
ID   AB451492; SV 1; linear; mRNA; STD; HUM; 474 BP.
AC   AB451492;
DT   02-SEP-2008 (Rel. 97, Created)
DT   02-SEP-2008 (Rel. 97, Last updated, Version 1)
DE   Homo sapiens TNF mRNA for tumor necrosis factor alpha, partial cds, clone:
DE   FLJ80001DABN.
KW   Gateway cloning system.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-474
RA   Kawamura Y., Nomura N., Goshima N.;
RT   ;
RL   Submitted (31-JUL-2008) to the INSDC.
RL   Contact:Naoki Goshima Biomedicinal Information Research Center (BIRC),
RL   National Institute of Advanced Industrial Science and Technology (AIST);
RL   2-42 Aomi, Koto-ku, Tokyo 135-0064, Japan
RN   [2]
RA   Goshima N., Kawamura Y., Fukumoto A., Miura A., Honma R., Satoh R.,
RA   Wakamatsu A., Yamamoto J.-I., Kimura K., Nishikawa T., Andoh T., Iida Y.,
RA   Ishikawa K., Ito E., Kagawa N., Kaminaga C., Kanehori K., Kawakami B.,
RA   Kenmochi K.-I., Kimura R., Kobayashi M., Kuroita T., Kuwayama H.,
RA   Maruyama Y., Matsuo K., Minami K., Mitsubori M., Mori M., Morishita R.,
RA   Murase A., Nishikawa A., Nishikawa S., Okamoto T., Sakagami N.,
RA   Sakamoto Y., Sasaki Y., Seki T., Sono S., Sugiyama A., Sumiya T.,
RA   Takayama T., Takayama Y., Takeda H., Togashi T., Yahata K., Yamada H.,
RA   Yanagisawa Y., Endo Y., Imamoto F., Kisu Y., Tanaka S., Isogai T.,
RA   Imai J.-I., Watanabe S., Nomura N.;
RT   "Human Protein Factory: an infrastructure to convert the human
RT   transcriptome into the in vitro-expressed human proteome of versatile
RT   utility";
RL   Unpublished.
DR   MD5; 1e99b6785fcb4c281a7e98024b4922c5.
DR   EuropePMC; PMC3602058; 23527290.
DR   H-InvDB; HIT000487705_02.4.
DR   H-InvDB; HIT000487705_03.4.
DR   H-InvDB; HIT000487705_04.4.
DR   H-InvDB; HIT000487705_05.4.
DR   H-InvDB; HIT000487705_06.4.
DR   H-InvDB; HIT000487705_07.4.
DR   H-InvDB; HIT000487705_08.4.
CC   This human Gateway entry clone was constructed by recombining an
CC   attB-attached open reading frame (ORF) fragment with attP
CC   sequences of the Gateway donor vector pDONR201. The ORF sequence
CC   in the entry clone is flanked with attL1 sequence (100 nt) -
CC   spacer nucleotides (TC) - Shine-Dalgano sequence (GAAGGAGATA) -
CC   spacer nucleotides (GA) - Kozak sequence (ACC) - translational
CC   upstream of the coding sequence of the mature form and is also
CC   flanked with a spacer nucleotide (G) - attL2 sequence (99 nt)
CC   downstream of the ORF. This is an N-type clone which has an
CC   intrinsic stop codon at the end of ORF. DNA sequences of the
CC   entire ORF and flanking regions were validated by sequencing.
CC   Clone structure of the ORF and flanking sequences is as follows:
CC   5'-caaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgct
CC   tttttataatgccaactttgtacaaaaaagcaggct TC GAAGGAGATA GA ACC ATG
CC   acccagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaaca
CC   ggtcactatcagtcaaaataaaatcatt attg-3' (5'ORF3'; the coding sequence
CC   of the mature form. attL sequences are described in lower cases).
CC   Clone information: http://www.HGPD.jp/
CC   This clone was produced in the "Functional Analysis of Protein and
CC   Research Application" project supported by the New Energy and
CC   Industrial Technology Development Organization (NEDO), Japan
FH   Key             Location/Qualifiers
FT   source          1..474
FT                   /organism="Homo sapiens"
FT                   /mol_type="mRNA"
FT                   /clone="FLJ80001DABN"
FT                   /note="Vector: pDONR201"
FT                   /db_xref="taxon:9606"
FT   CDS             <1..474
FT                   /codon_start=1
FT                   /transl_table=1
FT                   /gene="TNF"
FT                   /product="tumor necrosis factor alpha"
FT                   /db_xref="GOA:B5BUQ6"
FT                   /db_xref="H-InvDB:HIT000487705_01.4"
FT                   /db_xref="InterPro:IPR002959"
FT                   /db_xref="InterPro:IPR006052"
FT                   /db_xref="InterPro:IPR006053"
FT                   /db_xref="InterPro:IPR008983"
FT                   /db_xref="InterPro:IPR021184"
FT                   /db_xref="UniProtKB/TrEMBL:B5BUQ6"
FT                   /protein_id="BAG70306.1"
SQ   Sequence 474 BP; 98 A; 157 C; 127 G; 92 T; 0 other;
     gtcagatcat cttctcgaac cccgagtgac aagcctgtag cccatgttgt agcaaaccct        60
     caagctgagg ggcagctcca gtggctgaac cgccgggcca atgccctcct ggccaatggc       120
     gtggagctga gagataacca gctggtggtg ccatcagagg gcctgtacct catctactcc       180
     caggtcctct tcaagggcca aggctgcccc tccacccatg tgctcctcac ccacaccatc       240
     agccgcatcg ccgtctccta ccagaccaag gtcaacctcc tctctgccat caagagcccc       300
     tgccagaggg agaccccaga gggggctgag gccaagccct ggtatgagcc catctatctg       360
     ggaggggtct tccagctgga gaagggtgac cgactcagcg ctgagatcaa tcggcccgac       420
     tatctcgact ttgccgagtc tgggcaggtc tactttggga tcattgccct gtaa             474