
ID   GU997628; SV 1; linear; genomic DNA; STD; HUM; 18819 BP.
AC   GU997628;
DT   11-JUN-2012 (Rel. 113, Created)
DT   11-JUN-2012 (Rel. 113, Last updated, Version 1)
DE   Homo sapiens annexin A1 (ANXA1) gene, complete cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-18819
RA   Perez Solis E.E.;
RT   ;
RL   Submitted (13-MAR-2010) to the INSDC.
RL   Cellular and Molecular Neuroscience, CINVESTAV, Av Politecnico 2700,
RL   Mexico, D.F 23000, Mexico
DR   MD5; 2e9dbc2e7d58f609a807602f98a008e3.
DR   Ensembl-Gn; ENSG00000135046; homo_sapiens.
DR   Ensembl-Tr; ENST00000257497; homo_sapiens.
DR   Ensembl-Tr; ENST00000376911; homo_sapiens.
FH   Key             Location/Qualifiers
FT   source          1..18819
FT                   /organism="Homo sapiens"
FT                   /chromosome="19"
FT                   /map="19q24"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_seq: gcccctatcctaccttcaatcc, rev_seq:
FT                   cctttaaccattatggccttatgc"
FT                   /db_xref="taxon:9606"
FT   gene            <6672..>18243
FT                   /gene="ANXA1"
FT   mRNA            join(<6672..6737,6831..6939,7465..7559,8399..8512,
FT                   8939..9029,10918..10997,11612..11668,13252..13345,
FT                   14233..14328,15633..15691,17168..17290,18187..>18243)
FT                   /gene="ANXA1"
FT                   /product="annexin A1"
FT   CDS             join(6672..6737,6831..6939,7465..7559,8399..8512,
FT                   8939..9029,10918..10997,11612..11668,13252..13345,
FT                   14233..14328,15633..15691,17168..17290,18187..18243)
FT                   /codon_start=1
FT                   /gene="ANXA1"
FT                   /product="annexin A1"
FT                   /note="member or the annexin family"
FT                   /db_xref="GOA:Q5TZZ9"
FT                   /db_xref="InterPro:IPR001464"
FT                   /db_xref="InterPro:IPR002388"
FT                   /db_xref="InterPro:IPR018252"
FT                   /db_xref="InterPro:IPR018502"
FT                   /db_xref="UniProtKB/TrEMBL:Q5TZZ9"
FT                   /protein_id="ADZ76495.1"
FT                   ALCGGN"
SQ   Sequence 18819 BP; 6077 A; 3064 C; 3440 G; 6238 T; 0 other;
     agtgtgaaat cttcagagaa gaatttctct ttagttcttt gcaagaaggt agagataaag        60
     gtaagtcttg gttttccttt tagttagttt tggttgtttt gaaaactttt ctcatcacta       120
     tgttaaatgt tactgcttct acaggattta tggttagttg catttaacat gataagtcat       180
     tcataaatct ttctgtagaa ttacattgga tatttatatt ttaggaatca caaattacaa       240
     tatttttgtt ctacttagtt aacaaataca agtaaaaata agataagttt gcttaatact       300
     ggctcattgt actcttggta agttaccatg agaaagaagg gaagaatgtg ctttccctct       360
     ggtagcctta aaagaatgtg tttttccttt ccttcccctt gaaatatttc ttcccaagag       420
     ctgtgtgttt tacagagaaa tcgtgatggg ggctgctttt tgggggcaag aacaaaagtg       480
     ataggagtgg gctgcaggga actgtttcaa aatagtagga ctttcataat ttattttctt       540
     cttttgtaag gaaaacaaga tagattcaga cctcaaagtg ctaatcatgc tctttgtaat       600
     aaacatttaa aaatatatgt tatatttgct tatgctattt aaaataagaa ggtccgctta       660
     ttactttttt catttaaaga gggtgtggcc acattccttt tcttgtaggc tctgtgtcat       720
     atacagtctt ttcaagtgct ggctggaaaa cctaaaaaga agggaaatac tttctgggta       780
     gtgtcagata cattatccta ggggaatgtc agtgaggccc tccaacagct attccacttg       840
     attgttgcat gagctaatgg ccataaaact ccttagaaaa gcacaaagca aaactaaaga       900
     agagtattta ctagtgttgg atatatttgt aaaagtgaga ttacaaatca tgtatctggc       960
     tatttttttc ttaaacatgt tccttcaaga atttttctgt tcgttcattt taaatattta      1020
     ttaaatgttc tgatttctta tgttcactgc tagctaatta acaaggatgg aatttttctt      1080
     gccttggtta tatctaaaag attgtaaaaa ctttgagaaa gcaatgttgc cctctttcca      1140
     caggagtatt ttggtagctg taagagaatg cacattgcaa atgactcaaa tgtggtaaaa      1200
     tgttggtttc ataattctga aatggcctct tccccaaaag tgacagtaac accctagctc      1260
     caggctcaac cacatccagc acatagccaa catttaacag atgttgacaa aatagttaat      1320
     aataatatta ttaaggaacc agccagagtt tcatgcttat taaatacttt ttcaaccaga      1380
     aggtctgcaa aggttgattt ctgaatatga cgttagctct ctctagacct attaatttac      1440
     gacatttcaa atcagaggta aaccagcaga cctattattt ttcaatgata aactataaac      1500
     agttttttga agtcaactat ttccttttcc tttaaaattg gacagaattt catcaggaag      1560
     ctcagaacaa tccaatttat ataatgcctt ccttcattat gctaattttc ttcatcttca      1620
     tctacttgaa gtaatattta agattggcac ttcagagctg taaatggatc ttagatgata      1680
     attacttcaa cattcttatt ttataaacga agaccctctg gagaagctaa atgtttttct      1740
     tgaggtcaga tcgccagata atcaagaacc agtatacttc aatttgtatt ttatatccta      1800
     tagttgtggg tagaaaatgt tcattaaatt agtgtagata tgttttttaa aatattagca      1860
     atgatacatg atattcattc aataatactt attaacatcc taaattccag gcattttgct      1920
     agggattgga agtacataca taatgaatat tattatttgt atgttagcac gggcctcatg      1980
     gcctgctcct ggggaatata aacaagccaa tggaaagtga taatacagaa aggtggggct      2040
     ggtgtagggg tgaagtcagg atgctttggg agagcatgga aggtcaccga atccagtgct      2100
     gaggaactaa tgaagggttt ctgaagaacg tgatgagatc aatgctgatg agtcacttag      2160
     aagtagcaat tagttaggca aagggaagtg aatgtggagg aggaacaagc attccaggca      2220
     agaagaacac cctatcgaaa agcctggaag caaaacatta gtgaggctac ctttcataaa      2280
     ttgctttctg taagtcatgc cattgtgtag tcttaattgc tttctctcac cagggaaggt      2340
     gtgggaagga cttgtgaaat acatattcga ggaaaaacta tgcacaaggc cgtgcattta      2400
     aaaataaact ccctaaggct ggggtgaaac ctgctacggt ctgcgcaagt tgactgttaa      2460
     tgaatttgat tctcaggtgt gagtgattaa aagaacactg atcatgtcat tttctttttg      2520
     gtcactaatt ccctccctcc cttctctttc ttttcttttt tcttttcttt tctttttctt      2580
     tctttcttcc cgacagagtc ttgttatgtc gcccaggatg gagtgtagtg gtacaatctc      2640
     ggctcactgc agcctccgcc tcttcctggg ttcaagtgat tctcctgcct cagccttctg      2700
     agtagatggg actacaggtg cacaccacca tgcctggctg atttttgtac ttttggtaga      2760
     gacggggttt cgccatgctg gccaggctgg tcttgaactc ctggcctcaa gtaatctgcc      2820
     caccttggcc tcctaaattg ctgggattgc aggtgtgagc caccatgcac agccaaaata      2880
     tataacactt tggaatcaaa agggatggat ttatgtctcc attcttgcca ctactagcag      2940
     gaagactgct tgaaaatagc actcagtttt cccagataga aactgaggat aatgattaaa      3000
     ggctattatt ccaagcaagg gttagtcatt gctgttacta tcattgcaaa actctgatag      3060
     ttctagattg taaccaggaa gatacaatca accacaaaac tcagcttcct ctgtcacaaa      3120
     ttctagatag aggtagcctt tcatgaggct gagagatgga aaaatgaagc ggggggactc      3180
     tcttaggaca cataaatatg caaaaaaatt gctacgcttt agaaagctat acattcaaat      3240
     catagataag ctgacattag taggcagtgc atgttcacaa aaagaccatt aattagaaga      3300
     aatgtgaaat attgttaatt tccttataga tttgcctatg tataaatggc caatttcacc      3360
     gtcaatgagc tcatgctaag tactgaaata aacttagttt tagagcttat ctttggttag      3420
     ttgaaatctg tattgagtta gttgaaatct ataagttgat agaacaggct ctttaaaatc      3480
     tattgcaagc tttatacact acaaacaaaa agatagaaaa aagaaaacct ttcatgaact      3540
     cattggctta ggcaggtttt catgcagagt gtaggtattg aagagtcaga acggcttaag      3600
     gatagaattt ggccaatata taaaaaaata tatatttggt atttgttagt tgtattataa      3660
     ttattcagaa gttcagttaa tacgtgcagt tggctttgag cccttaacca gctgtatgtg      3720
     ataaaatctg tttcctttag agcaatttct tatatcctgc cttgatgctc ctgtctttaa      3780
     tctttgctaa gagctggtgg tgaatttggc tgaattcaga ttccgttttt ctctaattga      3840
     tttcttgaag aaaattctct attggttgct tttctttcct agattatgct tttagtctat      3900
     ccaaatactt caggctagaa tgtaggaact tagaagatac aaatcacaaa gctgtctcct      3960
     ctagggatgc tctctctttc aaataagtga cttaaacaac ttatttttgt tatcttgtgt      4020
     tatgtaatta atataccttt tcctgggctt tctctggctt tttttttaaa tggacattat      4080
     tcaagtattt tttagaagta aaaaaaaaac agtacagtaa agtttttata acgtttattt      4140
     tgaagttgtc agagacacct ttaatattag actggacaat atctttagtc tttcttttgc      4200
     tttcttttga agtttttatt tgctaattga aaagaatgga ataataataa taataataat      4260
     aaataaataa taataataaa taatataaat aaataaataa ataaataaaa taaataaata      4320
     ataaaaacat gtttttataa gtgatggagt agtactttgc caagtgatga attttaacac      4380
     tcattttgat gattcttcct tatcaaagcc ttggatgaaa tgatgaaaat ggaaattttg      4440
     agtgcctgaa gctgctagaa ttgcttttaa agtattgggt gtgccaatta agaaggtgga      4500
     atatgaaact ccatgtggca accgcaattg catgaaacta gactgtaatg ggaactaaaa      4560
     ccttgtgcaa aattgcgggt tgttacttta tcaggaagca attttaagtc tatcaattat      4620
     atttaggaaa caggctgctt taaatgaatg gaaaaagtat tggttcttct cacagatgac      4680
     agaatagtaa taagagcaat cccatgcgaa ttaagtgggg atgatttctg ctttggatat      4740
     tattttcttc atgcattcag tgttattact tgcaactcca gttacttttt agcaggtgaa      4800
     aatggaaaga gtttgtctga acatgctgtt gaggaatcag tttatggaat cagtttatgc      4860
     ctcatgagtc atttatcttc atatcaagaa tttaaaactg ccaagattgt cctcccaacc      4920
     tctctcacaa acattcatga gagtagtctc tagaggggtg aaacagaatg gtgtagatag      4980
     acagatcagt gtagaccttg agcaaggcct ctgaaaaaca tccccagact aaaaggatct      5040
     gtgatggcat tttgtgtgtg tgtggccaaa acagagaaca cattaatttt caatatactt      5100
     aagatcttaa aaatatatgt ctcattaaat aaaaatattg ccaagtcatg atagcaattc      5160
     aagaaatttc ctttaagata gagtttgcca aaagaacatg catgttacaa ttgcacctct      5220
     aggcttcctg ctacaacaaa aaaatccagt ataaaataat tcttttctgg gttttttgtg      5280
     ttgggtggga aaatatgtag gactactatt tagacagctc aaataggaag aaatgtgaag      5340
     atagcaatta cttcaatgct gagtactttt atatcaagaa atagaaaagg aaactaaatt      5400
     attcagggag aaatatcacc tggatatctt tttacaatta aaattttaaa tctgaattca      5460
     cttgtacaga ttggcacaag ttattttacc ttataaatgt aatcattggc tgggagtggt      5520
     agctcacacc tgtaattcca gcactttggg aggccgaggc gggcagatca cttggggtca      5580
     tgagttcaaa atcagcctag ccaacatggt gaaaacctgt ctctactaaa aatacaaaaa      5640
     ttagccgggc gtggtggctg gtgcctgtaa tcccagctac tcaggaggct gaggcaggag      5700
     aattgcttga acccaggaga cggaggttgc agtgagtcga gatttcacca ctgcactcca      5760
     gcctgggcga cagagaaaga ctccatctca aaaaaaaaaa aaaaaaaaaa agcaatcatt      5820
     aagcttttca tctagccatt acttttgtac aggctctcat taattccaca tagatggtct      5880
     aatggtctac taaatagtat tctaatcctc catcttgtct atctcttagc cattctccat      5940
     gataaaggat gaatggtctt tcggaaacat aaatgaaacc atgctgcttt aaaaaaacaa      6000
     acaaacaaaa agaaacccat taatgttttc ccaaagcttt gtggacacat tgaagcttct      6060
     tgtttcagct tctgccaaca tttctcgctc cagcaaactt tcttctgctt cccaaatatg      6120
     acaagcttct tctttaactt ttctgccagg ttaatcttga ctcatttcaa gagaggcttg      6180
     ggtcagccag ggcctactct aagaagtttc tttagccctt atgttttcct atggagagca      6240
     cacactagct ttaagtcctg agggtactta agatgatatt tcaatgtttt tgtactctta      6300
     gtgcttggca tatggtgggt ggtctacaaa tttagaacaa tgtagtgaac cacaaactcc      6360
     tctcttcagc ctgtgtgctt acttgtagta gttgtctgat ctctaaaatt tagaactgaa      6420
     tatgccaaga aagagttcaa tttcagagag gagggtatgg tttcatttta agtataaaag      6480
     cttcctttaa aaaaaattac gtcttacatt ttgttatgct cctaagtgta attgatcctg      6540
     gaaagtaagc gcaaggctac tctctaatgc taactcttat gtatgtaaga ggtgaggaag      6600
     gagaggttgt gtgtggtgca tttgttttgt aaaagcatct aactgttttc tttccagaca      6660
     ctttttcaaa aatggcaatg gtatcagaat tcctcaagca ggcctggttt attgaaaatg      6720
     aagagcagga atatgttgta agtagagtga taataaaatt atgattacaa tattgaaata      6780
     aaaacgaata taagtaaatg gccattaatt tatttctctc tcattcttag caaactgtga      6840
     agtcatccaa aggtggtccc ggatcagcgg tgagccccta tcctaccttc aatccatcct      6900
     cggatgtcgc tgccttgcat aaggccataa tggttaaagg taacgtgttt cctcaaaaca      6960
     gttccctcct ggacatttca gaatggctat ttgaatgact gtcaaaaaac agacatgtgc      7020
     aatggaaaga atctgtttca ttttgaagat aaaaacattt ctttgccaaa cgaagatgta      7080
     attatttact taacactgag gaaattgtgt tcacatcagt ggaatctcta ttgttacagc      7140
     agatattact ggctcatttc tagcagaaat tccatgctga aattaaaagc tctgttcaca      7200
     tatagagttg caactagtat caaacactgc aacactgagg gccaggaaaa gttaattgtc      7260
     tcttcctttc tcactcgaat gaaatgtcat tctcccaagt gcttccttga tatgtagtat      7320
     agcatcgatt ttttaggctg atatataatt tatatttctt aatttgttaa gaagttcttt      7380
     tggagcatct cagtaatgaa ttattttatg tcaattgatg atgaagaaaa ttggtgttaa      7440
     aggctgttgg ccctttattt ccaggtgtgg atgaagcaac catcattgac attctaacta      7500
     agcgaaacaa tgcacagcgt caacagatca aagcagcata tctccaggaa acaggaaagg      7560
     taagttagag tggtaaattt agatatttaa tttcagcata gttatactta accatggatt      7620
     cggaagcaca gttacctagt tctttaaggt tctaaccact gttttctcat tacatctatg      7680
     attgggattg cagtgtttat ccactttgtt gcaatttaat caattttatc aaatttccta      7740
     tttttataca ttagtcatct tggtgtatat tgtttgcaga tgtggtgctc tggggacaaa      7800
     tttttaattt gaacgtaaac atcgagattg ctgctgtcaa taaagaatat ggtctgattg      7860
     aaatgtacta atatttaaac tgaactgttt aatgcctaaa ttttatatat aattctactt      7920
     taaaaataag ccttatgtct tttataccaa atatgagtag ttttctaaag caatgaaatt      7980
     agaaaactat ataatttcag tatctgatta tactgcttgt tatttgagaa gtacaaacct      8040
     caaagattgg aaacatgaat atattatttt aaaagtaatt ttacttctgt tttctgttag      8100
     cacacagtcc tctgtgtttt gatctttgtg atttctcccc tgtgtataag attactaacc      8160
     ctatgcttta agaagttatt gatgaattca gtaaatttta ttttaatccc tctagatctg      8220
     gaagggtaag ataatgtttc aaaatatttg gtacactttg tatgtgaagg gaagaagctc      8280
     taaaagatgg ttgggtttag ggatgagttg tacgatgacc taaagtcagg taatatcaca      8340
     ttttttaacc tagcatgtta cttattggaa gtcctgattc taatcttttt ttttgtagcc      8400
     cctggatgaa acactgaaga aagcccttac aggtcacctt gaggaggttg ttttagctct      8460
     gctaaaaact ccagcgcaat ttgatgctga tgaacttcgt gctgccatga aggtaaatcg      8520
     cccaatttga gcaaactcct ttcctcaaga ggatgtattg ggcaagtcac ttatgcttat      8580
     gttattttca aaatctagta tagtacctgt caatcagtgg gagtttgaag aataaataaa      8640
     ttaatacctc aatgaaggaa ttaatatata aatgaaaaca gaaatgttgg cactaacacc      8700
     ttccatgtca tgtcactata tgagtcatat atttgcattt ttatttttac ccaaaatatt      8760
     gatgataaac ttgttttgtt ttagggcaat gtaatagagc ttattgtaat tattaaatgt      8820
     tgtgggtgaa atttactaaa tgacagagtc aaacaaattt tggaacacca aaaactcatt      8880
     gatcctcttg catgaagatt tttttctaca tttatccttt tcttctcttc aaatttaggg      8940
     ccttggaact gatgaagata ctctaattga gattttggca tcaagaacta acaaagaaat      9000
     cagagacatt aacagggtct acagagaggg taagttgtaa tgtccaacag tccaaacgcc      9060
     ttatttgaaa aggaaatcta atatactttc ttaaaattga ctgtctatgg taattatggc      9120
     agctttggaa tctccacata tcaaaatgtt tctttattgt ttggcacatg tctattaaat      9180
     gctgttacca ggcaacgctt gagttgctag gttgctgaca agggagatgg tgtcccaatc      9240
     cgcatcaagc ttgcgtttta atagaaaatg ttcctctagg ataaatggcc acatacgatt      9300
     ataatggaaa cctcaattca gagcattgaa tttttaaaaa tttctgaaaa acacttttct      9360
     attattctgg aatgtatttt ataaaaatgt cccaaggtca ttttttttga aaagaatata      9420
     taataacaaa aaaatctcct aacaaaatgt ttttcatttg tccttgaaaa agtaaagaat      9480
     taggtgctta taattctctg ttggaaacct taactttatc gttatgaaca taagagactc      9540
     actttatctc tagttaaatt cacagaataa aagactagtc ttagcttatt ttatctctcc      9600
     agtgaagcat ctcatttaaa tgatgtgctc aacactgaaa agagggtaat tgcaagtctc      9660
     ttaccatttt cctactctca tttccctgag ctgctggctt tttggctttc ccaatgcaat      9720
     atatggcata tagaagatct ttctgcttga ttctcatacc aagcatggag aatacaatag      9780
     cttttgcata tcattttcag aggaatttaa taaaagaata aaaataagga agcttttaaa      9840
     cctcattttc tgcaattctt atttaattac caatgtttat gttagatcca tgtgtcagtg      9900
     gtaataatga tgattatttt tgtttgataa aacatagttt ataaaaataa gtgtttatat      9960
     atttttcata tggccaagat ataggccagt gatagtttat tacattgccc agtttcaagt     10020
     tgttttagtc cgtttgtgtt gctataaaga aatatctgag accaagtaat gtaaaaagaa     10080
     aggaaatact gtacaagtag tatgggacca gcgtctgctt ttgatgaggg cctcatacta     10140
     cttctactca tggcagaaag cagacagaag cagatgtgtg cagagaggga gagagagaaa     10200
     aggaggtgcc aggctctttt caacagccag ttcttaaaga aactatgaat gagaactcac     10260
     tccgagccat tcatgaggga tctgccccca tcatccaaac atctcccaac aggccccacc     10320
     ttcaacagtg gagaataaat tgcaacatga gacttggcag ggccaaacaa acaatatgaa     10380
     aaccatagca ctagtcaatt ataaattcaa ttattttttc ctattacagt attattttat     10440
     gtagttaagc agaagtgttt acacacacat aaatcatcaa actgcattac ttataagaca     10500
     tttatagttt ttaaactaaa taaataattt gcattcaagc aagtacctca ttttgttctt     10560
     ttaaacaatt attttattca ttctattgct taaattctgc catgttgtat ttcagaatta     10620
     attactaatg tatacctata caatttattc ttaacgaaag ctttatgact gtgagttttc     10680
     aatcacagta ttatctaaat tgctcccatt gcttcatatg aaataaattc aatgatccaa     10740
     aaatttacct gctttaattt ttctcttctt atttaaaaat gataatattt tgcaacatgt     10800
     tccataagtc attgaacact gtggcactgt gaattttcaa ccaacttaga gatgtcagat     10860
     attcttatta ttattcatca ctggtttact ataaaatcta tttttctttt ttctcagaac     10920
     tgaagagaga tctggccaaa gacataacct cagacacatc tggagatttt cggaacgctt     10980
     tgctttctct tgctaaggta caactcagat actttaggaa atgcctcttg ttttataaag     11040
     actaatttct tagtccattt tgtgttgcta taagggaata tctgaggcta ggtaattttt     11100
     aaagataaaa aggtttattt ggctcaggat tctgatggct aacaaattca agtttgggta     11160
     tctatgtctg gtgagagcct caggctgctt ccactcctga cagaagagga aagggagctg     11220
     gtgtgtgcag agaccacatg gcaagaaagg aagcaagaga gagaatgggg aggtgccagc     11280
     ctcgttaaca accagctctc gtggttctca tgagcaagaa ctcattccca gtgacggcat     11340
     taatctcttc atgagagatc agccccagga cccaaatacc tccctctagg ccccaccttt     11400
     aacactgggg atcaaatttc aacatgaggt ttggagggga agaacatcta aaaccatcgc     11460
     aagtaaaatc ttgtatctga gctccttcta gaaatgagta atagaatacc tttttctcaa     11520
     aaaatattat ttatctgagt ttaagataat taagtaaatc atgcaattac atgctagaga     11580
     agagcttaca atagaatggg atttctttca gggtgaccga tctgaggact ttggtgtgaa     11640
     tgaagacttg gctgattcag atgccagggt aaggaagtgc ttacaaaata ctgctgcagt     11700
     tcatcttcct accttaagtg gggctaccac atgatcccct gtgaaagcaa atctaagatc     11760
     ttctgagaga ccaatggctt cttaatgttc atttcctgaa tgaggcatgt ctttctgtag     11820
     cccccacaca caaaaaagta gtctttgtaa gttttcaata tctctcatta ttcgtaaaac     11880
     cagagagaac tgaagaagga caatacaaat ttgatttgtc attcccaaga attgtttgtt     11940
     aaaaaaaact ctgacctttc gttgtactag gtataagaag gggaaatgta atttttttat     12000
     tatgtgcaat ggaaagagta agcatattta acgttatttt taacagagaa ctttggaatg     12060
     gtttatagat gtcaatttat attgtcaaaa tattactgca atgatataac aagagtatag     12120
     gataaattat aataatatat gctttctaac atattgtttt atttagtttc agtgacattg     12180
     ctgattattt atatgccaaa ccactggcaa cataagaaaa atcatatcat tttaaagcct     12240
     ggaatttcca tttaaaacaa acaaacaact aatatttgca ttatgccttc tcatggaaca     12300
     gtattctcta gagaattcat tacagtgctt cactaaggat agagatttct ttgtgcaccc     12360
     ccatccactt ctgctatacc agtacattat catgtacata ataggcactc atgaactttt     12420
     tgttcaacaa atgcatacat atcagatcaa tttgcttgaa aaatgcaaaa taatttttac     12480
     atacattgaa ggttttatca ttttaataga aattgttcaa gcatattaag gaacaagagt     12540
     tagcatttga ataattgccc ataataaaaa attcttattt gcttttgaca tttctgaatt     12600
     tgctttccat tttaagacta tcagggttct taatatatat ttatggaggt tacatggatt     12660
     agtgtgaccc aagagaatga tggtagtcaa catttcaaag ttaataaaga ccgcttgtga     12720
     caatagggca gggattatat ttttcatata taaaagaaaa aaatctgtca tttagtaagg     12780
     ttgatctatt tgtctaagat tatgcagctt tgaaattgca gagtcagaat ttgaatacag     12840
     aaattctaac atcaaaatgc aaggtccagg ttacggttga attattgatt tataagtaac     12900
     atttgctgat aattactttg aacaacacag agtaaaaaat ctttagagat ccccttggag     12960
     ttgtcttact atagagcata atcttaaagc aatttagttc agcaaacatt tattctgcaa     13020
     acatatattc agactctagt gtttacaagg caccttgaga gaaactgtgg aagatatttg     13080
     acaaacaaaa taaggtccct atctttaaag aacttgcaat cttattgttg actactctga     13140
     ttgtattggg cacaaagcga ttgcctatat aatctttgac aaggtctaac attattgtgc     13200
     agatatcatt tcagcagata gtgaagtgtt tacttttgtg tttcttgaca ggccttgtat     13260
     gaagcaggag aaaggagaaa ggggacagac gtaaacgtgt tcaataccat ccttaccacc     13320
     agaagctatc cacaacttcg cagaggtaac aataaatttc tttttctgga atctgtttat     13380
     ggaagatgca attttctttt ttgatgacaa ataagagaaa gtaaaaacag aacccttttt     13440
     caatatcact cctgtatcaa acagatacag tgttcctgac ccattgttat ttgtcaattt     13500
     gtccaatttt gtacagccgc tactttatca tatttaatac attttgtgac ttgggcatgt     13560
     ggaacataat tttgttattt tcactgcttt tactccccta aaagatttgg aatatgtgtg     13620
     ggaaaagaca tgcataacag aacaaatgaa attagaatga agaaaaacaa aaaaaaaaaa     13680
     acaaaaaacc ctcagagcta aatgaagaaa gaaatatgta ggtgctttgg aaaaacaaca     13740
     acaagacaaa actcagaaaa agtcctggcc tttgagtgca agatttagct ctgggcctct     13800
     tggaagtgaa ggcgatggaa aagttatgac aattaccaaa gttcaccatc ttataatagt     13860
     atactgattt ctactgttaa atgtaagaga aatttagtgc acaggtcttt atataaggga     13920
     agatccattt gctgtggctc ttagaactgc tgtaggaagt gctatagttg tcaatcacat     13980
     gccgtttcta ataactgtca acatttgcaa acatttcgcc aaaatatata ggaataccaa     14040
     aatggccagg taagttacat tcctaggaga ggatgaagta ttcacgttat gattaattgg     14100
     gtatattgct ttaaaaggtg tagccaaagt tgttattcta aaaaattctt tgagtcagtt     14160
     gccttgattt tgctaaagct ttctaaagaa aaggatgttt tgcatgtatc ttagtttgaa     14220
     tttaatattc agtgtttcag aaatacacca agtacagtaa gcatgacatg aacaaagttc     14280
     tggacctgga gttgaaaggt gacattgaga aatgcctcac agctatcggt atgtagtcca     14340
     gcagttgaaa gagttttcta actagaaatt gtattttcaa agctatccta tacttaacaa     14400
     gaacaacagc aacaaaacca ataaaagaaa acaaaaaaca atcagaagta gtgcatctgt     14460
     ttcaattgaa gcaacgtaaa agattggcaa agtactataa ccttaataac aatagatatt     14520
     attccccttt tcaaaaatag agagagatag actatactta ttgagcacct acttatatca     14580
     aacaatgtac caggctgggc acaccacaga ggcaattcag aatggtcact gagagcatgg     14640
     gatctggaat aaatgtaaca tctggataaa tgtaacttca agtcctggtc tactgcttgt     14700
     taattgtaca atcttgggca ggtccaggag agtctgattc agtgggtccg agttggcctc     14760
     taaaaatcgg tactttttaa agatctccca ggttattcag acaaccatca gggttgggga     14820
     acctatgttc tcaagcagtg tttctcattc atgactatgc acttgaatcc cctggaaagc     14880
     ttgttaaaat gcagattctg attccccagg tctggggtgg agcttagatt ctgcttttct     14940
     aacaagctcc ccattgatgc caatgctgtt ggtccataga tctcgacaag atgaagaaca     15000
     ctatgaactg gaatgtgcta gtattatttg ggttctgttt tatatttaag cccatcctat     15060
     cccagagttt tttcttcatt tattcattta tttttactta tttgtttgtg caactcttac     15120
     tttagacaca gaggtacatg tgcacgtttg ttccatgggt gttctgcact caggcagtga     15180
     gcatagtacc caataagtag ttttttgacc aatgcccctt ctctccctgc cctctctagt     15240
     agtctgcagt gtctgttgtt catagggtgt tctttttaaa tgttcttata gtaacataaa     15300
     taaagtattt acataggctt gaacacctag tggcttctcc actcccaagg agaatatatg     15360
     ttggatagcg caaactactg aagttgctct tgagatgtat ttaaggtaat aaaaaaattg     15420
     atcgtcaggg aaaagaatat tcaaaaccac catctagaga gtcacaaata ccttctcaga     15480
     agttaactgc cctatattgg gagatgagag gtgaagaatg atgatgaggg atagaacact     15540
     gttggcaaaa ttctatattt cctgtttctt tcatatggat atttcatttt tttcatggta     15600
     aatacatcaa ctaaaatttt cttctctaac agtgaagtgc gccacaagca aaccagcttt     15660
     ctttgcagag aagcttcatc aagccatgaa agtatgtacc attctactta tatgtcctgc     15720
     ttagaggaag aattatttgt agaaagaaca gaaaacctca tgttgtttga aaatctcaca     15780
     tttaatatct tcccattaat gagaatcatt gttctatttg atgaaagagg taatacacta     15840
     ccttctcaga ataaacttct gttagattcg gtgctttttt ttacagatga gattgtaaag     15900
     tgagcctgta agtgatttac ggctcacttg tgatttgctt aaaacatgtg tcaccacggg     15960
     aagggtgatg tactttcttt tttaacgtgt aattttagtg gcctacttcc tctaaggttg     16020
     tgagttttat aatctcccac tttatgagtc tgatttgttg tttttattat tctgtctttt     16080
     atgccacaga ttaatagttg aaacttttga aatgtcattc tatgattaag gatgtagaat     16140
     gatgtatttg agatcaacta tgtcacttta actttactgt ctgacatgca tggtattata     16200
     caaggtacct cttctattct gacattttga gcccacaaat gaatagttat gaagttatct     16260
     tccttttttc tttgcagctc caaaataagg aggttttcag agagagagag aaagaaagat     16320
     ctaactattt gaataatatg aaggaatatt ttgaatatat atgaataatt tgaataatat     16380
     gaaatgatag acatgctagg tactgctctg tagtggttag catagttgct gccccctttc     16440
     tgccatagtc tagtgtgata tttcgttggg taatgatgaa tacctggtgc catggaagag     16500
     aaaagtggga catatactcc agactttgga aatccaggta gcattgctgt cagctaaatt     16560
     aacacctgaa gtttaaatag aaatgagcca gatgagggca agagtggaag agatggggat     16620
     aaagcaaggg tggtccaaga ggaagaagta acccacacac aggcttgaag gcaaaaggta     16680
     acataacctt ctcaagacag taagtataga gtgatggtgc acactggaag agatggtaga     16740
     attaggcagg atattgtaag ccttgaaaaa gaattaggca ggatatcgga agccctgatt     16800
     agattctatc ctaagagcaa cagaagatca ctgacagtgt tttaaataga tagactagtt     16860
     tattagattt gcagtttaga agttcccttt ttttgtaatt attggacagt gtagagaccg     16920
     gatggtgaga gatgagttag gaagttgtga cagctctcta tacctaccgc taatgtagag     16980
     gattatttat tttcatttca ttaccattcg tgtaaggtgt gtgtgtgtgt gtgtgtgtgt     17040
     gtgtgtgtat agctagtttc tctatagaaa ttatatggaa gagtaagaag gcttcacttt     17100
     aaaattcatg tttttaatga gagtattttc tgaatatgag acacttaccc tcatttattt     17160
     tggccagggt gttggaactc gccataaggc attgatcagg attatggttt cccgttctga     17220
     aattgacatg aatgatatca aagcattcta tcagaagatg tatggtatct ccctttgcca     17280
     agccatcctg gtatgttttg attcctctaa tgccatccca acaaatgaaa gttctttttg     17340
     caagatcttc aaggagaaga gttgacttat tgtatctata aatttaatat gtaagattaa     17400
     tttaatatat tatggtgtat acttcatgag taaattgaac tttcactggt aaaatctact     17460
     agtgagttct ctactgaaat actgggtaca tttttcaact aaagtcatgg aaacatttag     17520
     tttcccatgc ataaattcag caagcagaat attctagtgt tccccctagg gtagatagac     17580
     attgtggttt attttgccat taatatttgt cagaggatta gaaactcctt attcaaaata     17640
     tttatcttaa ttctatcaca tgtaaaatgt ttaaaattta tgttcaaatt gtctcataag     17700
     aatgttaaaa aataagacaa agaacagtca agggttttgg acttactgaa aggtagataa     17760
     cgattcaaat ttaattaatt agtcatattg gataactaaa atctacccag aaaatgtgag     17820
     aaaattacag gcactataca tttctcttct tctggtgagt gaatcaggta tctcctcaca     17880
     taagatatga gattatattg tgttatactt atttaatttt gtgtgatatt tcattcatag     17940
     aaaataatgg cactaatata aaacataatt aattcagaaa agtttgtaat ctcagtcttg     18000
     aaggctattg cttttttatg caatgataaa aaatcagtta tctgttgtat atattgttta     18060
     attaagtgaa tggtaatgtg taatctcatc tacagctaag tctaaaaata attcttctat     18120
     aagtaaaaaa aaatagagaa ttatggtttc gactaacatt aagtatacct ttttttgaat     18180
     caacaggatg aaaccaaagg agattatgag aaaatcctgg tggctctttg tggaggaaac     18240
     taaacattcc cttgatggtc tcaagctatg atcagaagac tttaattata tattttcatc     18300
     ctataagctt aaataggaaa gtttcttcaa caggattaca gtgtagctac ctacatgctg     18360
     aaaaatatag cctttaaatc atttttatat tataactctg tataatagag ataagtccat     18420
     tttttaaaaa tgttttcccc aaaccataaa accctataca agttgttcta gtaacaatac     18480
     atgagaaaga tgtctatgta gctgaaaata aaatgacgtc acaagacaat tggtgtgtca     18540
     ttgactcttc tattttgatt ttcttttctg tgtaattcag tggtttaatt tgacattaag     18600
     ggatacaagc ctgaattcta gattataatt atttaatgaa atagagttca cattctgaat     18660
     tgaagaaaat acttatagct tttgaaaagg gatactacat tttatcgtat gtgtacagac     18720
     tattgagatt gtgtctctgt ataataaatt tattgcacta gcattataac aatttgatat     18780
     attctatatt tcattaacta gtataaagat gaaatggca                            18819