4 protocols
AccessionNameType
P-MTAB-34674
nucleic acid sequencing protocol
Libraries were sequenced using the Illumina Genome Analyser II platform to generate single-end 36 bases reads
P-MTAB-34672
nucleic acid extraction protocol
RNAs from the ileal tissue were extracted and purified using classical TRIzol/chloroform protocol. All samples were treated with Turbo DNase (Ambion). RNA quality was determined using Experion Automated Electrophoresis Station (Bio-Rad).
P-MTAB-34671
growth protocol
All experiments involving mice were handled in accordance with the Pasteur Institute guidelines for animal welfare. Only 9- to 12-week-old female C57BL6/J conventional (Charles River) and germfree wild type mice mice (CDTA) were used for experiments. Germ-free mice were housed in plastic gnotobiotic isolators. L. monocytogenes overnight cultures were diluted in BHI and bacteria were grown until OD600nm=1. Bacterial cultures were centrifuged at 3,500 x g for 15 min. After three washes in PBS, L. monocytogenes pellet was resuspended in PBS at a final concentration of 2.5 x 1010 bacteria/mL. Mice were infected orally with 5 x 109 bacteria diluted in 200 uL of PBS supplemented with 300 uL of CaCO3 (50 mg/mL) for 24 h and 72h. Serial dilutions of the inoculum were plated to control the number of L. monocytogenes inoculated in mice.
P-MTAB-34673
nucleic acid library construction protocol
The purified small RNA was ligated with 3' RNA adaptor (5'-/5rApp/ATCTCGTATGCCGTCTTCTGCTTG/3ddC/), which is specifically modified to target miRNAs and other small RNAs that have a 3'hydroxyl group. The 5' RNA adaptor (5'-GUUCAGAGUUCUACAGUCCGACGAUC) was then ligated to the 5' phosphate end of small RNA. Reverse transcription was done to convert the RNA to cDNA, which was then selectively enriched by 12 cycles of PCR. The PCR products were purified on 5% PAGE (BioRad) in a size range between 90-105 base pairs and checked on a Bioanalyser DNA1000 chip (Agilent).