Comment[ArrayExpressAccession]	E-GEOD-52047
MAGE-TAB Version	1.1	
Public Release Date	2014-04-26
Investigation Title	Tissue-Resident Natural Killer (NK) Cells Are Cell Lineages Distinct From Thymic and Conventional Splenic NK Cells	
Comment[Submitted Name]	Tissue-Resident Natural Killer (NK) Cells Are Cell Lineages Distinct From Thymic and Conventional Splenic NK Cells
Experiment Description	This SuperSeries is composed of the SubSeries listed below. Refer to individual Series	
Term Source Name	ArrayExpress	EFO
Term Source File	http://www.ebi.ac.uk/arrayexpress/	http://www.ebi.ac.uk/efo/efo.owl
Person Last Name	Artyomov	
Person First Name	Maxim	
Person Mid Initials	N.	
Person Email	martyomov@pathology.wustl.edu	
Person Affiliation	Washington University in St.Louis	
Person Address	Immunology&Pathology, Washington University in St.Louis, 660 S. Euclid Avenue, Campus Box 8118, St.Louis, MO, USA	
Person Roles	submitter	
Protocol Name	P-GSE52047-1	
Protocol Description	Spleen, liver and bone marrow cells were isolated from Rag1-/- mice and sorted for CD3-CD19-NK1.1+CD49a+DX5- or CD3-CD19-NK1.1+CD49a-DX5+ which were lysed. mRNA was extracted from cell lysates using oligo-dT beads (Invitrogen). For cDNA synthesis, we used custom oligo-dT primer with a barcode and adapter-linker sequence (CCTACACGACGCTCTTCCGATCT—XXXXXXXX-T15). After first strand synthesis samples were pooled together based on Actb qPCR values and RNA-DNA hybrids were degraded using consecutive acid-alkali treatment. Then, second sequencing linker (AGATCGGAAGAGCACACGTCTG) was ligated using T4 ligase (New EnglandBiolabs, Ipswich, MA) and after SPRI clean-up, mixture was PCR enriched 14 cycles andSPRI purified to yield final strand specific 3'end RNA-seq libraries	
Protocol Type	nucleic acid library construction protocol	
Experimental Factor Name	CELL TYPE	ORGANISM PART
Experimental Factor Type	cell type	organism part
Comment[SecondaryAccession]	GSE52047	
Comment[GEOReleaseDate]	2014-04-26	
Comment[ArrayExpressSubmissionDate]	2013-11-04	
Comment[GEOLastUpdateDate]	2014-04-26	
Comment[AEExperimentType]	RNA-seq of coding RNA	
SDRF File	E-GEOD-52047.sdrf.txt