
ID   FQ790388; SV 1; linear; genomic DNA; STD; MUS; 544 BP.
AC   FQ790388;
DT   12-APR-2011 (Rel. 108, Created)
DT   24-JAN-2013 (Rel. 115, Last updated, Version 3)
DE   Mouse DNA sequence from PCR product PCR_C57BL6J_AC102125_1 on chromosome 6
OS   Mus musculus (house mouse)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae;
OC   Murinae; Mus; Mus.
RN   [1]
RP   1-544
RG   Genome Reference Consortium
RA   Griffiths G.;
RT   ;
RL   Submitted (22-JAN-2013) to the INSDC.
RL   Wellcome Trust Sanger Institute, Hinxton, Cambridgeshire, CB10 1SA, UK.
RL   E-mail enquiries: grc-help@sanger.ac.uk Clone requests: Geneservice
RL   (http://www.geneservice.co.uk/) and BACPAC Resources
RL   (http://bacpac.chori.org/)
DR   MD5; 42d6e4cb483de1fd71de86347c6177b1.
DR   ENA-CON; GL456133.
DR   Ensembl-Gn; ENSMUSG00000063975; mus_musculus.
DR   Ensembl-Gn; MGP_129S1SvImJ_G0031459; mus_musculus_129s1svimj.
DR   Ensembl-Gn; MGP_AJ_G0031434; mus_musculus_aj.
DR   Ensembl-Gn; MGP_BALBcJ_G0031441; mus_musculus_balbcj.
DR   Ensembl-Gn; MGP_C3HHeJ_G0031163; mus_musculus_c3hhej.
DR   Ensembl-Gn; MGP_C57BL6NJ_G0031903; mus_musculus_c57bl6nj.
DR   Ensembl-Gn; MGP_CASTEiJ_G0030531; mus_musculus_casteij.
DR   Ensembl-Gn; MGP_CBAJ_G0031123; mus_musculus_cbaj.
DR   Ensembl-Gn; MGP_DBA2J_G0031280; mus_musculus_dba2j.
DR   Ensembl-Gn; MGP_FVBNJ_G0031231; mus_musculus_fvbnj.
DR   Ensembl-Gn; MGP_NODShiLtJ_G0031271; mus_musculus_nodshiltj.
DR   Ensembl-Gn; MGP_NZOHlLtJ_G0031935; mus_musculus_nzohlltj.
DR   Ensembl-Gn; MGP_PWKPhJ_G0030258; mus_musculus_pwkphj.
DR   Ensembl-Gn; MGP_WSBEiJ_G0030624; mus_musculus_wsbeij.
DR   Ensembl-Scaffolds; FQ790388.1:1-544; mus_musculus.
DR   Ensembl-Tr; ENSMUST00000081380; mus_musculus.
DR   Ensembl-Tr; ENSMUST00000111825; mus_musculus.
DR   Ensembl-Tr; ENSMUST00000128446; mus_musculus.
DR   Ensembl-Tr; ENSMUST00000153268; mus_musculus.
DR   Ensembl-Tr; MGP_129S1SvImJ_T0080830; mus_musculus_129s1svimj.
DR   Ensembl-Tr; MGP_AJ_T0080914; mus_musculus_aj.
DR   Ensembl-Tr; MGP_BALBcJ_T0080853; mus_musculus_balbcj.
DR   Ensembl-Tr; MGP_C3HHeJ_T0080468; mus_musculus_c3hhej.
DR   Ensembl-Tr; MGP_C57BL6NJ_T0081329; mus_musculus_c57bl6nj.
DR   Ensembl-Tr; MGP_CASTEiJ_T0081022; mus_musculus_casteij.
DR   Ensembl-Tr; MGP_CBAJ_T0080414; mus_musculus_cbaj.
DR   Ensembl-Tr; MGP_DBA2J_T0080574; mus_musculus_dba2j.
DR   Ensembl-Tr; MGP_FVBNJ_T0080456; mus_musculus_fvbnj.
DR   Ensembl-Tr; MGP_NODShiLtJ_T0080476; mus_musculus_nodshiltj.
DR   Ensembl-Tr; MGP_NZOHlLtJ_T0081599; mus_musculus_nzohlltj.
DR   Ensembl-Tr; MGP_PWKPhJ_T0080466; mus_musculus_pwkphj.
DR   Ensembl-Tr; MGP_WSBEiJ_T0079550; mus_musculus_wsbeij.
DR   GOA; E0CX25.
DR   GOA; E0CX90.
DR   InterPro; IPR002350; Kazal_dom.
DR   InterPro; IPR004156; OA_transporter.
DR   InterPro; IPR020846; MFS_dom.
DR   MGI; MGI:1351865; Slco1a5.
DR   UniProtKB/TrEMBL; E0CX25; E0CX25_MOUSE.
DR   UniProtKB/TrEMBL; E0CX90; E0CX90_MOUSE.
CC   -------------- Genome Center
CC   Center: Wellcome Trust Sanger Institute
CC   Center code: SC
CC   Web site: http://www.sanger.ac.uk
CC   Contact: grc-help@sanger.ac.uk
CC   --------------
CC   This PCR was performed to audit a questionable region in the reference
CC   genome sequence.
CC   Sequence from the Mouse Genome Sequencing Consortium whole genome shotgun
CC   may have been used to confirm this sequence. Sequence data from the whole
CC   genome shotgun alone has only been used where it has a phred quality of at
CC   least 30.
FH   Key             Location/Qualifiers
FT   source          1..544
FT                   /organism="Mus musculus"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /clone="PCR_C57BL6J_AC102125_1"
FT                   /PCR_primers="fwd_seq: aggtgagtgttctttctctg, rev_seq:
FT                   aagttttgagctaggacagc"
FT                   /db_xref="taxon:10090"
SQ   Sequence 544 BP; 132 A; 107 C; 109 G; 196 T; 0 other;
     agtgttcttt ctctgagtca tatcattgac ccaacactct ctaatttgat ccaactggct        60
     atgtagacaa tactgaagat tcatactaat acatttcttc tctaataagg tacttttttt       120
     tgacaggtgt ttcaaaattg cagctgcatt cagtcatcag gaaactcatc tgcagtcctg       180
     gggctgtgta aaaaaggccc tgagtgtgct aacaagctgc agtacttttt aatcatgtcg       240
     gtaattggca gtttcatcta ttcgatcaca gccatacctg ggtacatggt tcttctgagg       300
     taataagtaa ctctttcatt tagcctctct ctgtccttct ttgtagcatg ttcatatgca       360
     agtgtgtgat gtgacatgtg tgtgtgtgtg tgtgcatgcg catgtttatg agtgtttgta       420
     taaaagtgac ttttattcac cagatataat tgtttacctg aaggcttact actgaataac       480
     ctcctgcttt ctggttgttt gtaaactctg gctggctgga tcagttcagc tgtcctagct       540
     caaa                                                                    544