AltSplice Mouse Release 1 (Nov 2004)

Introduction

The data in his release is generated for 'known genes' as annotated in Ensembl 24.33.1. The extracted nucleotide region includes the gene region as defined in EnsEMBL. Such a region is extended both at the 5' and 3' ends by 3000 bases. Mouse EST and mRNA (transcript) sequences are mapped to these extended gene regions. Transcript confirmed introns and exons are delineated from these alignments. The matching transcript sequences are further classified into groups in a manner that each of these groups represents an isoform splice pattern. Each group is represented by a transcript representative structure - called transcript class.

Such isoform transcript structures are compared with one another to delineate the alternative events. Thus the presented data lists all the alternative splice events as seen in the observed transcripts for a gene. The basic events that are identified in this work are: exon isoforms (extension/truncation of an exon), cassette exons (an exon is present in one transcript but absent in an isoform of the transcript), alternating exons (exons are used in alternative transcripts in a mutually exclusive manner), and intron retention (a nucleotide region is used as an exon in a transcript while it is an intron in an alternative transcript). The latter three events (namely cassette exon, alternating exon, intron retention) are further characterised as 'complex' or 'simple' depending on whether the 5' or/and 3' flanking exons also undergo modifications (e.g. the flanking exon may be extended or truncated or the exon that flanks a retained intron is cassetted or alternated).
SNPs have been mapped to our data and we display them for features as well as for individual events.

We have implemented, in this release, integration of AEdb with AltSplice (for both human and mouse entries). Entries that are common between AltSplice and AEdb are associated and are indicated so in the dispay pages that are resultant of queries to Altsplice and/or AEdb. Queries can be raised for common entries. AltSplice exons and splice events that have experimental evidence from AEdb are indicated so. In addition, we have built a wrapper that passes on queries to both the AEdb and AltSplice.

We have further implemented SplicePatternViewer to visualise the isoform splice patterns. Annotation pertaining the expression states of the isoforms is being added to the data.

We will carry out further work on this data towards annotating through various means and towards implementing an oracle version of the database along with query tools. As soon as these take place we will update this page to reflect the new data and/or tools.

Documentation

Concise documentation of the procedure followed to produce this data and the naming conventions used is available in PDF format. The document is a work in progress and will be updated now and then to reflect now developments.

Statistics

Gene set

Grand totals of genes, transcript sequences, transcript classes, and events

Distribution statistics

Various distributions are located on the distribution statistics page (genes per classes, intron types, event types, length of retained introns and cassette exons, effective length change of exon isoforms).

Data files

Copyright Notice This ASD database has been generated within a research programme financed by the European Community1. ExonHit Therapeutics SA has been granted commercial exploitation rights to this database under the EU funded consortium, of which it is a member, and the database is protected by EC Directive2. ExonHit currently holds an option to an exclusive license to the contents of the Alternative Splicing Database for commercial use including without limitation, providing services, and designing products (Commercial Rights). Consequently, such Commercial Rights are not currently available to anyone else. For up to date contact information for ExonHit Therapeutics SA, please see its website: www.exonhit.com. The database is covered by paragraphs 2-17 of the EBI's normal terms of use, to be found at www.ebi.ac.uk/Information/termsofuse By clicking the button below, or hyperlinking to pages beyond this notice, you indicate your agreement with these terms. 1. DIRECTIVE 96/9/EC OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL of 11 March 1996 on the legal protection of databases. 2. DIRECTIVE 96/9/EC OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL of 11 March 1996 on the legal protection of databases.

In this release the following data files are available: Downloads Gene file (245Mb, gzip) contains a listing of all genes together with sequence that resulted in at the very least one confirmed intron. Transcript file (28Mb, gzip) a listing of EST/mRNA's used in the confirmation of introns and exons. Intron file (99Mb) all introns that were confirmed in the above genes by the EST/mRNA's. Exon file (77Mb) idem, all exons that were confirmed. Events file (28Mb) lists per gene the unique alternative events that were determined. Reference transcript structure file (2.9Mb, gzip) a listing of the reference transcript structures for the genes. Splice pattern sequence file (13Mb, gzip) lists the nucleotide sequences of the observed splice patterns. The structure of the splice patterns are as listed in the Events file. Show Copyright Notice

Examples and formats of the data files.

Gene file

The gene file has a standard FASTA format with a header, and a section right after the header that lists the sequence. The header will show the Ensembl gene identifier, and various flags. The important flag is the 'ext' flag which indicates how many bases we have added up- and downstream to the listed sequence.

Example:

>ENSG00000170613 chrom: 5 strand: -1 orientation: reversed ext: 3000 map_start: 3001(local) => 161664496(ensembl) map_end: 6941(local) => 161668436(ensembl)
TGCTATATTCCTGCACCTAAAACAGGGTCTGGCACAAAGTAAACAAT
TAATTATATTAATGGAGTGAATGGATAAATTTATGCTGCTTTGCATT
TGTATGTTTGTATTCTATCTGTCCTATTAGTGTCACCAGTCTAGTCC
:
GTCTTTGAAGCAGAGGAAA

Transcript file

The transcript file lists all those EST's and mRNA's that were used in determining the individual introns and exons. Besides listing the transcript identifier and version, it also gives a pointer to the gene where it confirmed a feature, the description of the transcript, and the alignment as we found it.

Example:

K057543.1 [ENSG00000170613] Homo sapiens cDNA FLJ32981 fis, clone TESTI3000002, weakly similar to L.mexicana lmsap2 gene for secreted acid phosphatase 2 (SAP2). g(3004..3705)e(1..702),g(5610..6928)e(703..2021)

Reference transcript structure file

The reference transcript structure file lists the transcript structure from the Ensembl annotation that we chose to be the point of reference with regard to numbering the features and comparing the new features that we found. Each gene only has one reference transcript structure; in the file Ensembl gene ID, Ensembl Transcript ID, and the complete reference transcript structure are given. UFR and UDR features are added features by us that denote the upstream and downsteam flanking region that was added to the gene sequence.

Example:

>ENSG00000167987 ENST00000301765 UFR(1..3000 3000),e1(3001..3102 102),i1(3103..7631 4529),e2(7632..7803 172),i2(7804..8501 698),e3(8502..8584 83),i3(8585..9299 715),e4(9300..11583 2284),DFR(11584..14583 3000)

• a basic type (e.g. EXON ISOFORM, CASSETTE EXON, etc) and a list of all detailed forms in which such a basic type exists
• an event specific structure, e.g. location changes for an exon isoform, or a list of cassette exons.
• for exon and intron isoforms a length change (donor/acceptor side and total)
• between which transcript class combinations this event occurs, and exactly in which form. Exon isoforms can be part of another event (e.g. CCE complex cassette exon) as the flanking exons, part of none if they flank only an intron isoform, or part of unknown if the intron it flanks is not completely defined in the other transcript class.
• a (grouped) list of flanking features and class combinations
• a list of transcript isoforms, with the reference (isoform 1) pertaining to the left-hand side of the structure relationship (listed as part of the above flanking features or as part of the event specific structure in case of exon/intron isoforms).