P-MEXP-6919 - P-MEXP-6919

Type
labeling
Description
Fifteen micrograms of total RNA were used to prepare cDNA with the Superscript Double-Stranded cDNA Synthesis Kit (Invitrogen) according to manufacturers instructions using oligodT-T7 oligonucleotides (GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG(dT)24). The cDNA was subjected to in vitro transcription in the presence of 2 mM each biotin-11-CTP and biotin-16-UTP (ENZO Life Sciences, Farmingdale, NY) using the MegaScript High Yield Transcription Kit (Ambion, Austin, TX). After purification of the cRNA on RNeasy columns (Quiagen, Hilden, Germany), fifteen micrograms cRNA were fragmented in a volume of 40 ƒÝl as recommended by Affymetrix.
Parameters
Amount of nucleic acid labeled, Amplification, Used Label
Links
Experiment E-ATMX-10