spacer

EBI Dbfetch

ID   FO203502; SV 1; linear; genomic DNA; STD; MUS; 217 BP.
XX
AC   FO203502;
XX
DT   20-JUL-2012 (Rel. 113, Created)
DT   01-FEB-2013 (Rel. 115, Last updated, Version 4)
XX
DE   Mouse DNA sequence from PCR product PCR_129S1SVLMJ_AJ851868_2 on chromosome
DE   12
XX
KW   PCR_CORRECTION.
XX
OS   Mus musculus (house mouse)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Glires; Rodentia; Sciurognathi; Muroidea;
OC   Muridae; Murinae; Mus; Mus.
XX
RN   [1]
RP   1-217
RG   Genome Reference Consortium
RA   Heath P.;
RT   ;
RL   Submitted (01-FEB-2013) to the INSDC.
RL   Wellcome Trust Sanger Institute, Hinxton, Cambridgeshire, CB10 1SA, UK.
RL   E-mail enquiries: grc-help@sanger.ac.uk Clone requests: Geneservice
RL   (http://www.geneservice.co.uk/) and BACPAC Resources
RL   (http://bacpac.chori.org/)
XX
DR   MD5; 124768932bfe4ac7f77a08019735f5ab.
XX
CC   -------------- Genome Center
CC   Center: Wellcome Trust Sanger Institute
CC   Center code: SC
CC   Web site: http://www.sanger.ac.uk
CC   Contact: grc-help@sanger.ac.uk
CC   --------------
CC   
CC   This PCR was performed to audit a questionable region in the reference
CC   genome sequence.
CC   
CC   Sequence from the Mouse Genome Sequencing Consortium whole genome shotgun
CC   may have been used to confirm this sequence. Sequence data from the whole
CC   genome shotgun alone has only been used where it has a phred quality of at
CC   least 30.
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..217
FT                   /organism="Mus musculus"
FT                   /chromosome="12"
FT                   /mol_type="genomic DNA"
FT                   /clone="PCR_129S1SVLMJ_AJ851868_2"
FT                   /PCR_primers="fwd_seq: aatgtttgtgctaaccatcg, rev_seq:
FT                   taacttcacacagccagatg"
FT                   /db_xref="taxon:10090"
FT   misc_feature    1..217
FT                   /note="Sequence from genomic PCR only."
XX
SQ   Sequence 217 BP; 46 A; 46 C; 71 G; 54 T; 0 other;
     aatgtttgtg ctaaccatcg ggacacatcc catgagttct gaagcagtgt gttgttcttc        60
     atgcatggcc cttttgtaga gctgtgagtg taggggaaga ggggggagag agagcccgtg       120
     tccagccaga gatcctgtgc tctgggcagg cagacacggg aggacaaccg aacacttttc       180
     actcggcctt tggtgggcat ctggctgtgt gaagtta                                217
//


spacer
spacer