTCCAATGTGGATGTCCTACTTAGGGCCTCA
GATGCACGTGAACCTGGCCAGTGCCCCGCTCTTGGAGC
AAGTGATGCGGCAAGAGGGcAAGTACCCAGTACGGAACGACATGGAGCTATGGAAGGAGCACCGGGACCAGCACGACCTGACCTATGGGCCGTTCACCAC
EMBL accession: BC051851
RefSeq accession:
AEDB accession:
AEdB motif accession: 109, 237
AEdB function accession:
Altsplice accession: ENSG00000135929
Disease causing mechanism: exonic silent G to T
mutation at codon 112, 13 bp upstream from the 3' terminus of exon 2 in the CYP27A1 gene
(606530),
which encodes sterol 27-hydroxylase. Silent mutation resulted in alternative
pre-mRNA splicing by activating a cryptic 5' splice site around the mutant codon altsplice.
Wild type sequence: TATGGGCCG
Mutated sequence: TATGTGCCG
Effect on exon usage: Exon-> intron
References: Chen W, Kubota S, Teramoto T, Nishimura Y, Yonemoto K, Seyama Y. Silent nucleotide substitution in the sterol 27-hydroxylase gene (CYP 27)
leads to alternative pre-mRNA splicing by activating a cryptic 5' splice site
at the mutant codon in cerebrotendinous xanthomatosis patients. Biochemistry. 1998 Mar 31;37(13):4420-8.PID: 9521761
Description: Defects in CYP27A1 are the cause of cerebrotendinous xanthomatosis (CTX).
CTX is a rare sterol storage disorder characterized clinically by progressive neurologic dysfunction, premature atherosclerosis, and
cataracts. Cerebrotendinous xanthomatosis is a rare, inherited lipid-storage disease characterized clinically by progressive neurologic dysfunction (cerebellar ataxia beginning after puberty, systemic spinal cord involvement and a pseudobulbar phase leading to death), premature
atherosclerosis, and cataracts. Large deposits of cholesterol and cholestanol are found in virtually every tissue,
particularly the Achilles tendons, brain, and lungs. Cholestanol,
the 5-alpha-dihydro derivative of cholesterol, is enriched relative to
cholesterol in all tissues. The diagnosis can be made by demonstrating cholestanol in abnormal amounts in the serum and tendon of
persons suspected of being affected. Plasma cholesterol concentrations are low
normal in CTX patients
Clinical features: At 30s the patients demonstrate cerebellopyramidal signs, myoclonus of the soft palate, mental debility,
cataracts, xanthelasmata, and tendon xanthomata.
Incidence: Berginer and Abeliovich (1981) observed 6 patients from 3 Moroccan Sephardic Jewish families. In this
particular group they estimated the gene frequency to be 1 in 108.
Internet links for the disease: http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=213700
END
>Name of the disease: Sandhoff disease
OMIM accession: 268800
Keywords: GM2-GANGLIOSIDOSIS, TYPE II HEXOSAMINIDASES A AND B DEFICIENCY Effect on splicing: Inhibits normal
splicing and decrease the quantity of mRNA significantly and activate cryptic
splice site.
Exon sequence: CTTGCGCCGGGCACAATAGTTGAAGTATGGAAAGACAGCGCATATCCTGAGGA
ACTCAGTAGAGTCACAGCATCTGGCTTCCCTG
TAATCCTTTCTGCTCCTTGGTACTTAGATTTGATTAGCTATGGACAAGATTGGAGGAAATACTATAAAGTGGAACCTCTTGATTTTGGCG
EMBL accession: AH002718
RefSeq accession:
AEDB accession:
AEdB motif accession: 109, 237
AEdB function accession:
Altsplice accession: ENSG00000140495
Disease causing mechanism: Two mutations (1 in exon and another one in intron) do not affect the splice
acceptor consensus sequence or create any new acceptor splice sites, but
inhibit the normal splicing and activate the cryptic splice sites.
Wild type sequence:GCGCCGGGC
Mutated sequence: GCGCTGGGC
Effect on exon usage: C to T transition at +8 of exon 11(P417L) (exon 11, +8 CMT)
generates predominantly an abnormally spliced mRNA at base +112 of exon 11 and has been described in two patients with a
juvenile form of the disease. Exon-> intron
References: 1) Two mutations remote from an exon/intron junction in the β-hexosaminidase β-subunit
gene affect 3'-splice site selection and cause Sandhoff disease. Mutsuko Fujimaru , A. Tanaka , Kyuchul Choeh , Nobuaki Wakamatsu
, Hitoshi Sakuraba , Gen Isshiki.
Hum Genet. 1998 Oct;103(4):462-9.PID: NM_000521
Description: Sandhoff disease is a
progressive neurodegenerative disorder characterized by an accumulation of GM2 gangliosides, particularly in neurons, and is clinically
indistinguishable from Tay-Sachs disease (272800).A lysosomal storage disorder characterized by the
accumulation of lipids (GM2 gangliosides, globosides) in the central nervous system (CNS) and
peripheral tissues resulting in 2 clinical variants.
Clinical features: The clinical and pathologic picture is very similar
to Tay-Sachs disease. Weakness begins in the first 6
months of life. Startle reaction, early blindness, progressive mental and motor
deterioration, doll-like face, cherry red spots, and macrocephaly are all present as in Tay-Sachs disease. Death usually
occurs by age 3 years.
Incidence:
Internet links for the disease: http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=268800
END
>Name of the disease: Marfan syndrome, MFS
OMIM accession: 154700
Keywords: Fibrillin 1, FBN1
Effect on splicing: Exon skipping, NMD
Exon sequence: AGGCCTTCCGCCAGATATGTCCTTATGGAAGTGGGATCATCGTGGGAC
CTGATGATTCAGCAGTTG
EMBL accession: AH002718
RefSeq accession:
AEDB accession:
AEdB motif accession:
AEdB function accession:
Altsplice accession:
Disease causing mechanism: exonic mutation. Mutations:
Skipping of exon 51 is caused by T->G transversion at nucleotide +26 of exon 51. This mutation creates an amber (TAG) nonsense mutation, substituting a
termination codon (X) for a tyrosine (Y) at codon 2113 (Y2113X) [1]. In-frame skipping of FBN1 exon 51 is due to the disruption of an SC35-dependent
splicing enhancer within exon 51. In addition, this
nonsense mutation induces NMD, which degrades the normally spliced mRNA in the
patient’s cells [2].IVS51+41 (C>T) I2118I (6354C->T)
skipping of exon 51 [3]
Wild type sequence: CCTTATGGA .(1,2), ATCATCGTG (3)
Mutated sequence: CCTTAGGGA (1,2) ATCATTGTG (3)
Effect on exon usage: Exon-> intron, constitutive exon alternative exon
References:1) Dietz, H.C., Valle, D.,
2) Caputi, M., Kendzior, R.J., Jr.
and Beemon, K.L. (2002) A nonsense mutation in the
fibrillin-1 gene of a Marfan syndrome patient induces
NMD and disrupts an exonic splicing enhancer. Genes
Dev., 16, 1754-1759.
PID: 12130535
3) Liu, W., Qian, C. and Francke, U. (1997)
Silent mutation induces exon skipping of fibrillin-1
gene in Marfan syndrome. Nat. Genet., 16, 328-329.PID : 9241263
Description:
Clinical features: Inherited autosomal dominant systemic disorder of fibrous connective tissue caused by mutations in
the fibrillin-1 (FBN1) gene.Fibrillin-1 is a 350-kD calcium binding
glycoprotein, which is the major component of the 10–12-nm microfibrils of the extracellular matrix.Classic MFS manifestations primarily involve the cardiovascular, ocular, and skeletal
systems.
Incidence: 1:5,000
Internet links for the disease: http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=154700
http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=134797
http://uwcmml1s.uwcm.ac.uk/uwcm/mg/search/127115.html
http://www.marfan.org/nmf/index.jsp
END
>Name of the disease: TNFRSF5, tumour-necrosis factor receptor superfamily,
member 5 (CD40);
OMIM accession: 109535
Keywords: TUMOR NECROSIS FACTOR RECEPTOR SUPERFAMILY
MEMBER 5, TNFRSF5
B CELL-ASSOCIATED MOLECULE CD40, CD40
Effect on splicing: Skipping of exon 5 may
arise from disruption of a putative SF2/ASF binding motif.
Exon sequence: CTACAGGGGTTTCTGATACCATCTGCGAGCCCTGCCCAGTCGGCTTCTTCTCC
AATGTGTCATCTGCTTTCGAAAAATGTCACCCTTGGACAAG
EMBL accession:
RefSeq accession:
AEDB accession:
AEdB motif accession:
AEdB function accession:
Altsplice accession: ENSG00000101017
Disease causing mechanism: Homozygous silent mutation at the fifth base pair
position of exon 5 occurs in a putative "exonic splicing enhancer", a cis-element
that promotes inclusion of specific exons through
binding by the serine/arginine-rich splicing factors,
leading to exon skipping and premature termination.
Wild type sequence: TACAGGG
Mutated sequence: TACTGGG
Effect on exon usage: Exon-> intron
The A to T
substitution at nucleotide 455 is a silent mutation that occurs within a
putative binding motif for the SF2/ASF protein.
References: 1) Simona Ferrari , Silvia Giliani, Antonella Insalaco, Abdulaziz Al-Ghonaium, Anna R. Soresina,
Michael Loubser, Maria A. Avanzini,
Massimo Marconi, Raffaele Badolato,
Alberto G. Ugazio, Yves Levy, Nadia Catalan, Anne Durandy, Abdelghani Tbakhi, Luigi D. Notarangelo, and
Alessandro Plebani Mutations of CD40 gene cause an autosomal recessive form of immunodeficiency with hyper IgM.
PNAS October 23, 2001., vol. 98, 12614-12619. PID : 11675497
Description: CD40 is a cell surface receptor that is expressed on
the surface of all mature B cells, most mature B-cell malignancies, and some
early B-cell acute lymphocytic leukemias,
but is not expressed on plasma cells (Clark, 1990). It is
also expressed on monocytes, dendritic cells, endothelial cells, and epithelial cells (van Kooten and Banchereau, 2000).
Clinical features:
Incidence:
Internet links for the disease: http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?cmd=entry&id=109535
END
>Name of the disease: Breast and Ovarian
cancer
OMIM accession: 113705
Keywords: Breast cancer 1 gene, BRCA1
Effect on splicing: Skipping of exon 18
Exon sequence: ATGCTGAGTTTGTGTGTGAACGGACACTGAAATATTTTCTAGGAATTGCGGGAGGAA
AATGGGTAGTTAGCTATTTCT
EMBL accession:
RefSeq accession:
AEDB accession:
AEdB motif accession: 238
AEdB function accession:
Altsplice accession: ENSG00000012048
Disease causing mechanism: exonic mutation. Mutation: In
BRCA1, inclusion of exon 18 requires the presence of
an intact SF2/ASF-dependent ESE spanning positions +
Wild type sequence: GCTGAGTTT
Mutated sequence: GCTTAGTTT
Effect on exon usage: Exon-> intron., constitutive
exon alternative exon
References: 1) L. Cartegni and A.R. Krainer, Correction of disease-associated exon skipping by synthetic exon-specific
activators. Nat. Struct. Biol. 10 (2003), pp.
120–125. PID: 12829008
2) Buratti, E.; Baralle, F. E.; Pagani, F.(2003)" Can a
'patch' in a skipped exon make the pre-mRNA splicing
machine run better?" Trends Mol Med. 2003 Jun;9(6):229-32;
discussion 233-4.PID:12524529
Description: Breast cancer (referring to mammary carcinoma, not
mammary sarcoma) is histopathologically and almost
certainly etiologically and genetically heterogeneous.
Clinical features: Cady (1970) described a family in which 3 sisters had
bilateral breast cancer. Together with reports in the literature, this
suggested to him the existence of families with a particular tendency to
early-onset, bilateral breast cancer. The genetic basis might, of course, be multifactorial. The disease in these women usually
developed before menopause, was often bilateral, and seemed to be associated
with ovarian function. About 30% of daughters with early-onset, bilateral
breast cancer inherited the susceptibility. The risk of breast cancer to women
with affected relatives is higher when the diagnosis is made at an early age
and when the disease is bilateral. Chang et al. (1987) showed that the noncancerous skin fibroblasts of members of a family with
Li-Fraumeni syndrome (which show resistance to the
killing effect of ionizing radiation) have a 3- to 8-fold elevation in
expression of the MYC oncogene (190080)
and an apparent activation of the RAF1 gene (164760).
Normal fetal and adult skin fibroblasts show distinctive migratory behavior
when plated on 3-dimensional collagen gels. Breast cancer metastasis occurs in
a distinct pattern involving the regional lymph nodes, bone marrow, lung, and
liver, but rarely other organs.
Incidence:
Internet links for the disease: http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=113705
http://uwcmml1s.uwcm.ac.uk/uwcm/mg/search/126611.html
http://www.ensembl.org/Homo_sapiens/geneview?gene=ENSG00000012048
END
>Name of the disease: Neurofibromatosis
type I
OMIM accession: 162200
Keywords: Neurofibromin,
NF1, Neurofibromatosis, Von Recklinghausen disease
Effect on splicing: Skipping of exons 7, 30,
and 37
Exon sequence:
>exon7
AAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTA
GGCAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCA
AGTACTTACATCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTTAAG
>exon 30:
GTCAGCTGCCTATAATCTTCTGTGTGCCTTAACTTGTACCTTTAATTTAAAAATCGAGGGCCAGTTACTAGAGACATCAGGTTTATGTATCCCTGCCAACAACA
CCCTCTTTATTGTCTCTATTAGTAAGACACTGGCAGCCAATGAGCCACACCTCACGTTAGAATTTTTGGAAGAGTG
TATTTCTGGATTTAGCAAATCTA
>exon 37:
GCACTTGAGAGTTGCTTAAAAGGACCTGACACTTACAACAGTCAA
GTTCTGATAGAAGCTACAGTAATAGCACTAACCAAATTACAGCCACTTCTTAATAAG
EMBL accession:
RefSeq accession:
AEDB accession:
AEdB motif accession:
AEdB function accession:
Altsplice accession:
Disease causing mechanism: Mutations: Within exon 7:
R304X (910C->T) [1,2,3], Q315X (943C->T) [1],
Q315Q (945G->A) [4], L316M (946C->A) [4], W336X (1007G->A) [1]
Within exon 30: E1907X (5791G->T) [5]
Within exon 37: Y2264X (6792C->A, 6792C->G) [3,6]
The use of
previously established sequence matrices for the scoring of putative ESE motifs
showed that the adjacent silent and missense mutations were located within highly conserved overlapping stretches of 7
nucleotides with a close similarity to the ESE-specific consensus sequences
recognized by the SC35 and SF2/ASF arginine/serine-rich
(SR) proteins.
Wild type sequence: CTACGAAAAAGGCAGCTGACAAGGCAGCTGACAAATTGGGAA
Mutated sequence: CTATGAAAAAGGCAGCTGACAAGGCAACTGACAAATTGAGAA
Effect on exon usage: Skipping of exon 7,30 and 37
References: 1) Wimmer, K., Eckart, M., Stadler, P.F., Rehder, H. and Fonatsch, C.
(2000) Three different premature stop codons lead to
skipping of exon 7 in neurofibromatosis type I
patients. Hum. Mutat., 16, 90-91. PID: 10874316
2) Messiaen, L.M., Callens, T., Mortier, G., Beysen, D., Vandenbroucke, I., Van Roy, N., Speleman,
F. and Paepe, A.D. (2000) Exhaustive mutation
analysis of the NF1 gene allows identification of 95% of mutations and reveals
a high frequency of unusual splicing defects. Hum. Mutat., 15, 541-555.PID: 10862084
3) Hoffmeyer, S.,
4) Colapietro, P., Gervasini, C., Natacci, F., Rossi, L., Riva, P. and Larizza,
L. (2003) NF1 exon 7 skipping and sequence
alterations in exonic splice enhancers (ESEs) in a neurofibromatosis 1 patient. Hum. Genet., 113, 551-554. PID: 13680360
5) Zatkova, A., Messiaen, L., Vandenbroucke,
6) Messiaen, L., Callens, T., Paepe, A.D., Craen, M. and Mortier, G. (1997) Characterisation of two different nonsense mutations, C6792A and C6792G, causing skipping of exon 37 in the NF1 gene. Hum. Genet., 101, 75-80.PID: 9385374
7) Ars, E., Serra, E., Garcia, J., Kruyer, H., Gaona, A., Lazaro, C. and Estivill, X.
(2000) Mutations affecting mRNA splicing are the most common molecular defects
in patients with neurofibromatosis type 1. Hum. Mol. Genet., 9, 237-247. PID: 10607834
Description: Clinical features: An autosomal dominant disorder, probably of neural crest origin, that affects all 3 germinal
layers and therefore it can involve any organ system. NF1 is caused by mutation
in the neurofibromin gene.
Clinical features:
Incidence: 1:3,500
Internet links for the disease: http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=162200
http://uwcmml1s.uwcm.ac.uk/uwcm/mg/search/120231.html
http://www.ensembl.org/Homo_sapiens/geneview?gene=ENSG00000196712
END
>Name of the disease: Acute intermittent porphyria
OMIM accession: 176000
Keywords: AIP., Porphybilinogen deaminase, PBGD, hydroxymethylbilane synthase, HMBS, porphyria
Swedish type porphyria, Porphybilinogen deaminase deficiency, PBGD deficiency, Uroporphyrinogen synthase deficiency, UPS deficiency
Effect on splicing: Exons skipping, premature
translation termination
Exon sequence: GAAGAAAACAGCCCAAAGATGAGAGTGATTCGCGTGGGTACCCGCAAGAGCCAG
EMBL accession:
RefSeq accession:
AEDB accession:
AEdB motif accession:
AEdB function accession:
Altsplice accession:
Disease causing mechanism: Mutations: IVS1+1 (G>A), IVS1+2 (T>A), IVS1+5
(G>C) three point mutations at the donor splice site of intron 1 they result in the activation of a
cryptic splice site 67 bp downstream in intron 1 the cryptic splice site leads to an
aberrant exon 1 finishing what in consequence results
to a frameshift and finally in a premature
translation termination signal at the end of exon 4
[1]
IVS12-1 (G>A)
described a G-to-A point mutation in exon 12
such that exon 12 is missing in the mature mRNA
the resulting aberrant mRNA encodes a truncated protein that is inactive but
stable and can be detected using antibodies directed against the normal enzyme
[2]
IVS1+1 (G>A)
single base substitution (G to A) in the canonical 5-prime splice
donor site of intron 1 this mutation leads
to a particular subtype of acute intermittent porphyria characterized by the restriction of the enzymatic defect to nonerythropoietic tissues [3]
IVS12-1 (G>C)
skipping of exon 12 [4]
IVS3-22 (C>G)
synonymous codon mutation R21R (63C->G)
skipping of exon 3 [1]
Wild type sequence:ATTCGCGTG
Mutated sequence:ATTCGGGTG
Effect on exon usage: constitutive exon ->
alternative exon
intron -> exon (premature
translation termination signal)
References: 1) Llewellyn,
D.H., Scobie, G.A., Urquhart,
A.J., Whatley, S.D., Roberts, A.G., Harrison, P.R. and Elder, G.H. (1996) Acute
intermittent porphyria caused by defective splicing
of porphobilinogen deaminase RNA: a synonymous codon mutation at -22 bp from the 5' splice site causes skipping of exon 3. J. Med. Genet., 33, 437-438. PID: 8733062
2) Puy, H., Gross, U., Deybach,
J.C., Robreau, A.M., Frank, M., Nordmann,
Y. and Doss, M. (1998) Exon 1 donor splice site
mutations in the porphobilinogen deaminase gene in the non-erythroid variant form of acute
intermittent porphyria. Hum. Genet., 103, 570-575. PID: 9860299
3) Grandchamp, B., Picat, C., de Rooij, F., Beaumont, C., Wilson, P., Deybach,
J.C. and Nordmann, Y. (1989) A point mutation
G-->A in exon 12 of the porphobilinogen deaminase gene results in exon skipping and is responsible for acute intermittent porphyria.
Nucleic Acids Res., 17, 6637-6649. PID: 2789372
4) Grandchamp, B., Picat, C., Mignotte, V., Wilson, J.H., Te Velde,
K., Sandkuyl, L., Romeo, P.H., Goossens,
M. and Nordmann, Y. (1989) Tissue-specific splicing
mutation in acute intermittent porphyria. Proc. Natl Acad. Sci. U. S. A., 86,
661-664.PID: 2563167
5) Daimon, M., Yamatani, K.,
Igarashi, M., Fukase, N., Ogawa, A., Tominaga, M. and Sasaki, H. (1993) Acute intermittent porphyria caused by a G to C mutation in exon 12 of the porphobilinogen deaminase gene that results in exon skipping. Hum. Genet., 92, 549-553. PID: 8262514
Description:
Clinical features:AIP is an autosomal dominant disorder resulting from an error in pyrrole metabolism due to deficiency of porphobilinogen deaminase (PBGD), also known as hydroxymethylbilane synthase (HMBS).AIP is characterized by recurrent
attacks of abdominal pain, gastrointestinal dysfunction, neurologic disturbances, and excessive amounts of aminolevulinic acid and porphobilinogen in the urine.
Incidence: Approximately 5 to 10 per 100,000 persons in the
AIP is the most
common of the acute hepatic porphyries, and the prevalence of PBGD gene defects
has been estimated at 0.6 per 1,000 in the French Caucasian population
Internet links for the disease: http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=176000
http://uwcmml1s.uwcm.ac.uk/uwcm/mg/search/120528.html
http://www.ensembl.org/Homo_sapiens/geneview?gene=ENSG00000149397
http://www.porphyriafoundation.com/about_por/types/types01.html
END
>Name of the disease:THROMBASTHENIA OF GLANZMANN AND NAEGELI
OMIM accession: 273800
Keywords: GLANZMANN THROMBASTHENIA, GT, PLATELET GLYCOPROTEIN IIb-IIIa DEFICIENCY Effect on splicing: Skipping of exon 12. The 11bp of deletion
on the gene GPIIIA occurs in the middle of an exon and results in the change of the reading frame of the GPIIIA mRNA.
Exon sequence:AGAATGTGTGGAGTGTAAGAAGTTTGACCGGGGAGCCCTACATGACGAAAATACCTGCAACC
GTTACTGCCGTGACGAGATTGAGTCAGTGAAAGAGCTTA
EMBL accession:
RefSeq accession:
AEDB accession:
AEdB motif accession:
AEdB function accession:
Altsplice accession:
Disease causing mechanism: Glanzmann thrombasthenia (GT) can be used by mutation in the gene
encoding platelet glycoprotein alpha-IIb (ITGA2B; 607759)
or the gene encoding platelet glycoprotein IIIa (ITGB3; 173470)
Wild type sequence:GGCAAGGATGCAGTGAATTGTACCTATAAGAAT
Mutated sequence:GGCAAGGAGTAGCTATAAGAAT
Effect on exon usage: Exon->Intron
References: 1) Newman, P. J.; Seligsohn,
U.; Lyman, S.; Coller, B. S. : The molecular genetic basis of Glanzmann thrombasthenia in the
Iraqi-Jewish and Arab populations in
2) Rosenberg, N.; Yatuv, R.; Orion, Y.; Zivelin, A.; Dardik, R.; Peretz, H.; Seligsohn, U. : Glanzmann thrombasthenia caused by an 11.2-kb deletion in the
glycoprotein IIIa (beta-3) is a second mutation in
Iraqi Jews that stemmed from a distinct founder. Blood 89:
3654-3662, 1997. PID : 9160670
Description: Glanzmann thrombasthenia is anautosomal recessive bleeding disorder characterized by
failure of platelet aggregation an by absent or diminished
clot retraction. The abnormalities are related to quantitative or qualitative
abnormalities of the GPIIb/IIIa platelet surface
fibrinogen receptor complex resulting from mutations in either the GPIIb or GPIIIa genes.
Clinical features: Glanzmann thrombasthenia has been classified clinically into types I
and II. In type I, platelets show absence of the glycoprotein IIb-IIIa complexes at their surface and lack fibrinogen and
clot retraction capacity. IN type II, the platelets express the GPIIb-IIIa complex at reduced levels (5-20% controls), have
detectable amounts of fibrinogenm and have low or
moderate clot retraction capability. The platelets of GT variants have normal
or near normal (60-100%) expression of dysfunctional receptors Incidence:
Internet links for the disease: http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?cmd=entry&id=173470#173470_Reference27
http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?cmd=entry&id=173470
END
|
|
5%
10% of the
patients. Occipital horn syndrome (OHS) is the mildest allelic form of MD
(Proud et al.