
ID   JX050004; SV 1; linear; mRNA; STD; MUS; 443 BP.
AC   JX050004;
DT   06-AUG-2012 (Rel. 113, Created)
DT   06-AUG-2012 (Rel. 113, Last updated, Version 1)
DE   Mus musculus UCHL-1 mRNA, partial cds.
KW   .
OS   Mus musculus (house mouse)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae;
OC   Murinae; Mus; Mus.
RN   [1]
RP   1-443
RA   Katakam M., Mallarapu L.D., Pawar R.M., Goel S.;
RT   "Expression of Ubiquitin Carboxy Terminal Hydrolase (UCHL-1) Gene in Testes
RT   of a Wide Variety of Vertebrates";
RL   Unpublished.
RN   [2]
RP   1-443
RA   Katakam M., Mallarapu L.D., Pawar R.M., Goel S.;
RT   ;
RL   Submitted (14-MAY-2012) to the INSDC.
RL   Laboratory for the Conservation of Endangered Species, Centre for Cellular
RL   and Molecular Biology, Uppal Road, Hyderabad, AP 500007, India
DR   MD5; d6e7f81ebc15da555b729fa24fa1b5c7.
FH   Key             Location/Qualifiers
FT   source          1..443
FT                   /organism="Mus musculus"
FT                   /mol_type="mRNA"
FT                   /tissue_type="testis"
FT                   /PCR_primers="fwd_name: uchl-1f, fwd_seq:
FT                   cccgagatgctgaacaaagt, rev_name: uchl-1 r, rev_seq:
FT                   ccaatgtcgggtagatgaca"
FT                   /db_xref="taxon:10090"
FT   CDS             <1..>443
FT                   /codon_start=1
FT                   /product="UCHL-1"
FT                   /db_xref="GOA:I7ENE7"
FT                   /db_xref="InterPro:IPR001578"
FT                   /db_xref="InterPro:IPR030297"
FT                   /db_xref="InterPro:IPR036959"
FT                   /db_xref="MGI:MGI:103149"
FT                   /db_xref="UniProtKB/TrEMBL:I7ENE7"
FT                   /protein_id="AFP20215.1"
SQ   Sequence 443 BP; 113 A; 118 C; 130 G; 82 T; 0 other;
     cccgagatgc tgaacaaagt gttggccaag ctgggggtcg ccggccagtg gcgcttcgcc        60
     gacgtgctag ggctggagga ggagactctg ggctcagtgc catcccctgc ctgcgccctg       120
     ctgctcctgt ttcccctcac ggcccagcat gaaaacttca ggaaaaagca aattgaggaa       180
     ctgaagggac aggaagttag ccctaaagtt tacttcatga agcagaccat cggaaactcc       240
     tgtggtacca tcgggttgat ccacgcagtg gccaacaacc aagacaagct ggaatttgag       300
     gatggatccg tcctgaaaca gtttctgtct gaaacggaga agctgtcccc cgaagataga       360
     gccaagtgtt tcgagaagaa cgaggccatc caggcagccc atgactccgt ggcccaggag       420
     ggccaatgtc gggtagatga caa                                               443