Comment[ArrayExpressAccession]	E-GEOD-51918
MAGE-TAB Version	1.1				
Public Release Date	2013-10-30
Investigation Title	Desai SDQ0804_HCP3_N2_LTEMB				
Comment[Submitted Name]	Desai SDQ0804_HCP3_N2_LTEMB
Experiment Description	modENCODE_submission_3543 This submission comes from a modENCODE project of Jason Lieb. For full list of modENCODE projects, see http://www.genome.gov/26524648 Project Goal: The focus of our analysis will be elements that specify nucleosome positioning and occupancy, control domains of gene expression, induce repression of the X chromosome, guide mitotic segregation and genome duplication, govern homolog pairing and recombination during meiosis, and organize chromosome positioning within the nucleus. 126 strategically selected targets include key histone modifications, histone variants, RNA polymerase II isoforms, dosage-compensation proteins, centromere components, homolog-pairing facilitators, recombination markers, and nuclear-envelope constituents. We will integrate information generated with existing knowledge on the biology of the targets, perform ChIP-chip analysis on mutant and RNAi extracts lacking selected target proteins, use extrachromosomal arrays to assess the ability of candidate identified sequence motifs to recruit targets in vivo, identify tissue-specific patterns of selected targets, and create integrated, quantitative models of transcription and whole-chromosome functions. For data usage terms and conditions, please refer to http://www.genome.gov/27528022 and http://www.genome.gov/Pages/Research/ENCODE/ENCODEDataReleasePolicyFinal2008.pdf EXPERIMENT TYPE: CHIP-chip. BIOLOGICAL SOURCE: Strain: N2; Developmental Stage: Late Embryos; Genotype: wild type; Sex: Hermaphrodite;  NUMBER OF REPLICATES: 2;  EXPERIMENTAL FACTORS: Developmental Stage Late Embryos; temp (temperature) 20 degree celsius; Antibody SDQ0804 HCP-3 (target is HCP-3); Strain N2				
Term Source Name	ArrayExpress	EFO
Term Source File	http://www.ebi.ac.uk/arrayexpress/	http://www.ebi.ac.uk/efo/efo.owl			
Person Last Name	modENCODE	Gassmann	Desai		
Person First Name	DCC	Reto	Arshad		
Person Email	help@modencode.org				
Person Affiliation	Ontario Institute for Cancer Research				
Person Phone	416-673-8579				
Person Address	Ontario Institute for Cancer Research, MaRS Centre, South Tower, 101 College Street, Suite 800, Toronto, Ontario, Canada				
Person Roles	submitter				
Protocol Name	P-GSE51918-3	P-GSE51918-4	P-GSE51918-1	P-GSE51918-2	P-GSE51918-5
Protocol Description	ChIP-chip_label_hyb_nimblegen_v2. DNA was labeled and hybridized to NimbleGen C. elegans tiling array (HD2) according to the protocol described in chapter 3 and 4 of the NimbleGen Arrays User?s Guide ChIP-chip Analysis, Version 3.1, 27 May 2008 with slight modifications. Briefly, amplified IP or input DNA was either labeled with Cy5 or Cy3 in the presence of Klenow fragment. The reaction was stopped by the addition of EDTA. Labeled DNA was recovered by isopropanol precipitation, and dried. The labeled DNA was hybridized to C. elegans tiling array for 16 - 20 hours at 42M-0C.	ChIP-chip_label_hyb_nimblegen_v2. DNA was labeled and hybridized to NimbleGen C. elegans tiling array (HD2) according to the protocol described in chapter 3 and 4 of the NimbleGen Arrays User?s Guide ChIP-chip Analysis, Version 3.1, 27 May 2008 with slight modifications. Briefly, amplified IP or input DNA was either labeled with Cy5 or Cy3 in the presence of Klenow fragment. The reaction was stopped by the addition of EDTA. Labeled DNA was recovered by isopropanol precipitation, and dried. The labeled DNA was hybridized to C. elegans tiling array for 16 - 20 hours at 42M-0C.	Worm_embryo_growth_and_harvest_vRG1. Synchronized worm cultures were grown at 20 M-0C in batches of 500 ml using 2.8-L Fernbach flasks shaking at 230 rpm. Gravid adults were separated from debris by sucrose floating. Embryos were isolated by bleaching and fixed after chitinase treatment with 1 % formaldehyde for 10 min on ice. For a detailed protocol see http://www.modencode.org/.	Worm_embryo_extraction_vRG1. Fixed embryos were suspended in 5 volumes of ChIP buffer (50 mM Hepes-KOH pH 7.6, 140 NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.5 % NP-40) and sonicated on ice with a Branson sonifier microtip (30 % power setting for 3 min; 40 % power setting for 1 min). Debris were pelleted at 10 000 g for 20 min and the supernatant was made 10 % in glycerol. The extract was snap frozen in liquid nitrogen aliquots containing 3 mg of protein and stored at ? 80 M-0C. Worm_chromatin_immunoprecipitation_vRG1. For each ChIP reaction, 3 mg of protein extract was diluted with ChIP buffer (50 mM Hepes KOH pH 7.6, 140 NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.5 % NP-40) to 900 ?l. Then 35 ?l 30 % sarcosyl (1 % final) and 20 ?l 5 % Na-deoxycholate (0.1 % final) were added. 50 ?l of the diluted extract were removed (input sample), mixed with Elution buffer (10 mM Tris-Cl pH 8.0, 1 mM EDTA, 250 mM NaCl, 1 % SDS) and processed as described for ChIP samples. 100 ?l antibody/bead suspension (5?g antibody pre-bound to 50 ?l Dynabeads, suspended in ChIP buffer) was added and the mixture and rotated over night at 4 M-0C. Beads were washed with 2 M-CM-^W 1 ml FA Buffer (50 mM Hepes-KOH pH 7.6, 150 mM NaCl, 1 mM EDTA, 1 % Triton X-100, 0.1 % Na-deoxycholate) for 5 min each; with 1 ml FA-1000 buffer (50 mM Hepes-KOH pH 7.6, 1 M NaCl, 1 mM EDTA, 1 % Triton X-100, 0.1 % Na-deoxycholate) for 10 min; with 1 ml FA-500 buffer (50 mM Hepes-KOH pH 7.6, 500 mM NaCl, 1 mM EDTA, 1 % Triton X-100, 0.1 % Na-deoxycholate) for 10 min; with 1 ml TEL buffer (10 mM Tris-HCl pH 8.0, 0.25 M LiCl, 1 mM EDTA, 1% NP-40, 1% Na-deoxycholate) for 10 min; and briefly with 1 ml TE buffer (10mM Tris-HCl pH 8.0, 1mM EDTA). Immunocomplexes were eluted with 50 ?l Elution buffer for 15 min at 67 M-0C. Eluates were incubated over night at 65 M-0C to reverse cross-links, then treated with proteinase K (0.44 mg/ml) at 37 M-0C for 2 h. Nucleic acids were recovered by phenol/chloroform extraction and ethanol precipitation. After digestion with RNAse A (0.33 mg/ml) for 2h at 37 M-0C, DNA was purified using the Qiagen PCR purification kit. Worm_LM-PCR_Amplification_for_ChIP-chip_vRG1. ChIP and input DNA was blunt ended with T4 polymerase for 20 min at 12 M-0C and purified by phenol/chloroform extraction and EtOH precipitation. Annealed oligonucleotide linkers (oligo 1: gcggtgacccgggagatctgaattc; oligo 2: gaattcagatc) were ligated to the DNA fragments over night at 16 M-0C. The ligated DNA was precipitated with EtOH, disolved in 10 mM Tris-HCl pH 8, and amplified with a Taq/Pfu polymerase mix using oligo 1. For a detailed protocol see http://www.modencode.org/.	ChIP-chip_scanning_nimblegen_v2. Array scanning and raw data extraction were performed according to the protocol described in chapter 5 and 6 of the NimbleGen Arrays User?s Guide ChIP-chip Analysis, Version 3.1, 27 May 2008. Briefly, array signal was scanned by using a GenePix 4000B Scanner with associated software and saved as .tif files of the 532nm and 635nm images individually. Raw signal intensities of the images were extracted and saved as .pair files by using NimbleScan software v2.5 according to the NimbleScan User?s Guide.
Protocol Type	labelling protocol	hybridization protocol	growth protocol	nucleic acid extraction protocol	array scanning protocol
Comment[SecondaryAccession]	GSE51918				
Comment[GEOReleaseDate]	2013-10-30				
Comment[ArrayExpressSubmissionDate]	2013-10-30				
Comment[GEOLastUpdateDate]	2013-10-31				
Comment[AEExperimentType]	ChIP-chip by tiling array				
Comment[AdditionalFile:Data1]	GSE51918_SDQ0804_HCP3_N2_LTEMB_ave.gff				
SDRF File	E-GEOD-51918.sdrf.txt