P-MTAB-30961 - P-MTAB-30961

Type
treatment protocol
Description
ES cells were transfected with Lipofectamine2000 (Invitrogen) and treated with puromycin (1 mg / ml) for 72 hrs for positive clone selection. pSUPER-puro Lin-9 was generated by inserting an oligonucleotide with the following target sequence specific for mouse Lin-9 into pSUPER-puro: 5' GCUACUUACAGAGUAACUUUC 3' {Knight,2009}. Knight et al. 2009. A Lin-9 complex is recruited by B-Myb to activate transcription of G2/M genes in undifferentiated embryonal carcinoma cells. Oncogene 28:1737-1747
Links
Experiment E-MTAB-1490