Dbfetch

>XM_001000025.2 PREDICTED: Mus musculus predicted gene 13288 (Gm13288), mRNA
ATGCTGCCTGTGCATCTATTCCTGGTGGGAGGGGTGATGCTGAGCTGCAGCCCAGCCAGCTCACTTGATT
CTGGTAAATCTGGGAGCCTGCACCTGGAGCGCAGCGAAACCGCGCGCTTCCTAGCAGAGCTCCGAAGCGT
GCCGGGTCACCAGTGCCTGCGGGACAGGACCGATTTCCCATGTCCCTGGAAGGAAGGAACTAACATCACA
CCGATGACTCTGGGAGAAACCACCAGTTGCTACTCCCAGACCCTCAAGCAGGTCCTCCACCTCTTTGACA
CAGAGGCCAGCAGAGCTGCCTGGCACGAGAGGGCGCTGGACCAGCTACTATCTAGCCTGTGGCGTGAGCT
GCAAGTGCTGAAGAGGCCAAGAGAGCAGGGCCAGTCCTGTCCACTGCCTTTTGCCCTGGCCATCCGCACC
TACTTCCGAGGGTTCTTCCGCTATCTGAAGGCAAAGGCACACAGCGCTTGCTCCTGGGAGATCGTCAGAG
TCCAATTGCAAGTGGACCTTCCAGCGTTCCCACTGTCTGCGAGAAGAGGCCCAAGATGA