E-GEOD-26941 - CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

Status
Released on 2 April 2013, last updated on 2 June 2014
Organism
Anopheles gambiae
Samples (4)
Array (1)
Protocols (8)
Description
In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 ºC and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5’ TCCATGACGTTCCTGATGCT 3’) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
Experiment type
transcription profiling by array 
Contacts
MIAME
PlatformsProtocolsFactorsProcessedRaw
Files
Investigation descriptionE-GEOD-26941.idf.txt
Sample and data relationshipE-GEOD-26941.sdrf.txt
Raw data (1)E-GEOD-26941.raw.1.zip
Processed data (1)E-GEOD-26941.processed.1.zip
Array designA-AFFY-102.adf.txt
Links