Comment[ArrayExpressAccession]	E-GEOD-45455
MAGE-TAB Version	1.1		
Public Release Date	2013-06-07
Investigation Title	A Switch Between Topological Domains Underlies HoxD Genes Collinearity in Mouse Limbs (4C-Seq)		
Comment[Submitted Name]	A Switch Between Topological Domains Underlies HoxD Genes Collinearity in Mouse Limbs (4C-Seq)
Experiment Description	During limb development, Hoxd genes are transcribed in two waves: Early on, when the arm and forearm are specified and subsequently, when digits form. While the latter phase is controlled by enhancers centromeric to the HoxD cluster, we show here that the early phase requires enhancers located in the opposite telomeric gene desert. The transition between the two types of regulations involves a functional switch between two distinct topological domains, as reflected by a subset of genes mapping centrally into the cluster, which initially interact with the telomeric domain and subsequently shift to establish new contacts on the opposite side. This transition between two regulatory landscapes generates an intermediate area of low Hox dose developing into the wrist, the transition between our arms and our hands. This intriguing correspondence between genomic and morphological boundaries illustrates the mechanism underlying collinear Hox gene regulation in our developing appendages. Circular Chromosome Conformation Capture (4C seq) at the HoxD locus in developing proximal and distal limbs at E9.5 and E12.5		
Term Source Name	ArrayExpress	EFO
Term Source File	http://www.ebi.ac.uk/arrayexpress/	http://www.ebi.ac.uk/efo/efo.owl	
Person Last Name	LELEU	Andrey	Duboule
Person First Name	Marion	G	D
Person Email	geo@ncbi.nlm.nih.gov		
Person Affiliation	EPFL		
Person Address	School of Life Sciences, EPFL, EPFL-SV-ISREC-UPDUB- Station 19, Lausanne, Switzerland		
Person Roles	submitter		
Protocol Name	P-GSE45455-1	P-GSE45455-2	
Protocol Description	Circular Chromosome Conformation Capture (4C) technique was performed as described (Noordermeer et al., 2011). Early limb buds were dissected from 40 E9.5 embryos, Digits and Proximal forelimbs from 10X E12.5 embryos. Tissue was dissociated with collagenase (Sigma Aldrich/Fluka) and filtered through a 35 micron mesh to isolate single cells. Cells were fixed in formaldehyde 2% for 10 min at room temperature and reaction was quenched on ice with glycine. Cells were further lysated with 10 mM Tris pH 7.5, 10 mM NaCl, 5 mM MgCl2, 0.1 mM EGTA, PIC 1x to isolate nuclei. Nuclei from pools were digested with NlaIII (New England Biolabs) and ligated with T4 DNA ligase HC (Promega) in diluted conditions to promote intramolecular ligation. Sequences ligated to fragments of interest were digested again with DpnII (New England Biolabs), ligated with T4 DNA ligase HC (Promega) in diluted conditions and amplified using AmpliTaq DNA polymerase (Applied Biosystems) and inversed PCR primers flanked with adaptors allowing multiplexing. Hoxd13, Hoxd11, Hoxd9 and Hoxd1 PCR primers were described before (Noordermeer et al., 2011). For regions CNS(39) and CNS(65), the following primer sets were used: CNS(39)_inverse_forward:M- 5M-bM-^@M-^YAATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTATCCAAGGAGAAAGGTGTTGGTC3', CNS(39)_inverse_reverse:5M-bM-^@M-^YCAAGCAGAAGACGGCATACGACAGGGCGTTGGGTCACTCT3', CNS(65)_inverse_forward:5M-bM-^@M-^YAATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTATCTAGTGAGCCCCTACCAGGA3', CNS(65)_inverse_reverse:5M-bM-^@M-^YCAAGCAGAAGACGGCATACGAGGAGCCTTTGGGGTACACG-3M-bM-^@M-^Y.	Tissue was dissociated with collagenase (Sigma Aldrich/Fluka) and filtered through a 35 micron mesh to isolate single cells. Cells were fixed in formaldehyde 2% for 10 min at room temperature and reaction was quenched on ice with glycine. Cells were further lysated with 10 mM Tris pH 7.5, 10 mM NaCl, 5 mM MgCl2, 0.1 mM EGTA, PIC 1x to isolate nuclei. Nuclei from pools were digested with NlaIII (New England Biolabs) and ligated with T4 DNA ligase HC (Promega) in diluted conditions to promote intramolecular ligation 4C PCR was sequenced with Illumina Genome Analyzer IIx. Data was mapped to the mouse genome using HTSstation (http://htsstation.vital-it.ch/).	
Protocol Type	sample treatment protocol	nucleic acid extraction protocol	
Experimental Factor Name	GENOTYPE	AGE	ORGANISM PART
Experimental Factor Type	genotype	age	organism part
Comment[SecondaryAccession]	GSE45455		
Comment[GEOReleaseDate]	2013-06-07		
Comment[ArrayExpressSubmissionDate]	2013-03-24		
Comment[GEOLastUpdateDate]	2013-06-08		
Comment[AEExperimentType]	other		
Comment[SecondaryAccession]	SRP019962		
Comment[SequenceDataURI]	http://www.ebi.ac.uk/ena/data/view/SRR796174-SRR796188		
SDRF File	E-GEOD-45455.sdrf.txt