spacer

EBI Dbfetch

>gi|341926165|ref|NM_001243167.1| Mus musculus predicted gene 13288 (Gm13288), mRNA
TCCCTGCTCAGCAGAGCTCCTGAGAGGAGAGGGGCAAGACCATACTGTCTGTCCTCTCTCTGGAACTGTC
TGCCTGTTGGGGCCCAGCTCTCCTCTCTGCCAACTCCACTTCCTTCTTCTCCACTCGCGTTAGAGAGCTG
GAAGGGTCTGGCGGGCCACCCAAACGCACCAAGATGCGAACCAAACAAACGAAAGGAAACCGAACCAAAG
GAGACCAAACCAAACCCAGCCCAGCCAAACCAAAACGCTGCTCTCTGGGCTTTGGAGCCTTCCCGGTTCC
CCGAAAACATGTCCCCTGGCCCACCAATTCCGTCTGGGTTCAATTCTCAAGGCGCGATGGATGGCGTACA
GTCCTGTACGCGAAGGGGCCCGGGAGAGAGGCAGGAGACACTCCCTGCCTGCCCGGAGTCGCGCGCTGAG
CGGGGCGAACGGCCTCCGCAGGCGCCCGCTGCTGCCCTCCGGTGGCCCGCGCCCTCTGCTGCTGCTCCTG
GCCTCAGAAGTCGCGTCCAGCGTCCAGCGCAGCGCAGGCAGTCAGCGAGCAAGAGCCCGAAGCTCCGAGT
GAACTATTAAAGCAGCAAACTCCAGGCTCAATGGGAAGGCGGCCTTGCCCTCGCGCTCCCCCTGCAGGCC
AGCCCCGCAATCGTCAGGCTTCAGCATGCTGCCTGTGCATCTATTCCTGGTGGGAGGGGTGATGCTGAGC
TGCAGCCCAGCCAGCTCACTTGATTCTGGTAAATCTGGGAGCCTGCACCTGGAGCGCAGCGAAACCGCGC
GCTTCCTAGCAGAGCTCCGAAGCGTGCCGGGTCACCAGTGCCTGCGGGACAGGACCGATTTCCCATGTCC
CTGGAAGGAAGGAACTAACATCACACCGATGACTCTGGGAGAAACCACCAGTTGCTACTCCCAGACCCTC
AAGCAGGTCCTCCACCTCTTTGACACAGAGGCCAGCAGAGCTGCCTGGCACGAGAGGGCGCTGGACCAGC
TACTATCTAGCCTGTGGCGTGAGCTGCAAGTGCTGAAGAGGCCAAGAGAGCAGGGCCAGTCCTGTCCACT
GCCTTTTGCCCTGGCCATCCGCACCTACTTCCGAGGGTTCTTCCGCTATCTGAAGGCAAAGGCACACAGC
GCTTGCTCCTGGGAGATCGTCAGAGTCCAATTGCAAGTGGACCTTCCAGCGTTCCCACTGTCTGCGAGAA
GAGGCCCAAGATGAGGAGAAGCCCCGTGCAGGAATCTCTCTGCTCTCGTGACACCACGCTCCCTCTCTCC
ATTCAAAGCAGACACACGGATTCGGATTCAGCACCAACAGGCGAAATGGGCGTGCATCGACCAAGAACAT
CGAGTTCTTTATGTCTTCCCTGCCAGAGGCCCCGAAGCATCCTACTGTACATCATACACTGCGAAAGATG
TTTGAAAGAAAACCTGTGCTCTTGCATTTGAGGTGGCTTCTGAATAAATTGATGATCTCGGTTTTCCTTG
GGAGGTTTCGATCACAGATGGGGGATGCCCATGGGCCACGGGGGTTGGAAAACGTGCCTTGTTGCAGCAA
GGCTCTCTTGGGCTGTTCGGTGTTAGAACCATTCTCTCTCCTGTCATGGGCTTCTGGTTAGCTTCTTGTA
ACCTGGGAACTCCTTAATCTCAGACTTTGCCCGGTCTCAGGTTTTCTGTTTGTTTGTTTGTGTGTGTGTG
TGTTTTTTGAAAATCTCCCTTGGAAGGAAGTTACTCCAGAGGTTGATGAACCTCTTTGCTTGATCTTTGC
ATCTTGAAAAGAGAAAATTCTCCTTAAAAAAAAAGCTATATTCTCCTTTCGTTGAAGACAGCTTTATGTG
CACAAAATTCTCAAAAGTCTCCTTTGATGCCAGTCTTTTTAGAGGGTAGGAGGTGGACCTGAAATATTAA
ACCCTCTGGCTCTATAGGCCTCAGGTTGGGAGAGAGGAATTTCCCATCTCATGTTTCATCAAGATGGAAG
CCTTTTGTCCTAGGTTCCATACAAGCTGCTAACTATAGTGTTTGTTTCAAAAGTTCCTTCTCTCTAAAAG
TCCCTTCTTTTTTACGTATTATCAGCAGAGCGTCCTACCCCTTTGGAGAAGTGATTAGCATGCATCAATA
TCAATCTCACTGGGCCCTTAGAGAGAACACAGACGTAGGTAAAGCATCATGAGAGATTATTAGGATAGCC
CACTGACACCTGGAGACTGTGTAGCACCCACAAGCACCAAGGAGATCTGCAGCACGTTGGAACTGAGGAG
TTAGTGTGGCTTCTGAGGAGGATGGGAGTTTTCACTTCAGTTGGGACCAGCCTGGTCTCTGCCTGTGGTC
AGAGAACAACTTGTTCTAGCCCTGTTACTTGATCAGGACTAGGGTTTACATAGGGAAGGACTTTGTCTCT
AGACTTCTCTCCTCTCCACCCTTGTAAATGGTCTAGTGAAGGCTCAGGGTGACATAGATGCATTCTAAAT
TGAACTTCATTTTGGCTGATGCCTTAAATTATGAAAATTGTCCATCTTTATGTAGTACTGTGTGATAATT
CATACATGCGCACACACTGTCAAGTTTTATACACTTTAAACATGGATCTCCTCAAACACTATTTTCTTTT
TGTAGATAAAACACTGAAAACCCTTTCTCACAATTTTAAAGCTGACTATGGCATCGTGAACGTCTTTTTG
TAATCAACATGCAGCAACACCCATGATCCTCCTTCCTGAGAGGATCTCAGCCCCTAGAAACCATTTTGGA
GGACTTGGTAGTGGTGTAAGCTTGGCTGACCGTGTGATTACATAAAATCTTCCCATTTGACCACTTCTAT
TTTTGTCGTTGCTTGTATCATCAACATTTTTCAATATAAATAATTATACC



spacer
spacer