
EBI Dbfetch

ID   EU588391; SV 1; linear; genomic DNA; STD; HUM; 270 BP.
AC   EU588391;
DT   20-APR-2008 (Rel. 95, Created)
DT   13-JAN-2009 (Rel. 99, Last updated, Version 2)
DE   Homo sapiens MHC class II antigen (HLA-DRB1) gene, HLA-DRB1*14new allele,
DE   exon 2 and partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-270
RX   DOI; 10.1111/j.1399-0039.2008.01175.x.
RX   PUBMED; 19140840.
RA   Han S.H., Jung S.M., Park S.R., Chung S.Y., Han H.;
RT   "Identification of a new HLA-DRB1*14 variant, HLA-DRB1*1478, in a Korean
RT   individual";
RL   Tissue Antigens 73(1):81-83(2009).
RN   [2]
RP   1-270
RA   Jung S., Han S., Han H.;
RT   ;
RL   Submitted (24-MAR-2008) to the INSDC.
RL   Immunogenetics Lab., Histostem, 518-4, Dunchon-dond, Kangdong-gu, Seoul
RL   134-0160, Korea
DR   MD5; 92be22e3fbc168002294dc54322e28fb.
DR   Ensembl-Gn; ENSG00000196126; homo_sapiens.
DR   Ensembl-Gn; ENSG00000206240; homo_sapiens.
DR   Ensembl-Gn; ENSG00000206306; homo_sapiens.
DR   Ensembl-Gn; ENSG00000228080; homo_sapiens.
DR   Ensembl-Tr; ENST00000328980; homo_sapiens.
DR   Ensembl-Tr; ENST00000360004; homo_sapiens.
DR   Ensembl-Tr; ENST00000399450; homo_sapiens.
DR   Ensembl-Tr; ENST00000412634; homo_sapiens.
DR   Ensembl-Tr; ENST00000415796; homo_sapiens.
DR   Ensembl-Tr; ENST00000419393; homo_sapiens.
DR   Ensembl-Tr; ENST00000428566; homo_sapiens.
FH   Key             Location/Qualifiers
FT   source          1..270
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: I1-RB9, fwd_seq: tggtgggcgttggggcg,
FT                   rev_name: I2-RB28, rev_seq: acacacacactcagattccca"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>270
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*14new"
FT   mRNA            <1..>270
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*14new"
FT                   /product="MHC class II antigen"
FT   CDS             <1..>270
FT                   /codon_start=3
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*14new"
FT                   /product="MHC class II antigen"
FT                   /db_xref="GOA:Q9GIY3"
FT                   /db_xref="HGNC:HGNC:4948"
FT                   /db_xref="IMGT/HLA:DRB1*14:78"
FT                   /db_xref="InterPro:IPR000353"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9GIY3"
FT                   /protein_id="ACB97664.1"
FT   exon            1..270
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*14new"
FT                   /number=2
FT   variation       244..245
FT                   /gene="HLA-DRB1"
FT                   /replace="gt"
FT                   /note="results in valine to glycine substitution as
FT                   compared to HLA-DRB1*1463"
SQ   Sequence 270 BP; 59 A; 65 C; 97 G; 49 T; 0 other;
     cacgtttctt ggagtactct acgtctgagt gtcatttctt caatgggacg gagcgggtgc        60
     ggttcctgga gagatacttc cataaccagg aggagaacgt gcgcttcgac agcgacgtgg       120
     gggagtaccg ggcggtgacg gagctggggc ggcctagcgc cgagtactgg aacagccaga       180
     aggacatcct ggaagacagg cgggccctgg tggacaccta ctgcagacac aactacgggg       240
     ttgtggagag cttcacagtg cagcggcgag                                        270
