Comment[ArrayExpressAccession]	E-GEOD-45457
MAGE-TAB Version	1.1								
Public Release Date	2013-06-07
Investigation Title	A Switch Between Topological Domains Underlies HoxD Genes Collinearity in Mouse Limbs								
Comment[Submitted Name]	A Switch Between Topological Domains Underlies HoxD Genes Collinearity in Mouse Limbs
Experiment Description	This SuperSeries is composed of the SubSeries listed below. Refer to individual Series								
Term Source Name	ArrayExpress	EFO
Term Source File	http://www.ebi.ac.uk/arrayexpress/	http://www.ebi.ac.uk/efo/efo.owl							
Person Last Name	LELEU								
Person First Name	Marion								
Person Email	geo@ncbi.nlm.nih.gov								
Person Affiliation	EPFL								
Person Address	School of Life Sciences, EPFL, EPFL-SV-ISREC-UPDUB- Station 19, Lausanne, Switzerland								
Person Roles	submitter								
Protocol Name	P-GSE45457-3	P-GSE45457-4	P-GSE45457-1	P-GSE45457-8	P-GSE45457-6	P-GSE45457-9	P-GSE45457-7	P-GSE45457-2	P-GSE45457-5
Protocol Description	standard Affymetrix protocol	standard Affymetrix protocol	Early forelimb buds, presumptive digits and proximal segments of E12.5 forelimbs were micro-dissected from mouse embryos, fixed in 1% formaldehyde for 15 minutes at room temperature, washed three times with 4M-0C PBS and stored at -80M-0C. Pools of 40 early forelimbs (E9.5), 10 limb buds (10.5), 10 autopods or 10 Proximal forelimbs were used for each experiment. ChIP was performed according to (Lee et al., 2006), using 2 M-NM-<g of anti-H3K4me3 (07-436, Millipore), H3K27me3 (17-622, Millipore) and EZview Red protein G/A Affinity Gel (Sigma). Immuno-precipitated and whole cell extract DNA (input) were de-crosslinked at 65M-0C overnight, treated with RNAseA, proteinase K and purified by phenol/chloroform extraction. ChIP and input DNA were amplified using ligation-mediated PCR (Lee et al., 2006), fragmented and labeled using GeneChip WT Double-Stranded DNA Terminal Labeling Kit (Affymetrix) and hybridized to custom tiling arrays (Affymetrix). For each sample, two independent ChIP-chip experiments were performed, with all antibodies.	Early forelimb buds, presumptive digits and proximal segments of E12.5 forelimbs were micro-dissected from mouse embryos, fixed in 1% formaldehyde for 15 minutes at room temperature, washed three times with 4M-0C PBS and stored at -80M-0C. Pools of 40 early forelimbs (E9.5), 10 limb buds (10.5), 10 autopods or 10 Proximal forelimbs were used for each experiment. ChIP was performed according to (Lee et al., 2006), using 2 M-NM-<g of anti-H3K27Ac (ab4729, Abcam), and EZview Red protein G/A Affinity Gel (Sigma). Immuno-precipitated and whole cell extract DNA (input) were de-crosslinked at 65M-0C overnight, treated with RNAseA, proteinase K and purified by phenol/chloroform extraction. using 2 M-NM-<g of anti-H3K27Ac (ab4729, Abcam). 20ng of output were multiplexed using &quot;Multiplexing Sample Preparation Oligonucleotide Kit&quot; from Illumina. Material was sequenced with 100bp-paired ends sequencing protocol in Illumina HI-seq according to the manufacturerM-bM-^@M-^Ys specifications.	Circular Chromosome Conformation Capture (4C) technique was performed as described (Noordermeer et al., 2011). Early limb buds were dissected from 40 E9.5 embryos, Digits and Proximal forelimbs from 10X E12.5 embryos. Tissue was dissociated with collagenase (Sigma Aldrich/Fluka) and filtered through a 35 micron mesh to isolate single cells. Cells were fixed in formaldehyde 2% for 10 min at room temperature and reaction was quenched on ice with glycine. Cells were further lysated with 10 mM Tris pH 7.5, 10 mM NaCl, 5 mM MgCl2, 0.1 mM EGTA, PIC 1x to isolate nuclei. Nuclei from pools were digested with NlaIII (New England Biolabs) and ligated with T4 DNA ligase HC (Promega) in diluted conditions to promote intramolecular ligation. Sequences ligated to fragments of interest were digested again with DpnII (New England Biolabs), ligated with T4 DNA ligase HC (Promega) in diluted conditions and amplified using AmpliTaq DNA polymerase (Applied Biosystems) and inversed PCR primers flanked with adaptors allowing multiplexing. Hoxd13, Hoxd11, Hoxd9 and Hoxd1 PCR primers were described before (Noordermeer et al., 2011). For regions CNS(39) and CNS(65), the following primer sets were used: CNS(39)_inverse_forward:M- 5M-bM-^@M-^YAATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTATCCAAGGAGAAAGGTGTTGGTC3', CNS(39)_inverse_reverse:5M-bM-^@M-^YCAAGCAGAAGACGGCATACGACAGGGCGTTGGGTCACTCT3', CNS(65)_inverse_forward:5M-bM-^@M-^YAATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTATCTAGTGAGCCCCTACCAGGA3', CNS(65)_inverse_reverse:5M-bM-^@M-^YCAAGCAGAAGACGGCATACGAGGAGCCTTTGGGGTACACG-3M-bM-^@M-^Y.	Immuno-precipitated and whole cell extract DNA (input) were de-crosslinked at 65M-0C overnight, treated with RNAseA, proteinase K and purified by phenol/chloroform extraction. ChIP products were sequenced with Illumina Genome Analyzer IIx. Data was mapped to the mouse genome using HTSstation (http://htsstation.vital-it.ch/).	Tissue was dissociated with collagenase (Sigma Aldrich/Fluka) and filtered through a 35 micron mesh to isolate single cells. Cells were fixed in formaldehyde 2% for 10 min at room temperature and reaction was quenched on ice with glycine. Cells were further lysated with 10 mM Tris pH 7.5, 10 mM NaCl, 5 mM MgCl2, 0.1 mM EGTA, PIC 1x to isolate nuclei. Nuclei from pools were digested with NlaIII (New England Biolabs) and ligated with T4 DNA ligase HC (Promega) in diluted conditions to promote intramolecular ligation 4C PCR was sequenced with Illumina Genome Analyzer IIx. Data was mapped to the mouse genome using HTSstation (http://htsstation.vital-it.ch/).	Immuno-precipitated and whole cell extract DNA (input) were de-crosslinked at 65M-0C overnight, treated with RNAseA, proteinase K and purified by phenol/chloroform extraction.	standard Affymetrix protocol
Protocol Type	labelling protocol	hybridization protocol	sample treatment protocol	sample treatment protocol	sample treatment protocol	nucleic acid library construction protocol	nucleic acid library construction protocol	nucleic acid library construction protocol	array scanning protocol
Experimental Factor Name	CHIP ANTIBODY CATALOG #	CHIP ANTIBODY	STAGE	GENOTYPE	CHIP ANTIBODY MANUFACTURER	AGE	ORGANISM PART		
Experimental Factor Type	chip antibody catalog #	chip antibody	Stage	genotype	chip antibody manufacturer	age	organism part		
Comment[SecondaryAccession]	GSE45457								
Comment[GEOReleaseDate]	2013-06-07								
Comment[ArrayExpressSubmissionDate]	2013-03-24								
Comment[GEOLastUpdateDate]	2013-06-08								
Comment[AEExperimentType]	ChIP-chip by tiling array								
Comment[AEExperimentType]	other								
Comment[AEExperimentType]	ChIP-seq								
SDRF File	E-GEOD-45457.hyb.sdrf.txt	E-GEOD-45457.seq.sdrf.txt