A-MAXD-9 - Reading University Daphnia magna 14K V2.3

Organism
Daphnia magna
Description
Spotted cDNA fragments. Features are presented as "ID"-Block-Column-Row

Origin: Non-commercial

Availability: Reading University - Dr Amanda Callaghan

Spotting Method: We have constructed a microarray with 13,455 ESTs obtained from Selective Subtractive Hybridisations (SSH) on organisms exposed to cadmium, lufenuron, low pH and calcium limitation, as well as between adults and juveniles, and a cDNA library from unexposed organisms. Selective Subtractive Hybridisations were performed using a Clontech?? PCR-Select cDNA Subtraction Kit (Clontech Laboratories Inc, USA). Complementary cDNA was prepared from mRNA extracted from batches of 100 D. magna, under 24 h old, using a Straight Aa?"s mRNA Isolation Kit System (Novagen Inc., UK). Because of the high abundance of ribosomal RNA still present in the mRNA sample, post synthesised cDNA was later amplified using a Super Smart PCR cDNA Synthesis Kit (Clontech Laboratories Inc, USA). This process relatively reduces the abundance of ribosomal RNA by amplifying the copy number of poly-A synthesised product. Complementary DNA fragments were cloned with plasmid vectors pCRA?4-TOPOA? into competent Escherichia coli cells using a TOPO TA Cloning Kit for Sequencing (Invitrogen, UK). Resulting colonies were amplified using M13-Long primers (forward 5' cgacgttgtaaaacgacggccag 3' and reverse 5' caggaaacagctatgaccatgattacgcc 3'). The amplified products were purified using Millipore Montage 96-well cleanup plates (VWR International, UK). Purified PRC samples were diluted in DMSO to 50% for a more uniform print. Spots were printed on Corning CMT-UltraGAPS glass slides (Fisher, UK), in a 16 x 17 block format, with 48 blocks per microarray, using an Omnigrid 100 (Genomics Solutions, USA). Microarray slides were stored under vacuum, in total darkness, at room temperature until required. A number of control spots were printed in each of the 48 blocks on the arrays. The spots comprised of Daphnia magna genomic DNA, four Spot Report System PCR products from Arabidopsis thaliana; CAB, RCA, RBCL and LPT4 (Stratagene, USA), along with negative hybridisation controls consisting salmon sperm DNA, mouse Cot 1, human Cot 1, yeast transfer RNA (tRNA) and poly A RNA. Cot 1 is human or mouse placental DNA enriched for repetitive sequences, thus reducing miss-hybridisation. Yeast tRNA reduces undesired non-specific DNA hybridisation. Poly A RNA promotes specific hybridisation with the labelled cDNA, thus reducing hybridisation with the array. (Stratagene Spot Report Oligo Array Validation System a? instruction manual 252270) Blank spots using 50% DMSO, were printed interspaced with the above controls and were used to qualitatively assess the microarray hybridisations and provide orientation for the grid overlap during assessment. Microarray Annotation Sequencing of ESTs was carried out with M13-Long primers and annotated according to BlastX homology search alowg with Uniprot Swissprot (database for all organisms) and Uniprot Tremble (invertebrate database). Primarily, sequences found to respond significantly were annotated.

Adhesion Method: UV-Crosslink

Number Of Plates: 395
Links
All experiments done using A-MAXD-9: (E-MAXD-20, E-TABM-793, E-TABM-797, E-TABM-798)
Files
Array DesignA-MAXD-9.adf.txt