5 protocols
AccessionNameType
P-MTAB-28700
data acquisition
All sequences begin with the molecular identifier sequence followed by the barcode and the actual mouse cDNA sequence.
P-MTAB-28699
sequencing
sequencing was performed by tag profiling essentially as described (Kivioja et al, Nat Methods, 2011, PMID:22101854). Briefly, fragmented was reverse transcribed by mixing 3ul diluted and fragmented with 1ul 12uM oligoT primer CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTTTTTTTTTTTTTTTTTTVN containing homologous sequences to Solexa/Illumina adapters. To the annealed oligoT-reverse transcription mixture containing 1ul 12uM barcoded template switch oligo (TCTTTCCCTACACGACGCTCTTCCGATCTNNNUNNNNUNNNXXXXrGrGrGrG, where U is deoxyuridine, XXXX is four nucleotide barcode and rG is riboguanosine), 5.25ul RNAse-free water, 3ul 5X Reverse Transcriptase Buffer (Fermentas), 0.75ul 10 mM dNTP, 0.25ul Superase.In RNAse inhibitor (Invitrogen), 0.75ul Revert aid Premium Reverse transcriptase (150 U, Fermentas). The total volume of the reverse transcription reaction was 15ul. The reactions were incubated at 50 degrees C for 1h and heat inactivated at 85 degrees C for 5 min. The cDNA was amplified using Solexa/Illumina compatible adapter primers by mixing 10 ul 1.5 M Trehalose, 2.5 ul reverse transcription reaction, 5 ul 5xPhusion HF Buffer (Finnzymes), 1.5 ul Solexa-primer-F AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and Solexa-primer-R CAAGCAGAAGACGGCATACGAGCTCTTCCGATC (5 uM each). 0.5 ul 10 mM dNTP, 5 ul 5M betaine and 0.5 ul Phusion HotStart II polymerase (Finnzymes). The following thermal cycling settings were used: denaturation: 1 min at 98 degreesC, followed by 20 cycles of 15 s at 98degreesC, 25 s at 60degreesC, and 1 min at 72 degreesC. Barcoded samples were sequenced as pooled libraries. Sequencing was performed at Genotypic Technology Pvt. Ltd, Bangalore, India, using 54 bp single end sequencing on Illumina GAIIx.
P-MTAB-28698
nucleic_acid_extraction
Frozen liver samples (100-200 mg) were transferred to QIAzol Lysis Reagent (Qiagen) and homogenized using Precellys homogenizer (Bertin Technologies) for 30 sec. After chloroform addition, total was precipitated from the aqueous phase with 1/10 volume of 3M sodium acetate, pH 5.0 and one volume of isopropanol. 15 ug total was fragmented for 3 min at 70 degreesC in fragmentation buffer (Ambion). Fragmentation was terminated by cooling of the sample on ice and addition of EDTA to 17 mM final concentration. 2.5 ul fragmented was then mixed with 0.5 ul 100 mM MgCl2 and diluted to 30 ul with RNAse-free water.
P-MTAB-28696
grow
Female mice were grown to 14 weeks of age on normal laboratory conditions before analysis
P-MTAB-28697
specified_biomaterial_action
Partial (70%) hepatectomy was performed for two mice of each genotype and liver was allowed to regenerate for 96 hours. Untreated mice (two of each genotype) were used as controls.