
ID   HE648920; SV 1; linear; genomic DNA; STD; HUM; 270 BP.
AC   HE648920;
DT   10-JAN-2012 (Rel. 111, Created)
DT   10-JAN-2012 (Rel. 111, Last updated, Version 1)
DE   Homo sapiens partial HLA-DRB1 gene for MHC class II antigen, allele
DE   HLA-DRB1*03, exon 2
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-270
RA   Masson D.M.;
RT   ;
RL   Submitted (29-DEC-2011) to the INSDC.
RL   Masson D.M., EFS Rhone Alpes, HLA Laboratory, BP35, 38701, FRANCE.
RN   [2]
RA   Masson D.;
RT   ;
RL   Unpublished.
DR   MD5; ea7e87e1769fe127d17540a756e3d61e.
FH   Key             Location/Qualifiers
FT   source          1..270
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: 1RB5, fwd_seq:
FT                   agcactaaggaagggttcag, rev_name: 2RB28, rev_seq:
FT                   acacacacactcagattccca"
FT                   /db_xref="taxon:9606"
FT   exon            1..270
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*03"
FT                   /number=2
FT   CDS             <1..>270
FT                   /codon_start=3
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*03"
FT                   /product="MHC class II antigen"
FT                   /function="antigen presentating molecule"
FT                   /db_xref="GOA:H2AM04"
FT                   /db_xref="IMGT/HLA:DRB1*03:01:12"
FT                   /db_xref="InterPro:IPR000353"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="UniProtKB/TrEMBL:H2AM04"
FT                   /protein_id="CCF23452.1"
SQ   Sequence 270 BP; 59 A; 64 C; 98 G; 49 T; 0 other;
     cacgtttctt ggagtactct acgtctgagt gtcatttctt caatgggacg gagcgggtgc        60
     ggtacctgga cagatacttc cataaccagg aggagaacgt gcgcttcgac agcgacgtgg       120
     gggagttccg ggcggtgacg gagctggggc ggcctgacgc tgagtactgg aacagccaga       180
     aggacctcct ggagcagaag cggggccggg tggacaacta ctgcagacac aactacgggg       240
     ttgtggagag cttcacagtg cagcggcgag                                        270