6 protocols
AccessionNameType
P-GSE39074-6
normalization data transformation protocol
Library strategy: TL-Seq Reads mapped to genome with Bowtie. Reads assigned to genes. Intergenic reads were assigned to the closest gene, regardless of strand. Antisense reads were ignored for subsequent analyses. Peaks were called assuming a uniform background distribution, using Poisson distribution to identify regions of high read density. Genome_build: Scer downloaded from yeastgenome.org on May 26, 2010. Supplementary_files_format_and_content: Tab-delimited file of monopeak TL genes giving TL length.
P-GSE39074-4
normalization data transformation protocol
TATL-SeqCombined.wig is TATL-SeqFraction1.wig through TATL-SeqFraction7.wig computationally pooled reads (simply the sum of all the other read densities). Each file is the read abundance at each position of the sacCer3 genome. Reads were mapped to the genome, then annotated splice junctions allowing for 3 mismatches (just as in the associated paper). Library strategy: TL-Seq Reads mapped to genome with Bowtie. Reads assigned to genes. Intergenic reads were assigned to the closest gene, regardless of strand. Antisense reads were ignored for subsequent analyses. Peaks were called assuming a uniform background distribution, using Poisson distribution to identify regions of high read density. Genome Build: sacCer3 Supplementary_files_format_and_content: Tab-delimited file of monopeak TL genes giving TL length
P-GSE39074-2
growth protocol
Yeast cultures (Sigma 1278b MAT a ura3 leu2 trp1 his3 and BY4742 Mat α his3∆1 leu2∆0 lys2∆0 ura3∆0) were grown to mid-log (OD600~0.5-1.0) phase in YPAD (1% yeast extract, 2% peptone, 0.01% adenine hemisulfate, 2% glucose) at 30°C in flasks with vigorous shaking.
P-GSE39074-5
nucleic acid library construction protocol
200-1000 µg RNA was subjected to poly(A) selection using oligo dT cellulose as described previously (Sambrook et al.). Poly(A)-selected RNA was fragmented by alkaline hydrolysis (2 mM EDTA, 100mM NaCO3, pH 9.3) for one hour at 95°C. RNA fragments were gel purified and dephosphorylated with 30 U Calf-Intestinal Phosphatase (CIP, NEB) in 50 ml reactions containing 100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 1mM DTT, pH 7.9 at 37°C for 60 min, followed by phenol:chloroform extraction and isopropanol precipitation. Purified CIP-treated fragments were treated (or mock-treated) with 25 U Tobacco Acid Pyrophosphatase (TAP, Epicentre) in 50 ml at 37°C for two hours, then precipitated. Next a 5’RNA adaptor (AAUGAUACGGCGACCACCGACAGGUUCAGAGUUCUACAGUCCGACG) was added via ligation in a 20 ml reaction with 20 U of T4 RNA Ligase (NEB) for one hour at 37°C. Gel purification of a higher molecular weight species yielded the ligated RNA, which was then 3’end captured via poly(A) tailing (TL-Seq, as previously described in (Ingolia et al., 2009)) or ligation with preadenylated adaptor (TATL-Seq, as previously described in (Mayr and Bartel, 2009)). cDNA was prepared from ligated RNA (Superscript III, Invitrogen), amplified by 10-12 cycles of PCR (Phusion, Finnzymes), and sequenced on an Illumina HiSeq 2000.
P-GSE39074-1
sample treatment protocol
Total RNA was isolated from yeast cell pellets by hot phenol extraction as described (Clarkson et al., 2010). Polysome gradients were prepared and RNA was extracted from gradient fractions as described (Arribere et al., 2011).
P-GSE39074-3
nucleic acid library construction protocol
200-1000 µg RNA was subjected to poly(A) selection using oligo dT cellulose as described previously (Sambrook et al.). Poly(A)-selected RNA was fragmented by alkaline hydrolysis (2 mM EDTA, 100mM NaCO3, pH 9.3) for one hour at 95°C. RNA fragments were gel purified and dephosphorylated with 30 U Calf-Intestinal Phosphatase (CIP, NEB) in 50 ml reactions containing 100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 1mM DTT, pH 7.9 at 37°C for 60 min, followed by phenol:chloroform extraction and isopropanol precipitation. Purified CIP-treated fragments were treated (or mock-treated) with 25 U Tobacco Acid Pyrophosphatase (TAP, Epicentre) in 50 ml at 37°C for two hours, then precipitated. Next a 5’RNA adaptor (AAUGAUACGGCGACCACCGACAGGUUCAGAGUUCUACAGUCCGACG) was added via ligation in a 20 ml reaction with 20 U of T4 RNA Ligase (NEB) for one hour at 37°C. Gel purification of a higher molecular weight species yielded the ligated RNA, which was then 3’end captured via poly(A) tailing (TL-Seq, as previously described in (Ingolia et al., 2009)) or ligation with preadenylated adaptor (TATL-Seq, as previously described in (Mayr and Bartel, 2009)). cDNA was prepared from ligated RNA (Superscript III, Invitrogen), amplified by 10-12 cycles of PCR (Phusion, Finnzymes), and sequenced on an Illumina Genome Analyzer II.