
ID   GQ868647; SV 1; linear; mRNA; STD; MUS; 749 BP.
AC   GQ868647;
DT   12-OCT-2009 (Rel. 102, Created)
DT   12-OCT-2009 (Rel. 102, Last updated, Version 1)
DE   Mus musculus strain SAMP1/YitFcs peroxisome proliferator activator receptor
DE   gamma mRNA, partial cds, alternatively spliced.
KW   .
OS   Mus musculus (house mouse)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae;
OC   Murinae; Mus; Mus.
RN   [1]
RP   1-749
RA   Spencer H.E., Kovach T.K., Hamilton J.B., Kazuhiko S., McDuffie M.;
RT   "Susceptibility to Crohn's disease associated with alternative transcripts
RT   of Pparg";
RL   Unpublished.
RN   [2]
RP   1-749
RA   McDuffie M., Spencer H.E., McDuffie M.;
RT   ;
RL   Submitted (03-SEP-2009) to the INSDC.
RL   Microbiolgy, University of Virginia, 450 Ray C. Hunt Drive Box 801390,
RL   Charlottesville, VA 22908, USA
DR   MD5; fe3c58fc4c5d70ac52962c3ec9ff5923.
FH   Key             Location/Qualifiers
FT   source          1..749
FT                   /organism="Mus musculus"
FT                   /chromosome="6"
FT                   /map="Pparg"
FT                   /strain="SAMP1/YitFcs"
FT                   /mol_type="mRNA"
FT                   /PCR_primers="fwd_seq: gatggaagaccactcgcatt, rev_seq:
FT                   gaaactggcacccttgaaaa"
FT                   /db_xref="taxon:10090"
FT   CDS             <1..>749
FT                   /codon_start=2
FT                   /product="peroxisome proliferator activator receptor gamma"
FT                   /note="nuclear receptor family member; Pparg; conventional
FT                   transcript; alternatively spliced"
FT                   /db_xref="GOA:D0EPX6"
FT                   /db_xref="InterPro:IPR000536"
FT                   /db_xref="InterPro:IPR001628"
FT                   /db_xref="InterPro:IPR003074"
FT                   /db_xref="InterPro:IPR003077"
FT                   /db_xref="InterPro:IPR013088"
FT                   /db_xref="InterPro:IPR022590"
FT                   /db_xref="MGI:MGI:97747"
FT                   /db_xref="UniProtKB/TrEMBL:D0EPX6"
FT                   /protein_id="ACX47078.1"
FT   misc_feature    116..421
FT                   /note="Region: DNA-binding domain"
FT   misc_feature    422..748
FT                   /note="Region: ligand-binding domain"
SQ   Sequence 749 BP; 221 A; 177 C; 171 G; 180 T; 0 other;
     cacagttgat ttctccagca tttctgctcc acactatgaa gacattccat tcacaagagc        60
     tgacccaatg gttgctgatt acaaatatga cctgaagctc caagaatacc aaagtgcgat       120
     caaagtagaa cctgcatctc caccttatta ttctgaaaag acccagctct acaacaggcc       180
     tcatgaagaa ccttctaact ccctcatggc cattgagtgc cgagtctgtg gggataaagc       240
     atcaggcttc cactatggag ttcatgcttg tgaaggatgc aagggttttt tccgaagaac       300
     catccgattg aagcttattt atgataggtg tgatcttaac tgccggatcc acaaaaaaag       360
     tagaaataaa tgtcagtact gtcggtttca gaagtgcctt gctgtgggga tgtctcacaa       420
     tgccatcagg tttgggcgga tgccacaggc cgagaaggag aagctgttgg cggagatctc       480
     cagtgatatc gaccagctga acccagagtc tgctgatctg cgagccctgg caaagcattt       540
     gtatgactca tacataaagt ccttcccgct gaccaaagcc aaggcgaggg cgatcttgac       600
     aggaaagaca acggacaaat caccatttgt catctacgac atgaattcct taatgatggg       660
     agaagataaa atcaagttca aacatatcac ccccctgcag gagcagagca aagaggtggc       720
     catccgaatt tttcaagggt gccagtttc                                         749