Dbfetch

ID   FO203517; SV 1; linear; genomic DNA; STD; MUS; 1165 BP.
XX
AC   FO203517;
XX
DT   18-SEP-2012 (Rel. 114, Created)
DT   01-FEB-2013 (Rel. 115, Last updated, Version 4)
XX
DE   Mouse DNA sequence from PCR product PCR_129X1SVJ_AC087217_1 on chromosome
DE   17
XX
KW   PCR_CORRECTION.
XX
OS   Mus musculus (house mouse)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Glires; Rodentia; Sciurognathi; Muroidea;
OC   Muridae; Murinae; Mus; Mus.
XX
RN   [1]
RP   1-1165
RG   Genome Reference Consortium
RA   Heath P.;
RT   ;
RL   Submitted (01-FEB-2013) to the INSDC.
RL   Wellcome Trust Sanger Institute, Hinxton, Cambridgeshire, CB10 1SA, UK.
RL   E-mail enquiries: grc-help@sanger.ac.uk Clone requests: Geneservice
RL   (http://www.geneservice.co.uk/) and BACPAC Resources
RL   (http://bacpac.chori.org/)
XX
DR   MD5; db893b26c6f6c52aee8e62a30b733531.
XX
CC   -------------- Genome Center
CC   Center: Wellcome Trust Sanger Institute
CC   Center code: SC
CC   Web site: http://www.sanger.ac.uk
CC   Contact: grc-help@sanger.ac.uk
CC   --------------
CC   
CC   This PCR was performed to audit a questionable region in the reference
CC   genome sequence.
CC   
CC   Sequence from the Mouse Genome Sequencing Consortium whole genome shotgun
CC   may have been used to confirm this sequence. Sequence data from the whole
CC   genome shotgun alone has only been used where it has a phred quality of at
CC   least 30.
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..1165
FT                   /organism="Mus musculus"
FT                   /chromosome="17"
FT                   /mol_type="genomic DNA"
FT                   /clone="PCR_129X1SVJ_AC087217_1"
FT                   /PCR_primers="fwd_seq: gcaaacagaggtaaggaaac, rev_seq:
FT                   tcccttcgtctctattcctg"
FT                   /db_xref="taxon:10090"
FT   misc_feature    1..1165
FT                   /note="Sequence from genomic PCR only."
XX
SQ   Sequence 1165 BP; 370 A; 197 C; 324 G; 274 T; 0 other;
     gggaggagtc gcgagtagtg aggtgagttg ttttttatcc cttgccctag gtagaagcca        60
     gtagtagagt agtgaggagt tttagccctt gccgtgagta gaagtagagt aagagaagta       120
     gaataggagt agtttagccc ctgccctaag aagaagctgc tggggaaggg agctgtaaaa       180
     gaaaaacccc gaagtaaagt tgctgcatga acccaacttg gtgtctgtgt tgttcctgtc       240
     tcgccaccgg ctcggaggac cgggacaaat ggtggcccat acgccgtgaa aacagcagta       300
     gggaaatttt ggcaaacaga ggtaaggaaa ccttagtaaa cagcggtaag aaattttagt       360
     aaacagctgt aaggaaattt tggtaagcaa tggtatttaa agaaagcaca ggcctgtaag       420
     gttgcctgga aaaaagggac taagcattaa agttctcagt tagagactat taggttcccg       480
     gtaagtggga agattcaagt tctcggttag agaccattag accattaggt ttctggatta       540
     gggactatta aggttctcag gtatagagac gaaggtaagg ttcccgagaa aaaagggacg       600
     aagcattaag attctcagga atagagacga agggaatttc agcaacatgg gttcaattgc       660
     gactaaaatg acaatgaaaa tgttagtcat ctggatcttg gtcagggcgt gcttgaggga       720
     caccaatgga aagtacaata aggagattgc ttttcaggct agccgccgaa agtctaaaca       780
     gcttagacaa caaaccaaag ataagaaaga gaagaaggaa tctagctctg aagggtctat       840
     tagtgacagc aacaagactg atagtgaaag ctgtcgtcgg atgttctgct ggaggttgag       900
     gcgcggtagg ccgcccaaac catcagccac tctgttgcct tctcctcccc tccataaaga       960
     tgagggagac aaaaagggaa agcatagtat gggtgatatt ttttatttgt ggatcctcta      1020
     atgtggaagt ggaagaggta tttgggaccc taactaaatg cctcttggag aagtggaatt      1080
     tggtgatagc cccagaaaaa gttcagaaga cagacataca acactattta ggtactaaag      1140
     tgagagatgc tgttgtcgag ccact                                            1165
//