7 protocols
AccessionNameType
P-MTAB-30966
bioassay_data_transformation
Data was background substracted and LOESS normalized using R (2.15)/Bioconductor/Limma
P-MTAB-30965
image_acquisition
Slides were scanned using an Agilent DNA Microarray Scanner G2505C; scan software: Agilent Scan Control Version A.8.1.3; quantification software: Agilent Feature Extraction Version 10.5.1.1 (FE Protocol GE_105_Dec08).(Parameters: Scanning hardware = G2505A DNA microarray scanner [Agilent], Scanning software = Feature Extraction Software [Agilent])
P-MTAB-30964
hybridization
Agilent Two-Color Microarray-Based Gene Expression (Hybridization)
Version: 5.7
Agilent publication number: G4140-90050
URL: http://www.chem.agilent.com/Library/usermanuals/Public/G4140-90050_Two-Color_GE_5.7.pdf
This document describes Agilent's recommended procedures for the preparation and labeling of complex biological targets and hybridization, washing, scanning, and feature extraction of Agilent 60-mer oligonucleotide microarrays for microarray-based two-color gene expression analysis.
P-MTAB-30963
nucleic acid labeling protocol
Agilent Two-Color Microarray-Based Gene Expression (Quick Amp Labeling)
Version: 5.7
Agilent publication number: G4140-90050
URL: http://www.chem.agilent.com/Library/usermanuals/Public/G4140-90050_Two-Color_GE_5.7.pdf
This document describes Agilent's recommended procedures for the preparation and labeling of complex biological targets and hybridization, washing, scanning, and feature extraction of Agilent 60-mer oligonucleotide microarrays for microarray-based two-color gene expression analysis.
P-MTAB-30961
treatment protocol
ES cells were transfected with Lipofectamine2000 (Invitrogen) and treated with puromycin (1 mg / ml) for 72 hrs for positive clone selection. pSUPER-puro Lin-9 was generated by inserting an oligonucleotide with the following target sequence specific for mouse Lin-9 into pSUPER-puro: 5' GCUACUUACAGAGUAACUUUC 3' {Knight,2009}. Knight et al. 2009. A Lin-9 complex is recruited by B-Myb to activate transcription of G2/M genes in undifferentiated embryonal carcinoma cells. Oncogene 28:1737-1747
P-MTAB-30960
growht protocol
ES-D3 cells (ATCC CRL-1934, mouse embryonic stem cells) were cultured in DMEM (Life Technologies) supplemented with 15 % FCS, 1 % Pen/Strep, 1% non-essential amino acids (NEAA)( Life Technologies), 1mM b-mercaptoethanol, 1mM Na-pyruvate (Life Technologies), 1000 u/ml LIF on gelatin coated dishes.
P-MTAB-30962
nucleic acid extraction protocol
RNA was isolated using the Nucleospin RNA II kit (Macherey-Nagel, Dueren, Germany) according to manufacturers instructions.