spacer

EBI Dbfetch

>gi|402294977|ref|NZ_JH621247.1| Aquimarina agarilytica ZC1 Scaffold2, whole genome shotgun sequence
CTGATACACCTTCAGGTACATATGTAGTAGAATATGAGATTTGTGAAGTTGGAGCAAGTCCAGTGAATTG
TGATAAAGCAGAAGCTACTATAGTTGTTGCGAATCCAATAGTTGCGACTGATGAAGACTTTAGTGCTACC
CCATTAACCGTAGGAGATAGTAGTCCAAGTGTTATTGATATGAACGACACTTTGGATGGAAGTGGTCCAG
TAACCGTTGGAATAAATCCTGGTGATGTAGGTTTAACAGGTACTAATGTTCCAGCAGGTTTAACATTTAA
TCCAGATGGTACGATTAGTGTTGATGCTGATACACCTTCAGGTACTTATGTAGTAGAATATGAGATTTGT
GAAGTTGGAGCAAATCCAGCGAATTGTGATAAAGCAGAAGCTACTATAGTCGTAGCGAATCCAATAGTTG
CGACTGATGAAACTTTAGCTCCAGTAGATACGTTAGGAGGCGATGTTACAATACCTTCAGTAATAGATTC
TGGAGAAACTTTAGCAGGAACACCAGTTACTGTTGGTACAGGAGCAGGTGATGTTACAGTTAGCCCTAAC
CCAAGTGGAAGTACCCCTGTAGGTTTTACATTAAATAATGATGGCTCAATAGTTGTCCCAGAGAATACAC
CTTCAGGAACTTATACTGTAGATTATCAGATTTGTGAAAATGGGTCAACACCAGCAAATTGTGCAATGGC
TACAGCTACAGTTATTATTGATAATTCGATAGTAGCTACTAGTGAAACTTTAGCTTCAGTAAATACTGTG
GGAGGCGATACTACTACACCATCAGTAATTGATTCTGATGAAACTTTAGCTGGTATTCCTGTTGTTATTG
GTACAAGCCCTGGAGAGATTACAGTAAATGATAACCCAAACACAACGAATCCAACAGGGTTTATTGTTAA
TCCAAATGGTACTATTACAGTGCCTGAAGGAACACCTTCTGGTTCTTATGATATAGAATATGAAATTTGT
GAGAATGGAGCTTCACCAGTAAATTGTGCTATAGCTGTAGCAACTGTTGTAATTGAAAACCCAATCGAAG
CTGAAATAGATGACTATACTACAACATCAATTACAGGAGGAGCATCTACACCTAATATTTTAGGTAATGA
TACTTTAGCGGGTAGCCCTGTAGTTTTAGGAAGTGCTCCTGGAGAGGTTAGTTTAATAGGAACTAATGTT
CCTAGCGAATTAACATTGAATCCTGATGGAACAATTACCGTAAGTTCTACGGCGTCTACAGGAACGTATA
CACTAGAATATCAGATTTGTGAAAATGGTACAACACCTGTAAGTTGTGATACTGCAACAGCTACCGTTAG
AGTAGAAAACTCATTAGTAGCATCGAATGATGACTTTACATCTACTCCTTTTGGAACAGGATCTACTACG
CCAAGTATTTTGGATAATGACTCTTTAAATGATTTAGGACCAGTTGTACCAGGAACAGGAATAGGAGAAG
TAACTTTAAGTCCAGTAAATATACCTGAAGACCTAACTCTTAACCCAGATGGAACGATTACCATTGCGGA
TGAGGCTTTGCCAGGAACTTACACATTAGAGTATCAAATTTGTGAAAATGGAGCAAACCCGGCAAAATGT
GAAACTGCAACAGCTTCTATAGAAGTATTGGATGATCCAATCCAGGCGACTAATGATGATTTCACAGCCA
CACGTTTTAGTCCAGGGGATACTACTATTATTGTTATAGGCGATAATGATACCTTAAACAATGAACCTAT
TGATCTCGGTATAGGTACTGGTCAGGTTACTATTACAGATAATCCTAATGGAACAAATCCAGAAGGAATT
AAGGTTAATCCTGATGGTACAGTGACTATAGACTTAGATGTAAAGTCTGGTTCTTTTGTAGTGGAATACC
AAATTTGTGAGAACGATGCTGTTCCAGCAAATTGTGATGTTGCTTCTGTTTTAATAGAAGTAGCGGCTGG
AGATGTAGAGGTATTTAATGGTTTATCTCCTGATGGGAATGGATTAAACGATTTCTTGAGAATTGATGGA
CTCCAAGACACATCAAGCAATTCGATTGAAATTTATAATAGATGGGGAGTTAAGGTTTACGAAACTAAAA
ATTACGGTTCGAACGGTAACGTATTTAGAGGTTTCTCTAATGGACGTGTAACGATAGATGAAAACCAATT
ACTTCCAACAGGTACTTATTTCTATGTTTTGAATTATACAAAAGACAATAGAAATGAAGTGAAACAAGGT
TATATATATATAAACTAAATCATCTTAATATCATTGGCTCTGTAATTTTATGCAGAGCCATGATTTAAAT
CATAAATATCATGGAAAAGAAATTTTTTAGATCAGCTATGGTAATTTTAGGAATTATTATTTCTACAGTT
GCACAAGCACAGCAAGATCCTCAATATACCCAGTATATGTATAACCCTTCTGTAGTTAATCCTGCTTACG
CAGGGTCAAGAGATGTGTTAAGTATTGTTGGATTACACAGAAGTCAATGGGTTGGAGTAGAGGGAGCACC
TAGAACACAAACCTTAGGGATTCATTCTCCAATAGGTATAGGTCGAGTTGGTTTAGGAGGGAATATTGTA
CACGATGAAATAGGGCCATCTCAAGAGACCTATTTGACTGCAGACTTTTCATATACAATTCCAACTTCTG
AAAAAGGTAATTTAAGCTTTGGTATTAAAGCTGGAGCTCATATTTTAGATGTTGATTTTACTAAATTGAA
TATATCTGATGCAGGTGATATCTTCGATAGAAACATAGATAATAAAGTAAGTCCTAATATTGGATTAGGT
TTGTTTTATTACACGGATAAGTTCTATTTAGGGTTAAGTGCTCCTAATTTACTTCAAACTAGACATTTTG
ATAATGTGAATATCAATACCTCAACAGGTTCTAGTTTTTTATCTAAAGAGCGAGTACACTATTATATTAC
TACAGGTAGGACATTTGATTTAAGTAGTAATGTGAAGTTTAAACCCGCGATCCTTTCAAAGATTGTCTTT
GGTGCACCATTACAATTAGATCTTACGGCTAACTTTTTAATATGGGAGAAGTTAACTCTGGGTGCTGCCT
ATAGATGGAGTGCTGCTTGGAGTGCATTAGCAGGTTTTCAAATATCAGATAGTTTAATGATTGGCTTCGG
CTATGATCGAGAAACGACTCCGTTAGGGGATACTTCATTCAATGATGGAAGTTATGAGGTAATGATGCGA
TTTGAACTTTTCAGAAAGCAGAATAAAATAATAACACCAAGATTCTTCTAAACTTAATTGATTATGAATA
CTAAAAATATTAAAAACGTCATATTATATTCTTTCTTGGGGTTTTCAGCATTAGTTGCTCAGGAACAAAA
GATAAAAAAAGCAAATAAAGCTTTTGAAAATTACGCATATATAGATGCTCAAAAAACATATTTATCCGTT
GTAGAACAAGGGTATACTTCTGCAGATGTATATGAGAAATTAGGAGACTCTTATTACTTTAATGCGGATT
TAGAAAGTGCTGCTATTTGGTATGGTAAATTATTTTATGAATACGCCTCGAATGTTAAGCCAGAGTATCT
ATTTAGGTATAGTCACGCATTAAAGAATATTGGTAATTATGAATTATCAGATAAAGTAATGGAGCAGTTT
GGCAAAGTTACTGGGGTAAAAGAGCAACGTGTAAAATTCTTTAATAAGGATCGTAACTACTTGGCATTAA
TAGAAAAGCAATCAGGTAAGTTTAAAGTATATAATGTAGAAGGCGTAAATACTTCGGGTTCAGATTTTGG
GCCAAGTTATTATAACGATAACACTATTTATTTTGCATCTGATCGCTCGAATATAGCTAAAAAAAATATT
CATACTTGGACTAATGCACCTTTTTTAAATCTTTTTAAGGCTGATAAAGATTCGAATCAACTTACGAATT
TAAATAACTCTTCAAAAGTAAACGGGAATATTAACTCTAAGTACCACGAATCTTCAACTGTATTTACTAA
AGATGGTAAAACAATGTATTTTACTAGAAACAATTATACAGACAAAAAGAAGAAATCAGATACTAATGGC
ACTACAAAGTTAAAACTTTACAGAGCCGTTTTAAAAGACGGAAGATGGTCAAATGAATTAGAGTTGCCTT
TTAATAGCGATGAATATTCTGTAGCGCACCCAGCATTATCAAAGGATGAAAAAAGGCTTTATTTTGCAAG
TGATATGAAAGGAACAAAAGGGCTTTCAGATTTATTTTTTGTGGAGATTCTTGGGGTAAACAAATATAGC
GAGCCTCAAAATTTGGGAAGTAATATAAATACAGAAGGAAGAGAAACCTTTCCTTTTATTTCTAATAATG
GGGATTTGTTTTTTGCCAGTGATGGACATATTGGACTTGGAGGCCTTGACATCTTTATAGCTAAAGCTAC
ACCTAGTAAGAAAAATTTCGAAGAGGCTTACAATGTAGGGAAACCTATTAATAGCAAATATGATGATTTT
TCTTTTATTCTAAATTCATCAAAAAAAGAAGGATATTTTACTAGTAATCGTGAAGGAGGTTTAGGGAATG
ATGATATCTATGCATTCGAACAAGTAGAAGAGTTGATTACAACATGTGACCAGTACTTGAAAGGTATAAT
AACTGATGCAGAAACAAGAGCACTTTTACCAGGATCAAAAGTAACCTTGTTAACTGAAGATTTAAAGCCT
ATTACTTCTACGGTCGCAGATGGTAATGCATTTTATGAGTTACCAATAGAATGTGATAATAAATATGTAA
TCCGAGCAGAAGAACCTAATTATAAACCAACTGAAGTTGATTTTGCATCCTCATCGGTTTTTGAGTTCAA
TCATAACCAGCCAATTCAATTAAGAAAAGGAGCTCCTATTATTAATAATGTGGCAGCCAAGGTTGGTGAT
GATTTAGCAAAATTGCTACAGCTAAACCCTATTTATTTTGATTTCGATAAAGATTTTATTCGTCCTGACG
CAGCTTTAGAATTACAAAAGGTGATAGCAGTTATGAAAGAATATCCAAATTTAGAAATAGATGTTAGAAG
TCATACGGATAGTAGAGCACCTTTTGCTTACAATATTGACCTAAGTACTCGAAGAAATAAAAATACGATC
AAGTACATTGTAGAAAAAGGAGGTATGTCTACTTCTCGATTGACAGGTAGAGGATACGGTGAAATAGAAC
TTACTAATGAATGTGCTGATGGAGTTAATTGTAGTGAAGAAAAGCATCAATTAAATAGAAGAAGTGAGTT
TATTATTGTAAAGCAATAATTATTTTTGTTTTATGCATTTATAAGTTAGTAGTAATTAATGTAAAAATCG
TCTGGAAATTTAAATTCCCAGACGATTTTTTTTATTTGAGTGTATAAAACCACCGTCAAAGACGGTGGTC
ATGTTTTAAGGGCTTTGCCGTTCTTTAGATTTGACCATCAAAACTCTTTTCAAGATGAGTAAATATAGAA
AACTAACGCACGTGTATTACAAGTGTAACTACCACATTGTTTTCACTCCTAAGTACTAATTTCGTGTTCT
ATTAGGAATGATAAAATCATTAATCGAACATGACTTTCAGGTTCTCAGTAGTTGGAAAGATGTTCAAATT
CAAGAGTTGAATAATCAAAAAGGTCATGTTTATATGGTCTGCTCTATTCCTCCCAAGATATCAGTGTCGC
AATATATAGGGATTATTAAAGAAAAAATAGCAATTAAACTTTTTAAAACATATCCAAGCCTAAAGCAAAA
ACCATAATGGGGAAATCATTTTTGGTCAAGAGGTTATTTTGTTAGAACGATTGGTTTGGATGAAGGCATG
ATAAAAAGGTCTGTAAAGTATCAATCTCACAACGAAGGGAATTAAGGTGTTGCCCCTGTAGGGCTAATCT
GAAAATCAAAGCCTCCGTTCTAACGGAGATTTTTTACTTAAAGTATCAAAGCCTTATTATGTAGCCTTCA
GTATTAAAACGCTGTAGGTCTAATATGTAAAATCAAAGCGTTTTTTTAAATTACATGTCGTAATATTGTT
ATATGTTGTCGTAATAGTTTAATTTTGCCCAGCAAACCTAAGAAAATGAAAAGAAACGTTTCTGAACTTT
TTAATAGTTATGCCATTCATATTTTCTCATGGGCAAGACTTAGATTACAAAAATCTAGACAGTGCGGATT
AAAAAGGTGTTGGCAACAATAAGGGTGCGTTCAACATACATAAATAACCTTTAATATTAATTTTATGAAA
ACCAAATTACTTTATCTTTTTACTTTTATTACTACTTTATCCTTTAGTCAAACAAATTTAGTCCCAAATG
GGAATGTTGAAAGTTGGACAAATTCTACAACATTAGATAATTGGATAACCGAAAACAATGTTTCTCAAAA
CACTACTGACTCAACGGAAGGAAATTCAAGCGCATCTTTATTAATCATTGGTAATAGTTCAGTTAACCCA
AAAATTGTTACAAAAGTTCCTTTAACGAGTGGTATAACTTATACTGTTAGTTACAAATTTAAATATACGA
CTTCGAGTTTTACTGGATCTAGATCCGTATGCTTAAAATTAGTTAAAGATGGTAGTGCAACTACAACAAC
TAGGTGCTCAACACTTAATGATAACTTATGGAATTTTAAAGAAATAACATTCACTCCTGATCAAACAGGA
GATTATGATTTAAGTATTTCAACGTCCAATTTTTCTGGCATCAATACATTTGAAGTACTAATTGATGATA
TAAAAGTTTTTGATCCTTTAAATTTGAGCGTTGATTATTTTAAAAATGATGATCAAAATCAAAATATTTA
TCCAACAATTACAAATGGAAAAATCTATTTTGATAAAATAGAAAACGTTGATGAACTTAATATTTCAGTT
TTTAATTGTATTGGGCAAAAAGAAAATTTTGTGGTTAACAATAATACAATTGACTTATCTAGACTAGCGA
CTGGAATATATTTTATAAGTTTGAAAACAGACAAGCTGAACACTGTAAAAAGAATTCTAAAAAAATAATA
CAGTTGCCAATACTGTATCACAGAAATAATAAGGTTTGAGATGGGAGTTTAGTGAGAAACCCTTCATCTA
AAGTAGGAAGAAAAAATGCGCAAAGAAATGCTATTTATTTCAACTAAAAACCATAGACTTTCAGAATGGA
ATTAATTGTGCTTGGGTGAATTACATCAAGAGATGTAGGTTATTCTAAAAAGGAATCAAAAAATTTAAAA
CCGGATCTTACTGAATTTAGGAAACGTATAGAATCAGTTAAAAATGCTGGTGGTAATCGAATACGATGGT
GGTGGCACACGAATGTCTAGATAAGTCCTGTTTTATACACTATCCCGTAAAGTGTGTAAGTTTAAAATAT
GGAGGGTTTAGCTTTTTAAAGTTGAACCCTTTCTTTAAATATAGTTAAAAACAGATCCAAAATTATTCCC
CAATTTCTAATAGGTATAGTCCATTTTTTAGTTGATTCTCTCAAAGCTAAAAAGGTAGACTTCATAACAG
CATTATCTGTTGGGAATGAGAGTTTGTTTTTAGTGTATTTACGGATTTTACCATTTAGATCTTCAATAAG
ATTAGTAGTGTAAATTATCTTCCTAATCCCGACAGGGAAGTCATAAAATACGGTTAATTTCTCCCAGTTA
TCACGCCAACTTTTAACAGCATAAGAGTACTTTGATTCCCATTTTTGAGCAAAATCGTTTAATGTAGCTT
CTGCTGCATTCTTGGTAGGAGAATTATATATTTCCTTCATGTCAGCAGCGAACTCCTTTTGTCCTTACAT
ACTATATATTTGGCTGCATTTCTAATCTGATGTACTAGGCAAATTTGAGTAGTTGATTCAGGTAATATAT
TACGAATAGTCTGTGTAAATCCAATGAGATTACCCGTTGCTGTGATCAGTAAATCTTCTACACCTCGAGT
CTTCATATCTATAAGTACATTCATCCAAAAGGCTGCTGATTCATTTTTGCCAAGCCATAATCCAAGAACA
TCTTTCTTACCATCTCTAAGTAGGTCAACAGCTATATACATAGTCTTGTTAATCACTTTTTAGTTTTCTC
TAATCTCAAAAACGATGCCATCCATTCAGGTAATTAAATAAACAGGTTCTAAAGGTCTATTTTGCCAAGC
AATAATATCATTGCTTATACGATCTGTAATTCTTTAAATTGTAGAGGTAGAGATATCAGAATTACTCATT
GCTTTTGCATATAGGCTTATGACGACATTTTCAATACCATCAACTATATTTTATCGCTTAGGAACCATCC
ATTGGATTAAAAGATGATTTACGATCTCGAGGAACCTTAATTTCGGTCTTTCCTAATGATGTTTTTATCT
TTTTTGTAGAATACTTATTACGAGAATTAGTATTCTCTGATTTTTGATGTTTCACATAATTAAGGTGAGC
ATCCAATTCGACTTCTAGAATTTTTTCAACTCTGGCTTTTGAATCGATTTAAGAAAACTAGTAAGCTTTT
TTCCTATTTTGAATTGCTTAAAAAATTCATCGTTCAAGAAATCTTCTTTTTTCATAAGTGCATAAAATTT
AAATTTGATCAAAAAAATATCTGGGGTCATGACCCCAGATATTTTAAACTTTACACACTTGGTGATATAC
TACTAAAAAAAAATCATCTAGAAATTTTACTTTCTAGATGATTTACTTTGTTTATTAAATGATAGATTTG
GATTTCTATGTTTTGTGGAAACTTAATTTGAAATAACTATTGAACGACCAATTTGGTAACCAGAGTATGT
TGGTTTTTATTGATTTTAATTAAATAAATTCCTGAAGTCAATTTACCAATGGTTATTTTATTAGATGTGT
TTTCTACTTTTTTCTGTAGTACTAAATCTCCTTTTAAATCATAAATATAAAGTTTAGCACCTTTTATGTT
TTCGTTTACCATTAAATTAAAAATTTCATCTTTTACTGGATTAGGAAAAATACTAAATCTTTTTTCTGTT
TCATTTCTAAATTCCGAAATAGAAAGAGAATCTTCAGTAAGATCAATAGTTGTCTTTTTTATATCTCTAT
CAGTCATAAAATTACCATCAACCTCTCTAATTATTGCTCTCACCTCATAGTCGTTAGCAATAGGCCAAGT
ATCTTCCGTTTGTATTGTAATAGTAACAGTGCCGATACCAGCATCAACTTTTTTCTTTGCATTTCTAAAA
AAAGTACTACCACTAGGATCATAAAGCGCAACAACAATATCTGCGCTTGAAGTTGCCTCATAATGTACTT
CTACATCAAAACTCTGTCCTTTTATAACATCATCTGGTACATCATCAATAGTAACTATATCATTTGTTAC
TAAATTTTTTGGTGTCAACTCCCAAGTTCTCACCCAATCATAATAAGTTGTGCGTTCTTCTTGTGTACCA
CCCATGCCTTGTTGCCCATCATTGGGCACCGAGTTCCACTTATAAGTTTCTGTTACTAAACGTAAATACA
TATCAAGATTAAAATCAGCCTTAGGAGTAATTGAATGAACTTCCTGCCCATCTAGAAAAAATATTAGTTC
TTTTGGACTTTTCCACCAACATCCATAAACATGATAGTTAGCCCATGCTTCTTCATTTATAGGACTTTCA
GTACCCCTAGAACCAGTAGGTGTTTCTGGACATGATGTATTCCTGCTATGAGAATTTGAATTCATATTCT
TGTTGTAGTCTTTTTTGTTTGGGTCGGTACTGGTAACCAGCCCTACTACTTCAACGATATCCAATTCAGT
AGTTCGACGATCACACCCAGTAAAATCATCAGGTCTATTTATCAACCAGAATGTTGAAGACATAAAAGTT
TTGTTAGCTTTCATTTTCGCTTCAATGTAATATCCAACACTAGCTTTTCTTTTAGACCAAATATTCCCAC
ATCCATGTGTATACGTTTCACCATCTATAACTCTCGGGGAATCTAAAAGATAATTTTCTAATCTTAAATG
TTCTGCAGCAACTGTGGCTGATTTTTCTTGAAACAATCCCGGAGGTCTACCAACCCACAAATCCGCTCTT
GTATTTTCCCATTTTGTAAGATCAAGTTTAGGACTGTCAAATTCATCTGACAAATCATCAATTAATTTCC
AACTTTTACTATCAGGACTAGGATCTTGACCTAAATTAAACGTTGGGTTAGTTGGTTTTGTTTGACCGTG
TAAAGATAAAGTAGTTGCTAGGCACCAAAAAACTGATCTTAAATGGCCACCTGAGAAAAAAGATTTCACA
TTAAACATTATTATTTGATTTTGATTAATACGGTGCGAATATAATAGTCAAAGTCAGTGGAATATTATAT
CCAACTAATATCGGTGTGCGAATCCGTTGAAAGGCGTTTTTACGGGTTTAAAAGCAAACTGTTTTTGTTT
GTTAGAGAAAGAAGTTCTTAAGTGTCGAAAAAAGAGCTTGTTCTTGTTTAAAAAGTTAGCATCTGTTCTT
ACTAGTTCTAGTCTATACTGTAAATATGTGGAATAGCCTCATAGATTAAATTTTGTTAAGTATTTTGAAA
TGATATGCTATTAAATTTTGTGTTGTTTTTGGTATGAAAAATATTTGTTTTATACGTTTTTATTTAAAAT
CAGCTGGGTTATTTAATCAAAATTCAAATACTTTAAAAATATTATGCAACGTATGGTTTTTTTAATTAAA
AAAAACCATTTGTGTCAAACTATAACGTTATAGTTTGATCATATTTGCCCATGTAATCAAACAACTAATT
TTTTATGAGGAATTTTTTAGTATTATCGATTTGTGCCATTTTTTCCAATGTTTATTCTCAATGGGATACG
GGGTGGTTTCCTAATCCAGATAATTATGTTCCAAAGTATAACGGCAAATCCTGGCAAAGACTGGGCTGGA
TGTCAGATGGCTTTAACGATGGGTGGTTAAATGAAACCAAGTGGAAACGAGGTTATTTAAATGAATGGAA
TGATAAAGGTAGGACGCGTTGGAACTCATGGCCTGATTATGTGAAAGTCAGTAATACCTGGGGGCAAGGT
TGTGCCCAAATTGGCCATTATTGGAATGACGCGAGTGCGGGAGGATGGGCGAATACTATAAGTTGTGGTA
TAATTAGCTCTAGAAACACAGTAAAGTACCCAGTCTATTTAGAATCAAGAATTAGAGTTGCAAATACAGA
GTTATCTTCAAATTTTTGGTTATTGGATACAGGAGAAAATAGAAGAGAGATAGACGTGCTTGAATGTTAT
GGGGGGAATTCATGGAATGGAAACAGAGCTACATCTAATTTTCATTTTTTTACTGATAGTGACCGTAAAG
ACCACTTCAAGAGATCGGATCATTGGAGAGGCTTTCCTTGGCGAAATAATTTTCATCGATTTGGTGTTCT
ATGGTTAAACCCATGGGATGTTAGATTTTTTATTGATGGAAAAAGAGAAGGATACAATTTCTATAGTATA
AATCTAAAAACAAAAGATGGCTTACAATTAAATAAAGATTGGTGGAATTATAGCACAGAAATGAAAATTA
TTTTAGATGTAGAGGAACACAAAGGAACAGCCCAAGATCCTATTTGGAAGTATAAGCAAGGTTTATGGAA
TACAGATCGTAAGATGTTAGTGGATTGGATTGGGGTTTGGAAACCAAATACTGGGGGTAAGAAATTAAAT
ACTTCATCAATTAATACTGCAGAGCTTCCAAAAGTATACCCAAACCCTGTAAAACAAGGGCAGGAGTTGG
TTTTAAGTAATATAGAAAAGGGGCAAAATTTTATTTTTTCTAGTGTAGACGGGAAAATAATATCTTCTTT
CAATATCCCGCATGAGGACAAACTATTTTTGAATACTAAAGATATAAGCCCTGGGTTGTATATACTTCAA
GTTGATACGAATGTGATAAAATTAATAGTTAAATAGTTTGAAAAAACATCTATTAAATGATCATTTTCGA
GTAGTTCCATGTTTTTCGTCGTCGAATTAGAGGGTAAGAGGACTCTAACCACTTTCTGATTATTTGCTTC
AAATATATTTTATAAAAATATATCAAGAATAGTGATGGATTTAAAATATGTTAAACTTGGAGTTTTCGAC
CTACTATTAAAAGAAAGCACCTTTTGATAAAACACTTGCTTTTAGAACTTATACAATCGATGGTAATTTT
AGTTAGCATCATAAATATGATTACTACGCTTGATATATTCTATTCTTGAAAGTTCAATATATGACAATAC
GGCCTATAAGCTAAATCACTAAGCAATACTAAGTGTAATACAAACCTATCTATCGGGATAATAAATAAAA
CTATTTATTCGCTAAGCAAATATTATACTTGATTAAACCATGCTTCAGTATTTGTTTTAAGATATCCAGA
TAATCGATATAACAAAAAATATTAATTCTATAAACAACTAATTTTATGAAAAATTATTTATTATTCATGT
TATTTAGCGTGCAATTATTATTTGCACAAAGTGTAAAGCTTCCTGAGGGTTTTACAAAAGACAGCTCATT
ATCAGATGATTTTAATTATGGTAGTGATAAAAAGGGAATGTCGGATAAATGGGATGATTTTAACAGCAGT
GGTTGGAAAGGTCCTGGTCCTACGGAATTTAGAAGTGAAAATATTACTTTTAAAGATGGTAAATTAATAA
TTAAGGCTAGTCATTTTGAAGGTGGAGAAAAACATTTTGAAAATGGACGTACATGGACCAGACAAGTTCA
CACAGGTTATTTAGTAAGTAAAGAAGATAATCCTATATCACCACCAGTATATTTTGAAGCAAGTCTAAAG
GCGAATGCGATAGGTTTAGCCAGTAATTTTTGGGCAAAAAGAGGAAATATTGATAATAGTTCCGAAATCG
ATGTAGTTGAAACGTATTCTGATACTGACAATGGAAGTAACAATTATCATTTTTTTAGAGATAAGAAGGA
TTATAATGATCAAAGAAGGCCTCCAGTAGGTAATGATGTAGAGTCTAATTTTAATGTCTACAGTTGCTTT
TGGAAAAGTAAAACAGAAGTTATTTTTTATGTTAATGGTAAGCAAACTAGACACATTTACCCATGTGCGC
CTGATCCAAGAGATAGATTGGTTGATCCTGCTGGAAGGTTTTTTGATGAAAATTTAAGAATTATTTTAGA
TTGTGAGGTGCACACATGGAGGATAAAACAAAAAATTGCAAACGCTCTGCCTACCAAAGCAGCCTTAGAC
AAACTTACAGATGATCAGCAAATGCAAGTTGATTACATGCATGTTTATAAACCTGGATCAGGTTATAAAG
TTTCAGATCCTTGTGGCAGTGATTCATCAGATTCAACAGACAGTGCAGCTGATGACAAGTCCTTTTCATC
GTTATCTTTTAACCAGTCAACAGAAGGAGCAAATAATAATCCATTAATTCTAAGCGCACCAAATACTGTA
GAAAGAAATATTAAAGGTTATCCACTGAAGGCTTCTTTTTCTCAAGATGGTTATGCCATCTTTCATTTAA
AGGATAGAAACAATGGGTGGAAATCATATGGTCACGTAGGTAAACAAGTGACATCTGGGAAACAATATAA
TTTTTGGTTGAAGACCAATGAGTATATATCAGGGAACAATCTAGATTTAGTATGGGAGATTAAGGTGAAT
AATGGAGCTAAAGGTTTTGCTGTAAAGTCAACCAATGTAAATAATGGTGGCAACAATCAAGATACTTTCT
CAAATAATAGTAGTCCAACAATTCAAAACGCCCCCAGTTCTATAGTTAGAAATATTAAAGGCTACAATTT
ACAGGCTTATTTTCCACAAGGAGGTTATGCTATATTTCATTTGAAAGACAAAAATAACGGTTGGAAATCA
TATGGCCAAGTAGGCAAGCGAGTTACATCGGGATCTACACATAATTTTTGGTTGAAGACAAATCAATATA
TATCAGGTAATAACCTAGATTTAATATGGGAGGTTAAGGTTGATAATGGCGCTAAAGGTTTTGCAGTAAA
ATCAACCAGTTTAAACAGCGGTGGCGGTAACCAAAACACTGTTTCAAACAATAGTAATGCAACAATCCAA
AATGCCCCTAGTTCTATAGTTAGAAATATTAAAGGTTACAATTTACAGGCTTATTTTCCACAGGGAGGTT
ATGCTATATTCCATTTGAAAGACAAAAATAACAGTTGGAAATCATATGGTCAAGTAGGCAAGCGAGTTAC
ATCGGGATCTACACATAATTTTTGGTTGAAGACAAATCAATATATATCAGGTAATAACCTAGATTTAATA
TGGGAGGTTAAGGTTGATAATGGCGCTAAAGGTTTTGCAGTAAAATCAACCAGTGTAAACAGCGGTGGCG
GTAACCAAAATACTGTATCAAACAATAATAATCCAACAATTCAAAATGCCCCTAGTTCTATAGTTAGAAA
TATTAAAGGTTACAATTTACAAGCTTATTTTCCACAGGGAGGTTATGCTATATTTCATTTGAAAGATAAA
AATAACGGTTGGAAATCATATGGTCAAGTAGGCAAGCGAGTTACATCGGGATCTACACATAATTTTTGGT
TGAAGACCAATGAATATATATCAGGTAATAATCTAGATTTAATATGGGAGTTAAAGGTTGATAATGGCGT
TAAAGGTTTTGCAGTAAAATCAACTGGTGCAAACAGTGGTGGCGGTAACCAAAATACTGTATCAAACAAT
AGTAATCCAACAATTCAAAATGCCCCTAGTTCTATAGACAGAAATATTAAAGGTTACAATTTACAGGCTT
ATTTTCCACAGGGAGGTTATGCTATATTTCATTTGAAAGATAAAAATAACGGTTGGAAATCATATGGTCA
AGTAGGCAAGCGAGTTACATCGGGATCTACACATAATTTTTGGTTAAAGACCAATGAATATATATCAGGT
AATAATCTAGATTTAGTATGGGAGTTAAAAGTTGATAAAGGTGCTAAAGGTTTTTCAGTAAAATCAGCGT
ACGTTAATAATGGTAATAAGTCTTTAATTCAAAAACAAAGTGATGATTATATTGTAAAATCAAATAGCAT
AAAGTTTATTAATTATACTAATAATTCCTCTTTCAGAGTTTACAACCTATTAGGTGAGCTGAAGGATGTA
GATATGATACATTCTTCTGATTCGGTAATTCTAGATTTTAGTAATATGAATCATGGCGTCTATTTGGTCA
AAACTTCTAAAGAAAAAGTAATTAAATTTTTAAATAAGCGTAGGTAGTATAATAGCTTATGTGATATGAA
TGAAAGCGATTGGTATTGTATTTTAGGATAAACTGCGTATAGTTATCAGGTTTCTTCTCTTGTAAAGAAA
CAATAATTAAGTTACTTAAGAATTAATTCAATACCAGATTTAAAAAAATTGAAGTTTATTGGCTTTGATT
TCACCATAACCCCATTGAATATAGTATTCATGGGGTTTCTTGTCTTTTCTAAATCAGTTTTTTTCATAAG
CATTGGATATTTCAATTTTTTTGACAGATAACTAAATTTACAATGTATGAATTGATAATTGTTTAGTGTA
TAGTTATGTACTAAGGCATTTTGCTCTAAAATAATCTTTAAATAATTGTTTTGGACTATTATCTAAAATA
CCTATTTTGCCCTATTTTTTATAGTATAAAGAGAGCATAGTTTTGTGATTAATTTAAAAATGAGAGAAAT
GAAAAAAAACTATGGATTACTAATTATGCTGTTCTTCAGGGTATTCACTTATGGACAAGTTATTCTTAAC
ATACCTGATGTAAATTTTAAAAATGCATTACTAAATAACGACCCCGTAATTGATACCAATGGTGATGGAG
AAATACAAAACGGTGAAGCCTTTGTATTTGGAGGACCTTTGTTTTTGGATAACAAAGGGATTGTTGATAT
GACTGGTATCGAAGCGTTCAATAATGTGAGGATTATTCGTGCATCATCCAATCAAATAGAAACGATAGAT
CTATCAAAACATACTTCGTTACAGGAATTGTATTTGTCAAACAACAAATTAAGACAATTAGATCTTTCTA
AGAATTCGAGACTACTTCGTCTTGAGGTAGCCAGTAATAATTTGGTTTCCTTAGATCTTAGCTCAAATGC
AAATATGAGAAATGTAAATGTAAGCAGTAATACAATAAAAATTCTCGATTTTTCGAATAGTCCCTTTATG
GAGCGATTTATAGCCAATGGAAATGATTTAAGGTTCATAAACGCGCAGAATGGAAGTAATACAGGGTTGA
CAGACTTTGTGGTTAGCAATAATCCAAATTTAAGCTGTATTATGATCGACAACGTTGTTAGTTTTATTGT
TCCTCTTACTTGGGAAAAAGATGCTACTGCAAGCTACAGCGAGAATTGTGTTGCACCTATTGTCAATATT
CCAGATGCTGCATTTAAAGGGATTTTATTAAACCATAGTCCAGCTATCGATACCAATAGCGATGGAGAAA
TACAAATTTCGGAAGCGGAAGCGGTGTCCAATATAAATACCTCTCGTAATGGAGATATAGAAGATTTAAC
AGGGATCGAGTATTTTGTGAATTTACGAACATTAGATTGTAGAGCTAGTGCGCTAAAAACATTAGATGTA
AGTAAAAATGTAAATTTAACAACACTATATTGTTCGTCTGGTGAAATTACTAGTTTAAATATTTCTAAAA
ATACAGAATTAGAGGATTTAAGGTGTGGGGATAATTTTATAAAATCATTAAATATTTCAAAAAACCCGAA
GTTAGAGATTTTATTAGCTGATAAAAATGATATGGAAACGTTTTTTGTTTCAGATATCGAAAATACGGTT
TTACATACACTACACGTGCAGGAGAACAAGTTGAGGATTCTGAATGAAGCTAAATTTCCAGCCTTGGTAA
GTTTTAGATGTGAGCAGAATCTAATTACCAGTTTAGATATTTCAAATAACCCTAACATTAGGACTTTTTA
CGCCTTTAGTAATGCGCTAACCTCATTAAATCTAAAAAACGGGGCCAATACCCTTTTTAGTCCTCTACTA
ACAAATAATCCAGATTTATACTGTATTAAGGTAGATGATGTCGATTATAGTAATACGAACTGGAATGGCC
TATCGAATAAAGATGATCAAGCGGTATATAATGAAACTTGTAGTACTAGGGGTATACTTATACCAGATGA
CAATTTTAAAGAGGCATTACTAAATTACATCCCAGTAATAGACATCAATCAAGATGGACAAATACAGTCT
TTCGAGGCTACAGCTTTTACGGGTACGATGAATGTAGTAAATAAAGATATAGCTGATTTGACAGGGATAG
AGCATTTTACGAATATCACAAACTTATTTTGTAACAATAATAGTCTAACGGCTTTAGACGTATCTCAAAA
CACAAAGTTAACTACCTTACATTGTGGTTTTAATGACCTTTCTGCTTTAGACATTAGTAAAAATACAGAG
TTAATAGATTTGTTTTTCAGCTTCAATAAGATCAAAACAATAAATATTGCTTCGAATACAAAATTACAAA
CACTAATAGGCTTTAATGCTGAGTTGGAAACCCTTGTAAGTGCTAGAGATAATTATCCAAGTTTAACACG
ATTGTTTTTAGCCAATAATAAGTTATCAACTTTAATTACAAGCCCGTTTTCGAATTTACAGATATTAACC
TGTCAGGACAATGAGATAAGTGCTCTAGATTTTTCTCTTAACACAAAAATTACTGAAATTTTAGTACAAA
ATAATCAATTGACAAGTGTCGATCTTAAAAATGGGAATAATGGCATATTCAAGTCCCTAGATAGTGATTT
TTCAGGGAATTCAGATTTAGAGTGTATCCAAGTAGATGACTTAGACTTTAGTAATAACCGTTGGATAGGC
TTGAAAAGAGATTCAGGAGTTCAGTTTAGCGAAGATTGTGGTGCGAATTTAAGTGTGAATGAATTCGAAT
TAACAGCAAACACCAATATCTTTCCTGTGCCAGTAATTGATCGTTTAACAATAAACAGCATATACGATAT
CGTAGCTGTAGAGGTGTTAAACTTGGCGGGGAACACGGTATTATTATCAAATGAAAATACAGAGAGTATC
GATATGCAAGACCTTCCATCAGGCTTATATCTTTTAAAGATTACCTACAATGAAGGAGTGGTGTATAAAA
AGATAATTAAAAACTAAGAAGATAATCTTATCTAATCATTGAAAGGGCTTAGTATCAATCCGGGTACTAA
GCCCTTTTTATTGCTTTTACTGAATATCCGTAAATACTAATAATTAGCATTGTGTCATCCTTTATTTCAG
GATCTCATCTAGAATATGAAAATCAATAGGATGAGATTCCTTAAGCAAGGAATGACGAAACGCTACTAGA
TATTATCAATTACGGATATTCAAATTGCTTTTTTCTTCTGTTATATAATTCACAAAATTTTACAGTTAGT
TAAAATTTACTTCTTATTGTGTGATTGTATCTTTCAAACACAGTTCAGGAAGTAATACCATTTAGACTTT
AAAGACGTCATAATAAAATGTTCTTTTTTCGCTGTCTTTTGAAAATAAAAATAAGCCGTAACCCTGCTAT
GCTTGATTTTTCTTTTATATCGCTTTCAAAGCCTAAATGGTATAATATTCAAGGAATCTGAGTCTCTATT
ATATTTTACAGGTGTCATCTCTCGTGATTTTTCGTAATGAAATGTAAAAAAATAGTACTTTGACAAAACT
CAGTAGAGTTATCGAGAGATAAGTTTTGATACAAATTCACTTCGTTAACCTGCTGTAAATCAATGTTAAA
ATACGTAATTATTTTGGAAAAATTAAACTCGGGTAAGGAAGAACGAAAGTCAATAATTTCGCTAATAAAT
AAGGGGAAATACCTAGAGTTTTAATGTGAAGGTGTATGCTATTGAATACTGATTTAGCTATATATTATGA
GAAAAGGATTGAGAAAGGGAAAATGATGTATTTTGAAATTATAGAAGATAGAAAAACTAAACATAGCCTT
AGCTACGTTTCTTTTTTATGTTGAGCTAGAATTTTAAAAGGCACATTTTAACCCAGTAAATTCAAATAGC
TAATGGTATTAGAAACAAAATACAGTAAAGAGTATCTGCGCCGTAGTAAAAAGAGGCACTCCATATGGAT
ATGCCTCTTGGTAAGAAAAAATTACACTAAAAAGTTGATTGAGCCATGTAAGGTAATTTTATTATGGCGT
TTTTAAAGTTTAAATGGTATTAATCGAAGACGCCTAAAGCTATTCTTTAGCAAAACGTAGTGTTTTAGCA
TCATTCTTGAACTTTAAAAGATATAGACCTTTAATCAAATTACTAATATCTATTGTTTGGTTGTTATCAA
TCGAGCCTTGTTTTACAGGTTGTCCTAATAGATTGTAAATTTTGAATTGTCCAGATGTGTTTAAATTACT
AACCTTTATAAAGTTTTTTGCGGGGTTAGGGAAAAGTTCAACTCTAGCTCCAGTTAAGTCAAAATCATCG
ATGCTTAGCGTAGCTGTTTCGTTATACAATGTTGTTACTTCTGTGTCTGATATAGCTCTAGTCCATAAAC
CAATTTCATCTAAATTCCCATCAATGGCCTGCGGTGAACCAGGCAAAGGGTATCTAGAAAATTCTAAAAA
TAGTTGGTAATTAGGATTGGCATATATGCCTTGCAACGAGGTGTCAGAGGCTTCTAAATTACCATCAATA
TAAATTCTTGCAGTTTGCGTACTCAAATCATAAGTACAAGTTATCATATGCCAGTCCGTAAGATCAGCGC
TGGTATTTGCATAAATTAAAGCGGCATTAGAACCAGCATCACTTCCTAGTCCTAATCTAAACCCTTGATT
TGGTATATATACCAACGAATAGCTGTAACGGTCGTAGGCACTTCCACCATAACCACCTCTGTGGAAAATA
CGTTGCGTTTTGTTAATGTCATTTGTTTTAAACCAAAAGTTAATCGTAAAAGAAGTTGGTGCAAAATTAA
ATAATGTAATATTATCTGCATTATCAAAAGCATGACTTCGATTAATGGCACCAGAGCTAACTACCGTACT
GAGTACTACTGTAGGGTCTTCATTACCAATTTCATCTACAACTGTTTGACTGTCTAAACTGTAATAGTGC
GCTATATCGGTTGTAGGAGTAGTATCTGGTAACTCATATTTTATGATTTTACCATTATCAAAATCAGATA
TATATAAGTCACCTTTGTATGATGTAACATCTCCAACGGCGCTTATATTCAGCAATTGTCCAAACGTACC
TACAGGATCATTAATGTTAAAACTTAATAATCTACCAGTAGGATTTTGTAAAAAGTATATAGTATTATTA
ATAGCTGTCATGCCAACGTTAATTCCAGCTAGTAATGGTTCTTGGCTACTGTTTATGACATTGCCTAATG
AAGGGGTATTTGCTGTAAGATCGAATTTCCTAATAGCATTTTCTTGCGTTACATAAGCATCATTGCCAAT
TTTTACAAAATCGTAAATAAGGTTTGCTCCAAATACTAAGGAAACATCAATTGTAGGGTTGTCAAGATTA
AATTTGAAAACATTATTGTTTGCACCCTTGGTGTATAAATAATTATTATGAATTAACATCCCCTGAGGTT
GTTCAATGCCAACAAAAAAATCTTGTCTAGTTGCTGGTAAGCTTGATGTAACGTCTACTCTTGAAATTCT
GTTAGCTTCAGAAACATATAGCGTATTACCATTAAAAACTAGCTCTTTAGGGGTATCTAAGCCAGTAACA
ACTTCTACTGGGCTAGGATTGGTCTGAGTAAGATCAATTTTAAGAATTCTATTGGCTGTGAGTTCTGTAA
AGTATAATTCGTCACCATTTATAGCAATGCCTCGAGGCTTAGTTAATCCTGTGAGAATATCTGTAGTTTG
TGCAGAAGCAGCTGTTAAAAAGGAGAAAAACAGTCCCAGTAAAACGTGAAAATATTTCATAATTTTTATT
TGTTATTAATGGGTATAAAACTATAGCTCACACGTACGTTGAAAAATAGGGCAAAATGGGTATTTTTTGG
TGTAATTGTAAAAACACCTAAATTTTAAGATGATAATATGATTTTGTGTGATATCTAAAATTCTTTCGGA
TTTTTGGCTAAAGACTCACTTATCGTTTTTTTAAACGATCTCACCGTAATGAAGTTGTATTTGCAAATCG
CTTGACGATTTGAAAAATACCCATTTTAGCCTATTTTTTTTAGTCTGTTTGAGGGATAATTTTGTATTTA
AATGATAAATCAAATACAACTAAAGATAAGTTCCTTTATATTCCTCGTACACCTTTTGGTGATAACTATT
TATGGTCAGGGATTTGTTAATATACCCGATGCACATTTTAGGTAGGCATTATTGGGTGATTTTACCAGTC
ACCCTAATATAGATACCGATGGTGATGGAGAAATACAAATTGCAGAGGCTAAGGCCGTAGAAGTATTAAA
TTTAAGAAATAAAGGTATTCTAGATTTAAGAGGGATAGAGTATTTTGTAAATTTAAAAGAACTATATATA
GAACACAATCGGTTAACAAGTCTAGATATTTCTAAAAATAAACAGTTAAAAGAATTATATGCTCAAGGTA
CTCTCTTAACTACACTGAATATTGCAAGCAATGAAAAACTTGAGGTCGCGGATATTCGTGGAGGTGAATT
AGAGATGTTAGAGGTTGATAACTGTGGTAACCCTCATTTACGAGAACTTATACTAACAGATTGCTTTTTT
ACAAACTTGGATAAATCTAAGTTTCCTAATTTGAAAATACAGTTTTGTAACTATATTGATTAGTTTACAT
TATAGCTTAAGTGTTAACGAATTCTAGTTTACAACAAATACTGTACGTAAACACAGCCATAGCAAATGTT
ACAAATACCCATTTTACCCTATTTTTAAATACACAATACGTGTCTAGTTTTGAAGCTCAAAAAAAATAAC
TAGACAATGAAAAACAATTATTTCTTACTAATTACACTATTTTTAAGTGTAACACTTTTTGGTCAGTCTG
TGGTTAACATCCCAGATGTCAACTTTAAAAACGCACTTATAAATCATAGTCCAACAATTGATACGAATAG
TGATGGAGAAATACAGTTAACAGAAGCAGAGGCTTTTTCTGGTTCACTTGCGGTATCTAACAAAAATATT
TCTGATTTAACGGGTATAGGGGCCTTTATTAATATTACTCGTTTAGGTTGTTCTGGAAATAATCTAAGTA
CTATCAATATCTCTAATAATAAAAAAATGCAATTTTTAGCTTGTTTAGAAAATCATTTAAAAAGTTTAGA
TATTACTAATAATTTAGATTTAAAAGCCTTATGGATCAATAGCAATGAAATGGAAACCCTAGACCTTTCT
AAAAATTTAGCTTTACAAGAATTATCGTGTTTCAAAAATAATCTGTCAAGGTTAGATGTCTCTAAAAATT
TAGACCTGCAAATTTTCTATTGTTATGAGAATAATTTGACAACGATAGACATCTCTAAAAATGTAAATCT
AAAAGTTTTATGGTGTAGCAACAATGATATAAAGTCATTAGATGTTTCTAAAAATATGTACTTAAGAGAG
CTATCTTGTTCTAATATTAATCTAACCTCCTTAGACATATCAAAAAATTTAGAATTAGATAGACTTTCTT
GTTCTAATAATAAATTAACTGCTCTAGATCTCTCTAAGCATACAAAGCTAGAAAGATTAAATGCCAGCAA
CAACCAATTAACTCGATTGAATCTTAAAAACGGAGTAAATACAGACTTCGAGCATAGTTTCTTAAACTTT
AGAAATAACCCTGATTTAACCTGTATCCAAGTAGACGATGCCAACTTTAGTAATACCAATTGGTCTTCGA
TTAAAGATGATACAGCTGATTTTAGTGAAGCATGTGATTATGTTATAGTGTTCCCTGATGCCAACTTTAA
AACTGCGTTATTAAATCATGATCCAGTAATTGATACCAATGACGATGGCGAAATACAGATTTCGGAAGCT
GAAAGTGCCATTACTCTAAATATAGCAAGGGCAAACATTAATAGCTTAGAAGGTATAGCCTATTTTGTGA
ATTTAGAAGAACTTTTTTGTGCTATAAATAATTTGGATGCTATCGATATTTCACAAAATGTCAAATTGAA
AAAACTGTATTGTGCTTCGAATAATTTAAGGGAATTAGATATTGCAAAAAACACGGTATTAGAAGAATTG
TCTTTTGGTTTTAACGGGGTAAAAAGTATTGCCCTAACATCTACAAAATTGAAATTAATAACAGCCACAA
ATGGAATATTGGAAGAATTACTTGTGCTAAGAGGTACAACTTATCCCGATCTAAAGGAAATATATTTGAC
TCAAAATAATTTAACTCAATTATTTCTTCCTGCTTTTCCTAATTTGGAGTTTTTGTCCTGTGCAGACAAT
AAGCTTACCTCACTAGACTTGTCAAGTAATACTAAGATTAAAGAGGTCTATGCCTTTAACAATCTTTTGA
CCGAAGTAAATCTAAAGAATGGAAACAATGAAAATATAGATGTTACACGAGGCTTAACAAGTTTTGCTCT
CAATATTGATTTAGATTGTATCGAAGTAGATGATGTAGCCTATAGTAATGCCAATTGGCAAGGGATTAAG
GATAGTGCAACACAGTTTAGCGAAGATTGCGGTGCGGGGCTTAGTATTACTGATTTTGAATTAGCTTCAA
ACACTAGTGTCTTTCCAATTCCTGTAATCGATGATTTAACCATAAATAGTAACTAACTATGATATTGTAT
CATGCGAGGTGTTAAACTTGGTTGGCAAAACAGTACTAGTTGCAAATGAAAATCCAGATAGTATCGATAT
GGAACACCTTCCTTCGGGCTTATATCTTTTAAAGGTTACTTATAATGAAGGAGTGGTCTACAAAAAAATA
ATGAAAAAATAAGGTGATCACTAACCATTGAAAAGAGTTTGGTCCAGTGTACTAAGCTCTTTTCATTTGC
AGTGGCTATGGGTAATACCATTTGAGCTTTGAAAGCAGTATTAAAGATAATTAAGATTTTTTAGATGTAT
TAAAAAAGAAAAATCAAGCATAGCAGTACTACGGTTTATTTTTATTTTGAAAAGACAGTGAAAAAAGAAC
ATTTTATTAGGGCATTTTTAAAGCTCAAATGGTATAAATCTCGTGCTTATCTAAAAAATACCCATTTTGC
CCTATTTTTTTAAGTTCGTGCAGAGAGTAGTTTTGACCTCTAAAGATAAACAGAATAAAATGAAGAAAAA
CTACTTAATATTTTTTGCTCATCTCTTAGTGTTGGCAATTCATGGCCAGGGGATAGTTAATATCCCTGAT
GCAAACTTTAAAGATGCATTATTAAACCATAACCCTGTAATTGATACTAATGGAGATAGTGAAATACAGG
TGTCTGAAGCCGAAGCGTTTCTCGGGCGAATCAATATTTTTGCTAAAAACGTCTCTGATTTAACAGGTGT
TGAGGCTTTTGTGAATATAAGTGGGTTGAATTGTGGTTTTAATAATTTGACCGAAATAGATGTATCAAAA
AATACAGAGATAACATTTTTAAGTTTCGGTCTAAATCCAATAAAGCAGATAAATATATCTTCGAACCTAA
AGTTAGAAGAATTGTTAGGGAATTTTTCAGATTTAGAAACACTTTTGATGCCAAACGTGATTAATGAAAA
TTTGACGGATATATTTTTAAATGATACTGAAATTTCCCAGTTGGACACTACTCCTTTTCCTAATTTGAAT
ATTATAAGTTGTATAAATGCAAAATTGAATTCGTTAGATGTGTCGAATAATACAAAGTTGAGACAACTTT
TAGTTCAAAATAATCGTTTGGTTAGCTTAAATCTTAAAAACGGGAATAACCCTTTTTTATTAGGGTTTGA
TAGAACAGCATCTAATTTCACTAATAATCCAGACCTTGATTGCATACAAGTAGATGATGCTGACTTTAGC
AATACAAATTGGGGGACAATTAAAGATAGCGGAGCACAATTTAGTGAAGATTGCCAGGGGAGTCTTGGTA
TTGAAGAACTGGAATTAGCTTCACACACTAGTGTCTTTCCAATTCCTGTAATCGATGATTTAACCATAAA
CAGTAAATATAATATTGTATCATGCGAAGTGTTAAACTTGATCGGAAAAACTGTGCTAGTTGTAAATGAA
AACACAGATAGTATTGATATGGGACACTTTCCTACTGGAGTATATCTTGTAAAGATTACTTACGATGAAG
GAGTGGTGTTCAAAAAAGTATGTAAAAAATAGTTTTGTTGTTGGTAGAATGGTGGAGGGGTTGGTCCTAA
CAATTCCTTCATCTGTTCTACGTTGATATTAAATCAAGTTAAAATTAAGGGCAAATTCGATCAATTGAAT
TTTGGAATCAAATCCTGCTTTTTTGTAGATGTTCTTTTTGTGTTTTATTACAGTATGATGAGATAAAAAA
AGGATATCAGCAATTTCATTAACGTTTTTTCCATTACAAACCCATTTTATAATTTCTTTTTCTCGTTTAG
AAAACGAGGTATAAAATGAAACATTCTCTTCGATGTATTTCGATGATTCTAAAACGGTATTGACCTCCAA
ATAAAAATCATCTATCTGTGTCATGGCCGTAGTAACCGCCTGAAAAACACTTTTTGTAAAATCGGCCTTA
ACACAGGTGAAATAGGTTTTATAATCTTCGTCACCAACCATCTTAAGTCGTTGATTGTAAATCAAGGTTT
CCTCTTCAGATCCTTTTTTTGCGAATTCCGTTAATAGGTTTACACACCTTTCTATATCCTCGGGATGCAT
AATTTCAGCTAGGAAGGCTGGTCCTAAAGCTCTAATTTCTTCCAGAGTCTTGCCATAAATTTCACATCCT
TTTTCTTCGAGATAAAGTAATTCGATGGTATTGATGTCATTTTCATGATAAAACCCTAAAAAATCTTCGA
GGCTATCAGTTCCTTGGTTACTTATTTTTTCTTTTAAAACAGCAATGGTCGATGCTGCGTTTTTAAATTT
TGTCATTTATCTATTTTAAATTTTGTACAGAAATAGTAGAAGTCATAAAAGTTATTGACATTCAGTTTCT
TGTAAATGTTGATTTTATGGTTTTTGATTGTGTGTATCGATAGATGTAAAGAGTCAGCGATATCTTTTAG
ACTATTTTCTTGACAAAAATATTGACATAGCATTACCTCCTTTTTTGTTAAGGAATCGAAAACGGCTAGA
TTCCTCTTTATAAAAGAACTGTTTTGAAATAAATCAAGTACCGTATGATTAAAAAGTTTTAGCTCATGAG
TAGGAACACTTAAATTTATTATTCTATTATCGTCTAAAACCCTTCCTCTTGTATAAAAACAATGTTCTTC
TTTTTCTTTGGGAAATTTGACTCTTTGGAAAAAAGCTACATGATTTTGCGTTTCTAGATTTTCTAAATAT
TTAAAATTAGCATCAATTGCATTGCGAAGATCGTCTGGATTGACCATTTCTATCATAAGTTCGGGACCAT
GTTGCAGTAGTTCATCTGCAGTCCGATCGATATGATTCAAAACAGTACTATCTGCTTCTAAAATTCGAAA
ATCATCTAAAGAATTAGTGTGTATATGACAAGGTAAGTAATCACTAATTTCTTGTATTGTTTTTTCTCCG
CTCAAAATTTGACGGCTGATTTCTGTGATGCTAAAATTTTGCAATAGAACTTGATTTGATAGATATTCAA
ATTTAACTATATCCCAACAAAATTTGTTTTGTACAAGAGCAATTTTTTAGGCAAGTATTTGTTTTAAAAA
AATGATGTAACTTAAGTAAACGGTGGTACTTGTAGAATTTTAATCTTTAACTAGTCATTCTTTTGTTCAT
ATTTAGTATAATTTATAACTCTTTAAAATTATTATTGATAAGTCGTATAAGTACTTTTGGGTAATTAAAA
AAGGTAAATAGCAATTAAACAATTCAAGTCTTCTTTCTTAATTAGAATAAACTGTATTGGAAAAATCGTA
TTTAGTCTTGATGTTATTTTTGGAGTACCTTGGATTTAGATGAGGACACAATAAAAAGATATGTCAAATC
TTACCAATAGTTTTTGAGCTGCTGCCTCTATAAGGCGAATTGGTAGAGAGATAAATTTAAATGCTCATAT
TTTAAATCATTTGCTGACTTAAAATTAATTCAATATCAGATTTCAAAAAGTTCGAACTCTGTCCGCTTTG
GTTCACGAATAAATAAAAAAGGAGAAAAATAATTTAAGCTTGCTCATAAATTATTTTTCTCCTTTTTGTT
TTCAAAGTTTAGCTTTGAGGGGTGTGCGTTAGCGAATCCTATTCGTAATAGAAACTTCGAATTTTGTCCG
TTCAATGTGACTACATAAGCAGGATTTTTCCTATTGCTGTGATTTGTATTGAAATGAATCAGTCCATTTA
TGGAACACATTTTTATAAAAGACTCGTAGAGGTTGCATAGATAGTAGTTTAATCAATCTTTTATTTATTG
GGGGGGGTGTTGTTGCAAAACGGATAATCAATATAACCATGTTTCCCACCACCAAATATTGTTGCCCTAT
CTGGCTTATTAAGTCTGAAATTTTTTTCAAAACGTTCTGGCAGGTCGGGATTAGCGATGTATAACGTACC
AAAGGAAATAAGCTTTGCAATGCCTTTTTCAAGTTCTGCTTCGGCAGAGTCCTTATCGTATCCTGCATTA
GCAATAACTGTATGACGAATCATCCTCCCAAATAATTCAATTTCGTTGTCAGTTGCATAATGTTTTGGTG
ATGGGAAAAATGTACTACGCTTCTGAATCTCCACATAGGCAAAGTCCAGTTTGTTCAGTTCTTTAATTAG
ATACGAATAAGTGGCAGAAGGGTCATCCAGTATAATATCACCGTAGGGATGGAATGGAGATATTTTAATA
CCCACCTTTTCACTTCCTACCGAACTGATTAATTCCTGCATTACCTCTAGCACAAAGCGGCATTTATTAG
GGATGCTACCGCCATATTCATCCGTCCTTTGGTTGGCACTTTCAGCTAAGAACTGGCTGGGCAGATAGCC
ATTAGCAGCGTGCAACTGAACTCCATCAAACCCTGCTGCTATTGCATTTTTTGCGGCCTGACCAAAGTCC
TTTATGGTCTGTTTGATTTCTGGTATTGTTATTTCCTGAGGTATTTCGTATTCCTTTTTCCCCTGAGAAG
TAAAGTGCTGCATTCCCCATATAGGAATGGGGGATGGCGCAAGAGGGAGCTTGCCGTTTCTGTCTACAGA
ATGTCCCATACGGCCGGTATGCCAAAGCTGTGCAATAATAACACCGCCTTTTTCGTGTACTGCCGTTGTA
ACCTTCTTCCATGCTTCTATTTGTTTGTCTGTGAAAATACCTGGAGTAAGCGGGCTACCAGTAGCCTCTT
TACTAATTCGGATAGATTCTGTTAACATCAAACCAGCGCTAGCCCTTTGGGTGTAGTATTCTACTGTTAT
ATCACCCACCAATCCATTTCTGTCTACGCGACCTCTGGTCATAGCTGCCATCGCCATTCTATTCTTCAGG
TTGACACCTCCTAATTGTACTTTTTCTAAAAGTTTCATTTGATATTTTTCTAGCTTTTATTTTTGTTAAG
TCCGTTTTATGTATTAGAACTTCGACATGAGGCTGTGATATACAATAAATACTAGTGTTTTCTTAATTTT
AGCATAGTTATCACTATGGTTAAATCAAAAAACTCAGTTTACGTTAGCATTTGAAGTAGATTGCAGCTGT
AATAGATTTTCTAATGCATAAAACGGGTTAAAGTCTACCGAAAAAAATGGCCCATAAATTCTTTCTCAGC
AATCGGACTTTTTGTTGATACACAGTATCATTTTGTGAAAATTATACTTCTTTTCGTCTGGCCATACGCT
GAGCGATTACGCTGGCGGCAATCAATTGCAAGGCATGGTAAAGCATGAGTGGTAACAATACTATTCCGGT
GATGGTACTATGCTGAAAGAGTACTTTTGACATGACCGTTCCGTGTACCAATGACTTTTTAGACCCACAA
AATAAGACCGTAATGCGGTCTTCATTTGAAAAGCCAAACCACTTGCTGAGTAATCCCACACAAAAGAATA
CGGTAAAAAACAAAGCCATCATCCCTACAGCAAGTCCGGCAAGTTCCAGAGCAGAGAAGCTTGCAAAAAG
ATGTTCGGAAAAAGACTTGCAAAACGAGGTGTAAATAATGGTGAGGATGATTGCCTGATCGAAATACTTC
AGTTGCTTCTTGTATTTTTTGGCAATGTTACCAAAACGGGAGTTGAGGCTTATACCGATGATAACTGGTA
ACAAAACCTGAAGAACCAACTTTAAAACAATGTCGCTTACATCAAAACTACCTGTTGCAGAAGCGATGAA
CAGCCCTATCCATAGTGGAGTAGCCACTACTCCAATCAAACTGGAAATGCTCGCATTGAAAATGGCTGCG
GGAACGTTGCCCTTTGCAATGGAAATCATAACAACCGAAGATGAAACTGTTGACGGCAAAGCTGCTAGAA
AAAATATACCCAACCAAAGCAATTCTAAATCGGTTTTCACGAAAAAAGGTCGAAATGCCAAAACTAGAAG
TGGAAAAAATAAAAAGGTAGTCAACTGAACAATAATGTGCATTTTCCAGTTTGAAAGTCCTACCTTTAGT
TTTTCAATACTTAGTTTTAAGCCATAAAACAAGAAAATAAATGAAACGCCAATATTGGCAATTTGACCTA
GCGAAACAGGTTCTTTAATCATTCCTGGCTGAGGCAAAAAATAGGCAAGTAGAATCATACTACCTATCAT
TAATATGAAACCGTCTAAACCTACTTTATTTAATACTTCTAATAACTTCTTCAAAATGCTCTTACTATGT
TTTTCTATTCATCTCAGATTATTTGTCAATTAATACATTAGAACTAAATCCCAAGTTCTTTGCGTATTAT
TTCTGCTCCAGCGCTTAAAGCACTTAACTTACCTCTTGCGACATTTCGAGATAAAGGAGCCATACCACAG
TTGGTACAAGGATAAAGGTTTTCAATATTTACAAAATCAAGTGCTTTACGTAGTGTATCCGCTACTTCTT
CTGGTGTTTCGATGGTATTAGTTGCCACATCGATTGCACCTACCATTACTTTTTTACCACGAACGAGTTC
AATTAAATTGAAAGGTACACGTGAGCCATGACATTCTAATGACACAATATCAATATTAGAACTTTGAATT
TTAGGGAAAATTTCTTCGTATTGACGCCACTCTGAACCCAATGTCTTTTTCCAATCATTATTAGCTTTTA
TTCCGTAACCGTAACAAATATGTACAGCAGTTTCGCAGTGTAAACCTTCAATGGCTCTTTCTAACGTAGC
TATTCCCCAATCGTTTACTTCCTCAAAAAATACATTAAATGCGGGTTCATCAAACTGAATAATATCTACT
CCAGCATCCTGCAATTCTCTTGCCTCTTCATTTAGTGCTTTTGCAAATTCCCAAGCTAATTTTTCTCGAC
TTTTGTAATGGCCATCGTATAATGTATCTACCATTGTCATCGGTCCAGGTAATGCCCATTTTATAGGCTT
ATCAGTCTGTTTACGTAAAAATTTAGCATCATCAACAAAAACTGCTTTTTGGCGGGTAACCTCATCTACA
ACAACAGGAACACTCGCGTTATAACGGTCACGAATTTTTACAGTTTTGCGATTTTTAAAATCCACACCAC
TTAAATGCTCGATAAAAGTTGTAACAAAATGTTGACGTGTTTGTTCACCGTCACTAATGATATCAACCCC
TGCCAATTGTTGCTCTTGCAATGCAATGCGCAAAGCATCTTGTTTCCCTTCTAGTAATTGATCCTCTTCT
AAGTTCCATGGTGACCACAATTTTTTAGGAGGCGCAAGCCATGCAGGTTTTGGCAAACTTCCAACAATTG
AGGTTGGTAATATTTTTTTCATAATAAGATGGTTATAATGTTTTAAATTAATTAAAGATCGAAATCGGCA
GCCCACTGCTCAAGAATATATTGGTAAGGTTTGATGAAATATTCTTCACAATATTTACCCTGCTCAATAG
CCAGTTGACTGCGTTCAACACGATCATACTCTACACGTGTCAGTGAGTAATCTTCATGTTTAAGACTAGG
TTGAAAGATTTTACCAGCCACAGAATTTGCATTGTAAATTTCGGGGCGATAAATCTTTTGGAAAGTCTCC
ATTGTGCTAATTGAGCTGATCAATCCAAGATCAGTATACTCTTTAAGTAGGTCACCGGTATGATAAAAAG
CCATGGGTGCTACACTATTTGCCGGCATGAAAAAACGAACTTTCATGCCCATTTTAGAGAAATATTGGTC
AGTGAGAGAATATTCATTCTGTAAGTACTCAAAACCAAGCACCGGATGCTGAAACTCGGTGCGAGTATAT
ATTTTGTTGCCCGATACACTTAGACAAATAATAGGTGATTGCTTAAAGTGTTCTTTATATGTCTCTGATC
TTACAAAAGACTGATAAAGCTTGCCGTGCAAATCACCAAACTTTTCCGGAACTGTAAATTTAGGTTTGTC
TTTATTGTACTCGATTAATAAAATACTGAAATCATAGTCACGGACGTATGAGGAAAAATTATTTCCTGCA
ACACCTTCGACATACTGATTCGTTTTACGATCTAAAATATTCGTTTTCAAAACTTCCATCATCGGCAGAT
TGTCAATACTTTTTTTATGATCAATATTCAATGTTACTGTCATGATTTCAAGTTCTACATGGTAACGATC
ACCTTTTGGGTTATCTAAATGAGCCAGTGCATTGAATCGATTGTTGATCATATTCAAAGCGTTCCGTAAG
TTTTGCTGGCGATCAACACCTCTGGCCAAGTTTGCGAAGTTGGTTGTTAAACGTGTATTACTTTCCGGGT
GATAGTTTTCATCTAAACGCCTGCTCATTAGTGTGAATGAAAAATCTGTTTTGATAGTATTCTGGGTGTT
TTTCATAGCTTTTTTCCTTCAATTTTGAATCTTCTAGTAGGTTCGATTTAATTGTTTGCGAATAGTTGTT
ATACACTGCAAATCTTATAATAAAAGATTATTTAATTACTATGTTAATTAAAATAAGTCAAATAATCTTT
ATAATGGGTTTTGGTAGATAAAATATCTTTTATCTTGGTGATTTAATTCGTAAAAAGAAAATTTATCTAC
GGTTGACTTAGACCAAACTGATTTGAAGTTATTAGAGTTGCTTCAATAAAGCAGGAAATTGACTAGAAAA
TAGATTGCACAACAAGTGAATCTATCGCCAACTCCTGTTTATGAAAGAATAAGAGGTTTGGAAAGAGAAG
GAGTTATTAAAAATATGTAGTATTGGTGGAACCAGTAAAAGTAGAGTAGGATCTTATCGTTTTTTGTGAT
ATTACTTTGAAAGAGCATACTAAAGAAATAGGTCATCAATTTGTAGGGGATACTATGCTATCTAAATTAT
TTCTGTGGGTGTTATAATATTTCAAGGGATTATGATTTTTGATTAAAGGTAATGGTCAGAGATATGAAAC
ATTATCAGGATTTTGTATTCAATAATTTAGGTTCAATAAAAAATATAGGGGGTGCTCATTGTACATTTGT
TATGGGAGTTATAAAACATGACTATGCTGTACCGATATAAAGTGTGATGCCCTATAACTTAGGACGTCTT
TTTCAGGGCGTCTGAAAATTTTAAATTAAGATCACTTATTAAATTATTTTTGTGCTAATGTTCGATTTTG
ATAGAATTAGATAAATATCTTCTCTAAAAAAGTTCGAACTCTCTCTGCTTTGGTTCACATTAGAAAGCCA
GACAATTTTGTCTGGCTTTCTTTGTTATGGTTGCTTTTATATTTTATTTAAATTTTGACTGAGCCATTTT
ACAGAAATTAATTCTTCCATTTGTATCAAAATTATTTTAGTGTCTAATATAAATAATTCAGGTTGAGGTA
TAAGCGATTAATTTCGGTAGGATATTATTTATTGGTGTTTTTTATTTTTGGAGCTAGCTTTTACATAAAT
ATGTAGATTGTAATAAAAAGAGGGTGCAACTTTAAATTGCACCCTATTAATCAATATAAATTCAATTTAA
TAAAAAAGAATTATTTGTTTATAACAATTCGTTCAACTCTTTTAAAGGTATCTCCTGTTAATTCTAATAG
ATAAACCCCATTGGCTAATAAGCTTACATCTAAATTATTATTATTTAATGGCGTACTAAGTACTTTTGCC
CCTTCTATGTTAAATATGGTAACAGTATGGAATTCTTCTATATTACTTACAGATACGGTATGTTGGGCAG
GGTTGGGATAAAGAATAGTTTCGGGGGATTTGTCATCCAGTGACTTAGCTCCTGAAACCGCATCAAAACT
CCATTGTTGGTTTTGATTGGTGTTACTACTAGCCCATAAATAGACATTTTGTTGTCTAGCTCCACCATTA
CCACCATCAATTGAAAAGCCGGGTGCATTACGTTTTTCTAATCGGAATCGTCCGTTAATGTTCACTTTTC
GCCAATGTTGATTTTGGTTATTAGTACCGCATGTAAATAATTTTACAGTTTGACCATTGGCTCCTCCGGT
TCCACCATCTAAACAAAAGTTAGTATTTTTCTTTCGGTAACTAAAAAAACCATTACCTCTATTAATTTCT
TCCCATTGTTGGTTCACATTTGAAGTACTTCTATTCCATAAATACACATTTTGCTGGTTTGCACCGCCAT
TACCACCATCAATTGAAAAACCTGAAGCATTACGTTTAGTTAACACAAATGTATTCCCGTTATTACCATT
GTTTCCACCACCGCCATTGTTATTACAGTTGGCATCTGGGAATTTATCATTTATGCCGACTATAGGTAAT
TTTGGTTGGTTTGAAAATCCATTGTAACCAATAGTACCAAAGAAAACACCAAAAGAGTTACTATCATAAA
TAACGGGCGCAATTGCTGGGCCAATATAGCTATAGCCATCAGGACCAGGTCTTGAAGAGGTGAGAGATTT
TAATGGACAGGGTACAAATACTCGGTGATTTGGTCTTATTTGTGCGGTTGTACCATAATTGACTTGTATT
CCTGTAATTCTCGAATTATTAGCAAATGATCCAATACCTCTATCTCCAAATCCACGTTCTACTCTTACTC
CAAAAGAACAACTATTGGATGTTACTCCATTAATATTTACTGTTCCTCCTACAGCCGAATGAGGAGAAAG
CATTACCGCTGCATTTCCATTGGTACCTATGATATTTCTACCTACAATATCTGTTGCCCCAACAGTTTCA
AAATTGGCAGGTTCAAGGCGAAGTGCGATTCCTCCTTCGCTAGAAAGGTTTTTAAATAAAACTCGATCGG
CTTTTCCAGCTTGGACACAGCCATAGCCGTAACTGGCATTCAATACATCAATATTTTTTATAATACCTCC
TTCGGGTGCTTGATTATTAAATCCTCTTCCTAAAACAAAAGCGGATTGCTCGGTAAGGTTTTCTATAACT
CTAGCATTTTCAAATTTGAAATTTTTAACATTTTCAACTTTAACGAAAATACAAATTTCATCGGTGTTAG
CGCCATCCATATTTACTGTGAATTTACCGCCATCACCTCTAATACTTACATTTTCTACAGCGTTTCTACT
TCCTACCCAAAAAATAGCACCCCAAGGATTATCATTTTCGGGTAATTTAATTACTGCATTAGGAGAAAAT
ACTAGGTGGACATTACTCTCTAAGTGTACAAATTTTATGCGATACTCACCTGCTGGGAAATAAATTTTCC
CACCATTAGGTTGTTTACTAACATCGTTAATAGCGCGTCTTACTGCCGGAGAGTCATCAGTATTGTCATT
AACAGTAGCGCCATAATCTGTAATGACATTTTTACTTACACCATTGTTAAATGTTTCTCTGTAAAATCTA
TTTTCATTGTCAATTTGACCAAAAAAAGGAGTGATCATTAAGTTGATTAAAACCAATAAAAGAACTGATT
TTAAGTGGGGAATTTTTAAATACGTTTTCATTTTTGATTGTTGTTTGTTATTAAAAAATTAGAACGACCA
TAAACAATTTGAGCAAATTATGGACGGGTTATAATTTAATAAATAACTACCATTAAATCAATGAATTACA
TGTAAGAAGAGTATGTCGGAATATGTGATGATTTGTGTTAAATTTCTATGAAATAAATATAAAACTAGTT
TAGGTGATGGACGATTAAAATCCAAAAATCAAGGTGTTGATCAAACTGAAAGTCTTGTTTTAAAGAAGCC
TTTTTAGCTAGTTATAGTGCTACCTATTTTTATGCCTATTCAATTGTTTTAAATTTTGGCACAAAATAGT
TTAAGCAATAAAGCATTACTCCGTAAGTAAAAATGAGTGTTGGCATGTTGGTGTTAAAACCGAGATCAAA
TTCTGGAATACCAAGAATTTCTCTAAAAGAACGAGTAGCAATAAGTAGCATAAAAATAATTCCGTAACCG
AAAACGGCAATAATAGCTAGTTTGTTTTTACGGGTTCGTATAATCCCTTTTTTTGTTTCTTCTGTGAAGA
AATACCAAAGTGCTCCAGTGCTAAATATTGCTTCAATAAAAATGGCTAAATAAGGACTAGAAGCATATAG
ACCAAGGCCGGCTTCCATTGTATCAGCTCCAAATAGATGATGCATATGACCAGAAAAAAAATCCAATATA
AAATGTACTGCTACCAATAGGATACTTACTAATCCTATTTGTGTACTTTTAAATAGGAATTTTCCAATTG
CGAATACTATAATGAACCATACTAATTGGGGTAATAAATCGTGGCTATATAGCATATCTACAGCCATATT
AGTTAAGGTAGCATCAAAAGCATCACTTGGTGTAGTAGGCTCAAGGCCTAAATAATGAAAGATAAACCAT
AAAAAATCTTGTAATTGTACTATAATTAAAAAATAAAGTAAAGATCCTTTTGGGAATTTTTGTTTGGCTA
TTAATGCGGTAGTAAAATGTCCTGCGAGCATAATTCCTGTTTTTGATTTATTTGGAGGTTTCTTTTCGAG
ATGTACCTTATTCATCTTACCGATCAATTAAAAGTAAATTAATCATCTACCCCTCCGTATCAGTCACGAG
CTTTTTGTTTTTAATTTATGAGTTTGTAAATTAAAATACTGATTTTGAGTATTCAAGATATGAAAAAAAT
AGGGTTTACTCTTTGTAGTAAAAAATAATGCTGTAAAGAATAGCTTATTTTTAATTAGAGACTTTGGTTC
AAGTATTATTTATTGGGAAGTAGGAATAACTAAGCATACATTTTTCACTATAAAACAAAGATAACTTAAT
TTAGAATTAGTTGTTTTAAAGATACTTAGAGCAAGATCAAAGCTTCCTATATTTTTTAGGATATAGTTAT
TGAACATCTAGTTGTTAGTATCTGGATTTCTTATTAATTCGTAATTAGTACTTCTTCCTCCAGATGTTTC
TTGTTTTAAAATTCCTTTTGAAATTAAATTTTTAATATCTCTAAGAGCTGTATCCGTTGAGCAGTTTGCG
ATTTTTGCATTTATTTTATTCCAAAGATGCTTTTGAAATAGAAAAAGCGGACATCATTATTATACCAGGA
ACAAAAAATACACTAAATGACTTACACTTTTTACGAAAACAAAATATAGTCCAAGTTATACTATCTCATT
ACGAAAAAGGAAAAAAAGTAATAGGAATTTGCGGAGGTTATCAAATGCTTGGTCAGTTAATTAAAGACCC
ACATCATGTTGAAAGTGATATGAATGAATTGTCAGGCTTAGGCTTATTACCCATTACTACAACTTTAACT
AAAGAAAAAAAGACCGTACAGCAAGAATTTCTGTTTAAAAACAAAAAAGCTATTTGTACAGGTTATGAAA
TACATATGGGAGTTACCAAGGGCGTAAAGTCGTCCCCTTTATTAAAAACTAAAGATGGACGAACCGAAGG
TTATGTATTGGATAATAATTGTTGGGGAAGTTACATGCATGGGATTTTAGATAATGCGGTGGTGATAGAT
GATTTGTTAGGGAGTGTTTCAAAAAATAGCCCCATTTCCTACCAAGAGTTTAAAGAAAAAAATTATGATT
TATTAGCAGACTTGTTAAGGGATTCATTGGATATGGAATACATGTATTCGCAAAGTAAAAAGCAAGATGA
TTAACGGTCACGGAGACGATGCTAACAGGTATACCCGAAAAGTAGTACGCAACTTTATCCTTATGTTTCA
GAAGGATTATCAGTAATGGAAAAGCGAACAATAGTGATCTCTTTATTCTTTTTTAGGCGTATTTTTGGAA
TGGATTTATAGTCAACAGACCGCTTTTTGCGAATCATCAGAAAAAACAAAGGAAGCATTGGAAAATTTAT
TTTTATATGCTGATGGAGAAGTAGAATAATACGATTTATAGATAAGAATTTCGTATAAATATGTTGAATT
ATTTTTTGCTAGTCTAAGGCAGGGCAGCACTATAGTGATGAGCCAGTTGATGCTTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTAGCTACGGTTGCTT
TTTTTAACGCAAGAATGGTGAAAAAGAAACAGCATATATGCGAAATTCTTATCAGTAAATCGTATAAAAT
ATAAACAAGAAGGTTTAAATCTTTATACATTTCTAAAAAGCACACAATATTTTATAACTTATTACTAGGG
AATAAATTTAAAAAAAAAAATATATTTATTTTAACATGCATAGGTTCTTCTAAGGCTATTTTTTTATGGG
GAATTATTACTTTTAATGTGAGTAGAAATAATACGATTTGCAGATAATAATTCAGCATATATGCGAAATT
TTTGTTAGTAAATCGTATAAGCATTATTGTTTTTGTAATAGGGCTAATCTTTATCAAGAAATGAAAATTT
GTATAGCGCAAACGGAGCCAATCAAGGGAGATATTTTAAAGAATATTGAAAATCATAAAAAATTGATTAT
GCTTTCTGTTAAAAAGGGAGCAGATCTAATAGTTTTTTCAGAACTTTCTTTAACAGGATATGAGCCCGAG
TTAGCTCAAAAATTAGCAACAACTAAGGATGATCAAAGGTTTAATGAATTTCAGGAGATTAGTGATGTAC
ATAAAATCACAATAGTAATTGGATTACCTACTAAAAATGATCAAGGTACCTGTATTAGTCTAATCTTATT
TCAACCCAATAAGCCTAGAATGACTTATTCTAAAGCTTACTTACATCCTGGTGAAGAAAAATATTTTATA
ACAGGGGAAAATTTAGCTCCAATTCCAATAGGCAATCATAAAGTGGCATTTGCAATATGTTATGAAACAT
CTATCACGGAACATATAGAAAAAGCGTTTAATAATAAAGCAGACGTGTACGTGGCTAGTGTACTCAATAC
AGTAAGTGGTGTTGATAAGGATATACATCGAATTTCGGAAATTGCAAAAAAATATACAATGCTTGCGCTA
ATGTCTAATCTAGTGGGAGAATCTGGAGGTTATGATTGTGCAGGCAAAAGTTCGGTTTGGAATAAAGAAG
GTAAATTAATAGGACAGCTGGATGATACCAATCAGGGGATTATTGTTTTTGATACAGCTACACATCAAGT
AATGAAGGTTAAGGATGAATGATTAAAATATAAAAAGAGACTGCCTTTTATTAGACAGTCTCTTTTTCAT
GTAACTTAAAAACTTTTATATGAATTAATCTATTATTAATTTTAAAGAAGTACCAGTGTTAACTTGTATA
AAGTAAATACCAGATGCTAAATTAGAAGTAGGTATTACCTCCGTAGTATCTGTGGCAACCATGTTAACAA
GTGCTGAACCTGTTGAATTTCGAACTATAATAGTATCTCCTTGGTTAATTCCTTCCAAGAAAACATCATT
ACCTCCAAGTACAGGGTTTGGATAAGCAACCGTTTCAGTGGCTTCGGTGCTTGATAATATTTTACCACCG
CTTTCTCTTCTCCAATCAAATGTTTCCCATCCTAAAGGAGCATTTCCTCTAGGGAATAATGCAGCATTAT
TTTGATTCCATGCTGCCTGCACCCATTTGTTAACTTGTAAACTTCGTAGCGCTACTTTATTGTTTCCAAC
ATTTCTCCACTCAAAACGTTCCCAGCTTAAGTCACTGTTTCCTCTTGCACGTACAATAACATTTTGGTTA
CTGTTATTGGTCTGTATGTATTTACGCGCAGACAAAGAGTATAATGCTACAACTCCAGAACGATGTCTGT
CTACTCTAAATCTTTGACGGTTACTTTCAACGCTAGTTTTATTAGCATACAAATCATTGTTTAATTCTGT
TACAGCAGAAACAAATCTACGATCTCCACCTGATTTCCTTAATGAAATTATACTTCCAATTGGAGCACCA
TCATTATTTGCTGTTGGAGGTGGGGGTGGTGGAGTAGAGCCTCCTCCGCCTCCGTTGATGTTAGGGCGGT
ACACACGTACCCAGTCCACTAACATCACATTTCTATTGTTATTATTTAAGTTGGCTACTGATTCTACAGG
TCTACCCGCATGTGCTTCGGTATCAATTATAATATGTGTAGGATCGTTGAATTGTCTGTTAGGATAAGGA
ACGCCTCCTCCGCTTTGTCCTTGTACATTTCTTAAAAGCGCTTCGGTAGTACAGTTTAAAACGGCTGCAT
TTGGACATTGTAATCTTGCGTCTGAAAACTTTCCAGTTAAATTCCTGGCAGCTCTACCTGGAACAAAATG
TTGACCATCAAACCTTGGTTGACCATCAATATAAAATTCAAGTTCAGTTGGACTAGCCCAATACACTCCA
AAAGTATGGAAAGCATTTCTCCAGAAATCATTATTACTTGTGGTAAAGAATGTTTGGTAAGTAAAGTCGG
TTAAATCCTGCCCACCACAGTTGGTAGCAGTTTGAGCGCCAGCATGAGATTGTCCCCCTCTACGATGCCA
CAAGTGAAAATTTGTTGACATTTGTTTTGAATAGAATTCATCTGGATCACCTCCATAACATTCCAAAACA
TCAATTTCTTCATTGTCACACTTGTTTAACATCCAAAAGTTGGATGAATTACGAATATTTGACACTTTAA
TTCGAGCTTCCATGTACACCGGATAACGAATTGTTCTTTTAGAAGATACAATACCGCAATTAACTAGGCC
TCCTGATCCAGGACGCGCTCTAACTTCCATTCGTCCGTTTCGTACTTCAACTAAATTTCCACCTTGCCAA
ACAGTTGAACCAGGTCCTCTAAAGCCAGGATCGGGCAAATAACTTTGTGCCCAAACATCTTGGAACTTTG
CACTGTTTTTGTTGTTGTGATTAAAGTCATCCGATAATCCTGTAATTAAATCCCAAGAAGCAAAACTTTG
TAGATTGTTTGGTAAGGGAGTGTTTCCAAAATTTAAGCCTCTGTCATTTCTTTGCGCATAAATGGCAGAG
GATAAATACATCGCAAAAGCGAATAGTAATAGTGATTTTAATTTCATAATGTGAGCGTTTTTATAGGTTG
TTTATAAAAATAATACTACAAATATATACAAAAAACGTTTTCGTAGGAATTAATTTAAATATTTAACATT
TGTCAATTTATTAAGTTTATTGTTGAGGTATCTTCTTTTTTTAACACTTTTTTGTGATAAAATATTAATA
TAATTTAATTTTTTCATATCTAATATTTTGTTAAAACATTGTTTTTCAGCTGTTTGTGTTTTTAGATGTA
AAGATTGTGTTATTTTGATTAGTTAAGTGTTAAAGTCGATTAAGTGCAATAAAAAAAGGTTATAATTATC
AAGTGATAATTATAACCTTTTTTATAAATTTTAGATTTTTTACAATAAAAAAACTAAAAAGTCATTGAAT
ATTGACTTATTTTATGCTTTTTGGACAACTACCCAACCTTTTTCAAGTAAAGGGATGGCTTGTTTAAACT
TTAGAGTTTTGGTTTCGCCATTCATTAAATTCTTAATAACAATTTTGTCATTACGACCAATTTTAGGTTC
TTCCCTAACAATAGTTTCTACTGGAGCTTGTTGTTGCTGATGTTGTGCATCGGCAATAGCTCTATTTTGA
TTGGTACGCTCTTCTAAATTTTGAATCTCTTCCTTTTGAGTCTGCATTTCTTGCTGCTGGTGTTGCTCTG
CAGCTTGAACATCATCGGGGTTGGCAGATGGTAATTCAGCTTTAAATAAAAAGGATATTACTTCTTTATT
TAAGCCTTGAAGCATGCTTTTAAATAATTCAAAGGCTTCAAATTTATAGATTAACAACGGATCTTTTTGT
TCATGAACTGCTAAACGAACACTTTGCTTTAACTCATCCATTTTACGTAAATGAGTTTTCCATGCATCAT
CAATAAGCGCTAATGTGATATTCTTTTCAAAATCGGAAATAATTTGTTTTCCTTCACTGTTATAGGCTTT
TTCTAAATTGGTACCAACGTTTAATGATTTAATTCCATCAGAAAAAGGAACTCCAATACGCTCAAATTGG
TTGTTGGGATCTTCGTATATCTGTTTGATTACTCGGTATACTTCTGCAGAAGTATGTTCCATTTTGCTCT
GATAATGTTTCAAGGCAGCGTGATATACTTTTCCAGTTAATTTTTCAGCGTTAAGCGAATTAAATTCCTG
TTCAGTTACTGGGCTTGGCATAGCAAAATAACGGATCAATTCAAACTCAAAGTTTTTATAGTCTTGCGAT
ATGTTATTACCTTGAGCAATACTTTCCGATAACTCATAAAGCATGTTCGCAATATCCACCTTTAAACGTT
CTCCATATAGGGCATGTCGTCTACGTTTATAAACTACTTCACGTTGGGCGTTCATCACATCATCATATTC
TAATAAATGCTTACGTGTACCAAAGTTGTTTTCTTCAACTTTTTTCTGTGCACGTTCAATAGAGTTAGAA
AGCATTTTTGCTTGTAATACCTCTCCCTCTTCAATATTCATTTTATCCATTAGTTTGGCAATTCTTTCGG
AACCAAACAAACGCATTAAATTATCTTCTAATGATACATAAAATTGTGAGCTACCCACATCTCCTTGTCG
ACCAGCACGACCACGTAATTGACGGTCAACTCGACGAGAGTCATGACGCTCTGTACCAATAATAGCTAAA
CCGCCAGCGTCTAAAACTTCTTTCGAAAGTTTAATATCCGTTCCACGACCTGCCATATTAGTTGCTATAG
TAACCACGCCAGGATTACCTGCTTCGGCAACGATATCTGCTTCCTTTTGGTGTAGTTTAGCATTAAGTAC
ATTATGTTTTACTTTACGCATGTTTAACATACGACTTAGTAATTCCGAAATTTCTACGGAAGTGGTACCA
ATAAGTACCGGACGACCAGCTTGTGCAATTTTTACAACATCTTCAATAACGGCATTGTACTTTTCACGTT
TGGTCTTGTATATTAAATCCTGGCGATCATCCCTAGCAATAGGTTTGTTAGTAGGGATCTCAATAACATC
TAGTTTGTAAATTTCCCAAAATTCACCAGCTTCAGTTACCGCTGTACCTGTCATACCAGATAATTTGTGG
TACATACGGAAGTAGTTCTGTAGGGTAACGGTAGCTAAAGTTTGTGTAGCATCTTCAATTTTTACATTTT
CTTTAGCTTCTAAGGCTTGGTGTAGTCCGTCGGAAAAACGACGTCCGTCCATAATACGACCCGTTTGCTC
ATCAACAATTTTTACTTTGTTGTCCATTACTACATATTCTACATCTTTTTCAAATAACGAATAGGCTTTT
AATAATTGAGTAATGGTATGAATACGTTCACTTTTTACGCTGTATTCACGGAAAAGTTCTTCTTTTTTAG
CGGCTTCTTCTTCGGCGTTTAATCCTAATTTTTCAATTTTAGAAATTTCAACAGCAATTTCGGGTAAAAT
AAAGAAATCGGAATCTTCTTCTTTTGAAATATGTGCTATTCCTTTATCGGTAAGATCAATTTGATTATTC
TTTTCTTCAATAACATAATACAAATCAACATCAATAAGGTGCATGTCCCTATTGTTATCCTGCATATATT
GATTTTCTGTTTTTTGAAGTAGTTGTTTTACTCCTTCTTCACTTAAATACTTAATTAAAGCCTTATTTTT
TGGAATACCACGGTAAGCTTGTAGTAATTTAAAACCACCATCTTTAGTGTTTCCTTCTTTAATTAATTTT
TTGGCTTCGGCTAAAACACCAGTTAAAAACTTTTGTTGTAAGCTAACAATGCTAGCAATACCTGGTTTTA
GCATATCATATTCGTGAATATCTCCTTTAGGTACAGGACCAGATATAATTAGGGGAGTACGTGCATCATC
AATTAACACGGAATCCACCTCATCCACAATCGCATAATTGTGTTTGCGTTGTACTAAATCCTCTGGCGCA
TGAGACATGTTGTCTCTTAGGTAATCAAAACCAAATTCGTTATTGGTTCCATATACAATATCACTATTAT
AAGCATTACGACGTGCTTCAGAATTTGGTCTGTGATTGTCAATACAATCAATTGTTAATCCATGAAATTG
GAATAACGGAGCCATCCATTCACTATCACGTCGTGCTAGGTAATCATTTACGGTTACTAAATGTACTCCA
TTTCCAGTAAGTGCATTTAAGTATACCGGTAGTGTTGCTACCAAGGTTTTACCTTCACCAGTATGCATTT
CGGCAATATTACCATTATGTAATGCTACTCCACCTATTAATTGAACATCATAGTGGATCATATTCCAAGT
CACTAATGTACCAGCTGCATTCCAGCTAGTAGCCCAGTTTGCATTAGTATCATTTATAGTAACATATTCT
TTTGTAGCAGAAAGTTCACGATCATATTCGGAAGCAGTTACTTCAACAGTTTCATTATTGGTAAAACGAC
GAGCGGTTTCTTTAACAACAGCAAAAGCATCAGGCAGAATTTCACTTAATTTTTTATCAGTAATTTCTAA
CGCTTTGGTTTCAAGAGAATCAATTTCTGTATATATGTCCTCGCGGGCATCAATATCAGCTGTATTGTTT
GCTTTAACTTTTAAATCGTCGATTTGAGCAACGATATCAGCTTTAGCATCAATAATAATTTGTTTAAAAG
CTGTTGTTTTTGCTCTTAATTCATCGTTAGTGATATTAACTAATGTAGCTTCTGCTTTTTTTATTTTATC
TAAAATAGGCTGTATGGCCTTAACGTCTTTTTTGGATTTGTCCCCGACAAATACTTTAAGTACAGAATCT
AAAATTCCCATGGTTATATTGTTAATGAAACTTACCTTATACTATTTGTTAAAATAGGTTAAGGTATTCG
TTAGGTTAGTTCCAACGTATGTTGGAAACTGATATTGCTTTTGTGGCGTAATTTACGCAAAAAAAAAGCC
TCTATCGAGACTTTTTGTGTTGTTTATTTAGGCTGAAGGCTAGTATTCATCTTCGTTCCAGAGATAATCT
TCATCAGTAGGATAATCCGACCAAATTTCTTCTATGGAATCATATGAATCACCTTCGTCCTCAATTGCTT
GTAGATTTTCTACAACTTCCAATGGAGCTCCCGTTCTGATGGCATAATCGATTAATTCATCTTTGGTAGC
AGGCCAAGGTGCATCACTTAAATAAGATGCTAGTTCTAGTGTCCAATACATTTGTCTATGATTTTTTTTG
CAAAAATAAATTTTTACGTAACATAAGCAAGTAAAAACTTATTTTTTTATTATATGTTTTATAAGAACTT
AGTGTTGAGTGTTATACCTCCTTGTTTGTTTTTTTAGGAATCCATTTGATTTCCTCAACTGTTAATTCTT
TTGACAACTTTCGTGCCAGTACAAATAAATAGTCAGAAAGCCGGTTTAAATATATTAAAACTTCTTTTTC
CAAAGGTTCGTGATGATGTAATGCATAGGCTAAGCGCTCTGCTCGTCTACAAATAGATCGAGCAACGTGA
CAATATGACACGGTGACGTGTCCACCCGGTAAAATAAAATGTGTCATTGGATTTAAGCTCGTATCCAAGT
GATCGATTTCATTTTCTAAAGCTTCAATTTCTTCAATGCTGATTTTTTGAATATTTAATTTTTTCTTTTG
ATTATTATGTGGTGTAGCCAAAATAGAGCCAATGCTAAATAGTTCTATTTGAATTTGGGTTAAAAAGTTT
TTATGCGTAATTGAAATTTCTTGATCTCTTAATAGTCCAATAAATGAATTTAATTCATCAATGGTTCCAT
ATGCGTCAATTCGATCATTACTTTTAGGAACACGTTTGCCTCCATATAAACTTGTAAAGCCTTCGTCTCC
TGTTTTGGTGTATATTTTCATTGTTTTTTTCTGTGATTTTAGGCTTTTTTTTGGCTAGTGTAAATTCATA
AATGCCAGTAGGTAATTATAAGCACTACTAAATATACAATTAATTCTATGTTTAAAAGCAAACTGTGATG
CTATTTATAAGCGGATAAAAAATTCTTCTTTAGCTTGTTGGTTTCTGTTAAAAATGAAACCAAAAAAATA
AGTGTCAATTACAACATGAGCATTTTTATGAGTTTTAATAGCATTCCATTTTTTTTTATTCTCGTGTGGT
AATTCAATTATGGCAAGTGCATTAGGTTGAAGTTCGTCTATTTGTCTTGCGATGTGTGTGTTTTTGGAAA
TAAAAATTAAATCGGCATTGCTACTAGAGGTAGTGTCTATTTTTTTTTGATGCTTAATAAGGTGTGTTAT
GGGGTGATTGTTTTTGAAATCCCCGGCTATTTTGTTGATTTTAAAATAACAAATGATACGATCTAGTAAT
AGTATGTGTTTTGATTTTAGTTGTTTAGGGGTGTTTTTAATGGTGTTTTTTGGGAGTGGGCTTGTTTTTA
TGGGCTTGTAAAAGCAGCGTGTTACTAAATTATAAACAAAAGGAGAGTGTACTCCATGTTCGTTTGTTGA
TTTTAATAAAAATAACCAGTAAGATTTTTTTAATAAAACAGACATTATTTTAATGTTTATTCTTTTTATT
TGTACTAATAAATAATGGAGATTAGTTTGTTAACCAACAACCAACAACCAACAACCAACAACCAACAACC
AACAACCAACAACCAACAACCAACAACTAATAGTTATCCCATTTTTTCGGCCAATTCCATCCAGCGCATT
TCTTTTTCTTCAATGGCATTAGTGATTTTTCCTAATTCTTTTGATTTTTCAATAAGTGCGTCTCCTTCAA
AATTTTCGGTTGCAAATTGTTGTTCAATTTCCTTTTTTTGAAGTTCAAGTTTTTTTAATTCGCGCTCTAT
TTTGTTATACTCTTTTTGTTCATTAAAGGATAAAGAGGTGTTTTTTTGTTCCTTTTTCCATGAATTTTTG
TGCTGTTTTACCTCGGGAGTAATTGTGGCTTCGGGTTCTTTTTTTGTTTTCGGACTATTCTCATAGGCGC
GATAATCGGAATAGTTTCCAGGGAAATCTTCAATCACACCTTTGCCTTCAAAAACAAAAAGGTGATCTAC
AATTTTATCCATAAAATAACGATCGTGAGATACTACGGCTAAACAGCCTGGAAAGTCCAAAAGAAAGCTT
TCTAGTACATTTAGTGTAACAATGTCTAAATCGTTAGTAGGTTCATCTAGGATTAAAAAATTAGGGTTTT
GAATCAAAACAGTGCATAAGTAAAGGCGTTTACGTTCACCTCCGCTTAGTTTTTCGACAAAATCATGTTG
TTTTTTACGATCAAATAAAAATTGTTCCAATAATTGACCAGCCGAAATTTGTCTTCCTTTTTTTAAAGGA
ATGTAATCTCCAAATTCGCGAATAACATCAATGACCTTTTGACCTTCCTTTACTTTAATTCCTTTTTGAG
TATAGTAACCAATTTTAATAGTTTCTCCTGTAATAACTTTTCCACTATCGGGTAATTCAATCCCTGTGAG
TAGATTTAAAAATGAAGATTTACCTGTTCCATTTTTTCCAATAATTCCAATGCGTTCACCGCGTTGAAAA
ACATAGTCGAATTTATTGGTAATAACCAAATCACCATAACTTTTAGAAACTTTGTGGAATTCAATAATTT
TACTCCCCATGCGCTCCATGTTGATTTCAAGGGTAACTTGGTGATCAGCTCGGCGTTGGTGGGCTTTTTT
CTTTATTTCAAAAAAATCATCAATACGGGATTTGGATTTAGTGGTACGCGCTTTTGGTTGGCGACGCATC
CAATCCAGTTCTTTTTTAAATAAGTGTTTGGCTTTGCTTAGTTCGGTAGCTTCGGCGGTAAGTCGTTGTT
CTTTCTTTTCTAGGTAATAAGCGTAATTTCCTCTGTAATTGTATAGTTTGCCATGGTCTAGCTCAACAAT
TTCGTTACATACGTTTTCCAAAAAGTAACGGTCGTGAGTAATCATAAAAAGTGTAATCTTTTCTTTGGCA
AAATATTCCTCAAGCCATTCGATCATTTCTAAATCTAAATGGTTGGTTGGTTCGTCCAAAAAGACCAATT
CGGGCTTACTTAATAAGACATTTGTTAAAGCTAAGCGTTTTTTCTGTCCACCAGAAAGTGATGCTACTTT
AAGCGATAAATTATCTAATTTAAGTTTTGAAAGTATTTGTTTGTATTCTGTTTCGAAATCCCATGCTTGT
GCTTGATCCATACGGTCAAAGGCAGCTTGAAAAGCGTCAGCATCTTCGGGGTTTAATACTGCTTTTTCAT
AAGCTTCAATGGCTTGTAAACTTTCGTTGTCGCCAGTAAAAATGGTTTCCTCAATACTAAGTTGAGGATC
TAAATTAGGTTCCTGTGGCAAAAAAGCAACCTTTAATCCTTTGCGATACACTACTTGCCCTGTATCGGAT
GGGGCGCTTTTGGTGATAATATTTAATAGTGAGCTTTTTCCAGTTCCATTTTTGGCAACAAAACCAATTT
TCTGACCTTCATTAATACCAAATGAGATGTTTTCAAATAAAACACGCTCTCCAAATGCTTTGGAAACATT
TTCAACAGAAACAAAATTTATCAAAATCTATAATTTTTGGTAAAACTAAGTGTTAATTATCAAACTATGA
ATTATTAATTATAGGTTTTTTTGTTTCTTAACTAGAGGTTGCTGATAAATATGTTTGAGGTGATAAGCTT
GTAAATGATAGAAGTGTTTGTATTTGATATTTTCTATACTATGTGATGGGTGTCAAATTTGTGGATGATA
GTATTGAAAAAAATAGGCTAAAGAACATAATAAGAAAACGAAAAGCCTGTTACTTCTTTACTCTTTACTC
TTTACTCTTTACTCTTTATTATCTAAAAAGGCTCCAGTCAATTCGGAGTGAAAACACATTTGAGTACAAG
GAAACACTTTGGTCTCCTATATCTGTAAGAGCGTAATCCACGGATACTCCTTTGTAGTGGAAACCTACAC
CAAAATTAGGTTGAAAGCCAAGTTCATTAGTGTTGTCAAATTGTTTTACTTTTTGGAAGTTACCAACACC
TCCTCTTAGGAAAATAAGTTTTCTGAAATTAGCTTCGAATCCGAAAGCGGGTGATATGCTAAAAGAAGCA
TTGCTAATTACATCGTTAGTTTGAGCAAAGCGAAAATTTCCGTCAGCTTCAAAATCAATAAAGATATCCC
TATTAATAGTAAATGTTTTGTTAAGTCCCATTCGAACACTAGGCAGGGTGATCTCAGTGGTTTCTGGAGC
TTCTTGATTGTTTAAGGCATTTATGGATCCGTTTCCTCTGGGGTCATCACCTAAGTCGTTGTCAAAAATA
CCATCTTCAATTTGCCATGAATTGTAAGTGGTGGTTAGGTCACGAACCATTATTCCGAATTTCCAAGCTT
TATTTTTGCTTGTAAGCAGAAGTCCAGCATCCAATCCGAATCCCCAAGCTGTAGCAAAATCACCGATTAC
TCTTCGGATAACTTTAGCATTTACTCCATAGCTAAAATTTTTATTGAAGGGTTTTCGAGAATAGGATAAA
GTAAAAGCGTAATCGGCGGTTGAAAATCGAGGTAATTCTTCAATGGGAGTAATATCTCCGCCAGAGGTTA
TTAAAGCTCTAGTGTCAAGAATGTCATCTACACCAAACCGTATCACGGAGACACCTATGGCACTCTTATC
GTCAATAGGAGTGGCAAAAGCGGCATAATCGTAATTTGCAATATTTGCAAAATAAGAAGCGTGCATTAAA
GCTAATTGTTTGTCTTTAATGTTAATTAATCCAGCGGGATTCCAATATCCTGAATTAACATCATTGGTAG
AAGCAACCACAGCATTTGATTTTCCAAATGCAGCAGCATCAACCCCAATGTTTAAAAACTCGTTTGAATA
TTTACGAGTCTGAGATTTAACAGAGATGATTGTTCCTGTCAATAGCATGAAAAAAAATATGTTTCTCAAA
GGCTGTTTTTTTTGCAAAGATGTTACATTTTTGTAATATATTAAACTTTATTTACATCTCCTTATTGTAT
AAAGTATTTTAAGTAAATAAGTAAACACCTACAGTGATATGTCGTTAAAAAAACAAATTCCTAATATAAT
TACCTTGTTAAATTTATTTTCGGGCTGTATTGCGGTTTACTTTGCTTGTATGAATCAGTTGTTTTTAGCA
GCTGTATTTACAGCATTGGGAATATTTTTTGATTTTTTCGATGGTTTTTTTGCGCGTTTGTTTAATGCGA
ATAGTGAGCTTGGCTTGCAGTTGGATTCATTGGCGGATATGGTAACCAGTGGGGTAGTCCCAGGGGTGTT
TATGTTTCAGTTATTGTTAGAATCAAGTGCGATTAATGATTCTTTTCCAATAGAGAATATAGGGGGGAAT
GTTATAGAGTGGGTTCCTTTTTTAGGTTTTTTTGTAACCTTGGCTTCGTGTTATCGCTTAGCTAATTTTA
ATATTGATACGCGACAAACAAGTTCTTTTATTGGTTTGCCAACACCGGCAAATACTTTGCTTATAATAAG
TATAGGTCTGGTTAGTATGTATCAGTCTTCGGGTATTATCGAGGTTTTGATGGATAATGTATGGGTATTA
CTGTCAATAGTAGCTTTGAGTTGTTATTTGCTTAATGCAGAAGTGCGACTGTTTGCTTTAAAATTTAAAA
ATTGGAATATTAAAGATAATTGGGTACGTTATTTACTTATAATTTCTTCGTTGGTTTTGATTTTGCTTTT
TAAATATTTAGGTATAACTTTAACTATATTATTGTATGTTCTTTTGTCTTTGATTTTCAGTGGAGAAGAA
ACCAATGGAGTTTAGGCTTGAAAAAAAGTTTAATTTTTTGCTTAAAAAAATTTGCCACAAGGGAATTAAG
TTTTATATTTGCACCCGTGTTTGAAACACTGGTCTATGGTGTAACTGGCAACACGTCTGTTTTTGGTACA
GAAGAGTCTAGGTTCGAGCCCTAGTAGACCAACTTAAAACCCCTTTAAAACATTGTTTTTTAGGGGTTTT
TGTTTTTTTAGGGGGCGAAATAGGGGGGCTAATAATAATTCTTAACAAAATATCTAGATGTCAAATACTA
TAGTTTACGAAGACAGATCTAAACGGTTTGACGAAAATATGATAAAAGGGCGTATAGCTGAAACTATTGT
TGAGCAGATGTTTATACGCATGGGTTATGATATTTATCGTTACGGTATGGAAAACACAGTTCCTGGTATA
ATACAAGACTTATACAACTGTAAACCTAAAGAAGTATCAGATGAAATTAGGAAGATGCCTGATTTTATTA
TAAAGAATCCAAATGATAATTCTGTATACTATGTTGAAGTTAAATTTAGAGCAGATGGTAAATTTCTATT
AAAAGAATTAGGTAAAAATTACCCTTATAAAAATGCATATATTTTAGTAGTTAGCAAAAAGCATATACGT
TGTGTTCTTTATTCGGAACTTGAGGAGTCTGGTGAGCTATTAATGAAAAAAGAATACCTATTAGGTTACA
GAGAGGACTTCAAGACTAATAGAGAAATTATACTATATTTTTGTGAATTGGCTAAGAAATATTTTAGTTG
TCTAGAAAGTTAGTTCAACTGAAATATTTTACTACTATTTATGATTAAAGATTTAATTTGATTTTACAGG
AATGATCTGGAGAATATTTTTGTACTACCTTTTATTTCGTATAAAATAATAGATTAATAGTACTATCGTA
ACACATAAAGAAAGTAGAATGGCTGATGTTTTAAGTGTATCCAAGAAATCTTCAAGCAGATTATTTAAGT
TTTCAAGTGGATTTTTATTTGTTAGTAGAAAAAAGAGTTTCATAATTATTTTTTAAGATTTGTCAAGTAT
TTTTTGCCATTTAGCATTGCTTTTATGTTTTAGGTCTTCCATTATCAAATCGGCTCCAACTAAACTTTTT
AAATGAAATATAACTTTTAAAGTCTCTACGATAAATGGATTATAATAAGCATTTTCAAGGTTTGATATTG
GGTTTAGAGTATCACAAAATAAATCATGTTCTGGAAATTCCTTAAAGGTTTCTGGGATTAATACTATTTC
TTGATCACTACAGTAATCATCGAATTCATCATCTTCTATTTTTACTAAAAAAGGAATTAAGGAAAAAACA
GTGTCATTATTTTTGAAAAGATTTCGATATTCAATAAACAAATCAAGTCGTCCTTCAGCTATATGTTTTA
AATAATCTTTATTATTTTTAAAGGGCTTTTTTAACATACCTCTACCTTTGAAAGGTGAAATTACGAAATC
ACTTTGATTAGTTATTTCCTCTATATAATCAGGGATATAAAAAAACCTAGGTAAATCAATTATGATATAG
TCATAGTCTTTCTTTTTTTGATCTATATATTTGGCTAATTCTTTTGTTTCTATGGACGCAATACTATATA
GTGGTTTTATATTTGGAAAAACTTCTAAATCTAATGCTCTTTTATCATAGCAAGAATTTTGATAATGTGA
GTCGATAAATAATAATTTATAATCTTTGGAAATCTCATTTGCTAAGATTATTGACAAAGTAGAAACGCCC
ATTCCTCCTTTAAAACTTGTAAATGATATTACTTTGTTTTTTAACTTTTTGTTAGAAGTTATTTCTGAAT
TATGAGAGATTTTAATTTTGTTATAGCAAATTTCTAATACTTCATCAATTTTAATGTTTAGATATTTACA
TAACTTCACTACCTCGAATACCTTTATTTCTCTTCGTCCAGATTCAATATGACTAAAGGTAATTGGAGAT
ATACCAATTTTGTTAGCCAGGTGCGATTGTGTGAGACCTAATTCTAACCTCTTTATTCGAATTTTTGAGA
TCAGTAAACTATTATACTCTTTGTTTGTATCCATATCGTATTATGTGTGATTGTAAATATAGTAAAATAA
TACAATATGTTATTTCGCTTAAGACTTTGTTATTTCTTAAATCAAATAAATTATTATCTTAAAAATAGTT
TGTTAACTTGGAAATAACCTTTAGGGTTATTCTAAATTAACGAACGTGCGTGCAATAAGACTATAGTTAT
TGTATAAATTCATACCATGCGAGAAACCAATTATTATCTCCTGTGGTACAAATTTATACAATAGGTTACA
TTTAAAAGTCAGTTTTGACGGTAACAGTCTTACTCACTTCAAAGCCAGTATTATTAAATACGGTAAAAAT
TACTTCTCCAGGAACTACATTTCCTGAATAATTTAGAGAATACGAAAAAGTTTCATTTTGAATTCCTGAA
AAGTTATCTAGTAATATATTTTCACCAAAAACTATCTTTCCATTGTTGAATAAGATGTTTTCGGTCGTAG
TTGAAATTCGTAAATAATAATCCAAGTCATAAAAGTATCCTGTTGCAAACGAAGGTCTATTTAACGTCAC
ATTTATAAAGTCGTTAATAGAGCCTGAGTTTATAGTTATAACGGTCTTAGATAAGCTAAAATCGAATTCT
ACGGGTTCTGCAGTTAAGCCATCAAAAGTTTTGGTTTTAGTAACTCCATTACTAGCAACAATAGTAACTG
TAAAATTATTTTTTTCAATAACCTCTGTAGGTATATAGTCAAAAACATAATTACCTTTTGAAAGATTCGA
AATTGTCTCAGGTAAATTTGAGTAGCCAATCCAATTAATTTCTCCATTTGAGTTGCTGCTTATATTCATA
GTATAAGTTAAGAGCTCATCAGAAGTTTGTTCTATATTAAGGTTTAAACTTGTTCTTTCTCCAAAAAGGA
CCTCTTCTTTCAATGGAGTAAAGCTAAATTTAAAATCAGTTAATTCTTTGGTAACAGAATAAATAACTTT
GGCAGTTGCTGAATGTTTCTTATTGTCATCAACGAAAATTTCAATTTCAATTTCTCCTTCTTCAGTTGGA
ACAAATTCAAGAGTATAGTCTAGACTTTTTATAGATAAATCATAGATTGTATTTTCTTGAATTTTAGTGC
CATCAATTTTATAGTGCCCTTTATCATCAGCATTATATGAAAATGAAAAAACAGTACTATCGACTAAGTT
TTCAGGTAAAATGATTAATTCATTTTGAATTGTTTCAGATAGCAGAGCTTCATTAGTTCCAGTAACTGAA
ATTTGAAAAGGAAAGCTATCTATAATTGTACTTTCATCTTCACAAGCCAGTAAAAAAATAGAAAGCGTTG
CGATTAATAAAGTATTAAAATGATACTTTATTAAAATATTAAATTGTTTAAATAATAAATTCATAATTGT
AAAAGTTTAAGATTAAAAGTGATAGCGTATTCCGGCTCCGATAATGAACTTATGTAATGAAACATCGCTA
GTAGTAAAGAAGTTTGAATTGCGGAATACAGCAGATAGGTTATTGTTGATTTTGAAAAGAGAAAATATTC
CTGTATAACCACCATAGATTAGACCATCTTCGGTTTCTAGAATAGCACCGTTTGAGAGTTTGTCTTTTCC
GTCGTTTAGTAATTCAGCACCTACAGCTCCACCAATTGTAAATCTTGTAGTAATGGTGCTTGTTTTATTG
CTTAAAAAACTAAGCTGTTTAGTGTATCCTAAATTCAAAATAAAGACTTCTGAAGGTATTTCTAATTCTT
TGGCTAGTAAATCATTGTTGTCATAATACAATCCCATTTCAAGCCCCTTGTTTTTATCAGTATCTATTTC
AATACTGAAATTCGCTTGATAACCTAGACCTTCATTGTCTGTTATACCAATAATAGTTTCAAAGCTTGCA
TATGTGGTTTTCCTTGATTTTTCTTTTTTCATTAGCCTAAATGATCTAGTGCTATAGCTCTTTTGTAATA
GTTTTAATTCATTTTCGATTTGCTTATTTTGCATCTGCAGACGATTTAATTGGAAGTGAAGGGTTTCTTC
AGATTGCTTTTGTAATTCTGTTTCGTTTTGAGCAAATGCTCCCTGTGCCATAGCTATTACTGCTATGGAA
AAAAATAGTTTTTTCATAATAAAAATTTAAATGTTAAAGATTGAATTTCTTAGTTAGAGTAGGTGTTGTA
GTAGATTTTTTGAGTAAAAAATTTATGTCACTATAGACTTTTTCGTAAGCTCTTTGCTCATCAATATTTT
TTTGAGGTTGGATAGGAATGGGCTTAATTTTTTTTAAGTAGTGATTTCCATTCAATCGTTTGCCTTCAAT
AAGTCTTTCATTACCTTCAGCAATGATGGCAGTACACATACCTGCTTTATAATTAATAACTTTTTCACGT
CTTAAAATGTCTCTCTCGATACTTGAATAACTATGAGTTGGACCATCTAAACTTAAACCTCCTTGTTTTT
CTGAAATAGATGTTTTTTCGACTTCTCGTTTGCCTAATGTTTTTTGAAAATGATCTAAGGTTTCAGGGCT
TGTGGTTCTGAAAAGAAATTGAGAGCCCATGTTGGCTATAATTGAGCTAGCTTCCTCTTTTCCGTACTTT
AAAACTAGTTGACTAAAATCCTGTATGGCAATACAAGTAGCTATTTTGTTACTTCTTGCTGTCTCAGGGA
TATTGCTAAAATTTGGAATAGATAATACTGTAAATTCGTCAATAATTACAGCACTTTCGTGTTGGTCAGG
GATATTCATCTTTTTTAGAATTAGACCAATAATTGAACTATAAATAGGGCTATAGATATCTCGCTTTTGT
AAATTGAAGATTAAGTTTATTATACTTGGATTGTTTGGGTCGTTAGGTAATGGTAAATCAGTATCGGAAA
GTAGGTTTCTAAATATTCGCGGTACATCTAACGAAGCAAAAAAAGCAGTAAAAGTACTCATCATAGAGCC
TAAGAGTTTTTTGTCTCCTGAAACACTAGAAAGTACCTGTGCACTTCTTTTAGCTTCTTCGTCACTAAAA
ATCAGCTTGATAATTTGCTCAGGATTAGCAGTTAGAAATAATGCAATAATATGTGGGATACTACAGAATT
TTGGGTGCTTTTTTCTTAAGAAAAGAATTGTTCCAGTTAGTATACTTTTTGCAGAATTAAAGAAGTACTT
AGCTGCGTCGTTCTTTGGAATACCCACGATACCACTTAAAAAATAACTGCTGAATTCAATAATGTCTGAT
TTATCTTCACACAATGAAAGCACGTTAATAGTATTAAAATTGTTATCTAAACTAAAATTGATAATAGGTT
TTTCGTTTTGCTTAGCAATTCCATTTATTAGTGGTGTCAATTCTCCTTTTGGGTCAAAGGTTATACAGCC
TTTGTGTTTTACACAGTAAGAAAGTAATGGGTTTATGTACGAATACGTTTTTCCACTTCCTGCACCGCCT
ACGGCAATAGCTCCACGATTCAGATTATTTATTCTGTAGTGTTTTGAAAACCTACCGCTCTTTAAATAGA
ATGGAGGTGTTTTTGGTTTTAAAAAATCTAATTTCATCTTTCGTAAATTTGAGTGTGTTGCGGTTTGTCC
TTTTTCCAAAGTTGTTCGTGTTTGGTTTTACTGCCTGCTTCACCTCTTTGCATTCCATATTTTTCCATTA
ATTCAGCATAGCGTGTTTGTTGTTCGGCTAAGGATTTTCTTCCATTAATAAATTCTTTAGCACTTAATCT
TCCATCATTTGTGATTGGTACAATTACAGCATGTAAATGGGGTGTTGTTTCATCAAGATGTAAATGCATA
CTCAAAACATTTTCTTCGCCATATGTTTCAGATAGGAATGTTTTATTATCTTTCATCCAGCTTTGAACTA
AGTTTTCGTCACTAAAGATTTCAGCCATTTTTGCGTTATCAGAAGTCATGATATAGTCAATAGCTTTTAC
AGCATCTTTTCGAATGTTTTTTTGAATTTTATATCGTGATTTTATTTCATTTTGAATGCGGTCTTGAAAT
GGTGTTTTTTTACAATAATTAGCCCATTCTTTTTGTGTGTATGACTGCCCGTTTTTGTCCCAATGTATAT
TGTTTAAAATGGCTCTATCTTGAATATTTGACGGATAGCATAATTCTCCATCACTTGTGCATCGATCAAT
ATGATTGCCTAGTGATCCCGACAATGATTTTATTTTGTTAAGTCTTAAAATTGCATAGCTCATTTTGTAT
TATTTTTAATTTTACTATTAAACTATCTCCCCCTCGGAGAGCAAACTTCACCTTTCGGAGAAAGTGTAGT
TTGTTACACTTTACACAGGTTTGAAGTTTAGAAGTATCTATTATGGATAATTTGGCCTCCTTTTTTGGTA
TATAAAATGAAGTAATAAATAGCTATCCAGCCTAATGGAATATACCAGGCATAAAATATTTTATCCGTCT
CAAAATAGATCCGAAGGAGATCATGTTCGCCAAGAACAATTCCTTGTTTTTTATTGCTCATAGCAATAGA
ATAACAACTATAAATTATGAGCTGTAAAACCCCTAATAATGAGGTTTTATAAAAGGCGTCTTTCCAGTTG
TATTTTTTTTGGAATTTTAGGAACGAAAACAAGACTATATTACATAGTGAAATAGATAAATTTTTGAGGT
TAAAATCCAGGTTCCTTAAGAGGAAATAAAAAGCTTTTTTTCCTCTTAAATTTGTTTCTTTTAGACATTG
TAAAGATTCTGTTGTTAAAGATTCAGCGAACAGAAAAAATAAACCGCTGATTATTGCTATTGGAAAAAAT
AAGATCATTACATTTCTGACTAATAGCTGTAGGAGCTGTAATTTCATTCTTGATGGTATCATGTTTTGTT
TTTTAAGTTGAGTTTCTGATTTTTTAAAATCTACGATCATTTCCTGTTAAAGGAATAATATTGAACATTT
CATATAATCTACTTTTTACTTGAGGGGAGTATCTTTTTTCTAGTTTTTCAATGCTAAGATTTGTGGTAAC
AAAAGTTTTCTTTCCTAAATTTTTGAAATTGTTATATCTAATCTGTAAAATGCGATCGAAAAGTTCTTCT
TTAATTCCCCAAGCTTGTACTTGGTTTTCAGTGCCTAAATCATCAAAATGAATAGTGCCTCTGGAATATT
TTTCAATTACAGATTCACCACCATTTCCATACGCCTTACTTTCTTTGTTAAACTCAGTTATCACAGTATG
AACCGAAGTGTTTTTAAAATAGATTTGCTTTAAATCATACTTTAGGCTTATGCTTTGAATAATATCAAAT
ATTGAACTCTTTCCTGTTCCACACTCGCCATAAATTAAAAGCCCTTTTCTAAGCTCTCCATTTGTTATTT
TTTCAAATTCGATATCGTCCGAAAAGTATCGAGAGATGATATCTAAAAAGAGCTTATTTTCACTATCAAC
ATTGAAGTATCTCCCCTTTGAAGCAAAATATTTTTTGCCTTCTACCCAAATTTGTTTTTTTATCCACTGA
GTTGGAATTGGTGTTAATGGTCTAGGTTTGTTTTTTTCTTTCAGAGAATCAAAATATTGATTGCTTTTTT
TGGTTTCTTCTTTTTTGAGCTCAATTCTTTTTTTTCTTTCTTCCTCAGTTTCCAAACCCATTTGAATTTT
TGCCTGTTGCCCTAGAGAGTTTTTCATTTTTTTCTTGGATTAGCATTAATGAATTTTCTTTTTGAATTTT
TCTTTTTTAAATAATTATTAGATGTATTATTAATACTCGTATTATTATCATTCAAAATTTCTTGTATAGG
TCTATTCAAATTAATTTTACTAGGGTGGGAAAAAATTGTGATATACCTATGCAAAATTTCTTTACTACCA
TCAGCACGATAAATAAACCTTTCAATGTATCCGCATTCTTCCAATTGAAGAAGCCAGTTATTGATAGTTT
GTTTCGAAACTTGATAGAGTTCTTCAAAATATTTATTAGTAGACCAACAAATACGGTGATTATTAGTAAG
AGCGGTTATTTCGGCAAAAAGAATCTTTGCAGCCGGCGATAACCTTTTGTCGTATCTTATTTCTGCAGGG
AGTATTGCATAATAGTTTGGCTTGGATTTTTCCATAGTAAATGATTTTGTAAATACAGTATCTTTGTGCT
GTATTAATATGTTAGATGTTAATTAGAAAGTCTAAAAGAAGTGTCAGAAGCTATTTTAGACTTTTTTATT
TTCTAGATGCTTTTACAAGCTTTGAGTTTTTTCTTGCTTGAGTTAAAAGCTCTTTTTTAGAATAGAATAC
AGTCCTGCCTATTTTATAGTAGGGTATGAGTTCTTTCTTTTTCCATTTAATTAAGCATTGCACTGAAACT
CCAAGTAAGTCTGCTGCTTCTGTTTGGGTAAGTCTATCTTCTTCGGGATTAGCTGAGGATTCATCTATCA
GCTCAGTTTTTCTAAGGCGATTCACCACTAATTCTATAGTGTGTTCTAAGTCCTTTTTTGAAAAACCGTA
TAATATTGGATTACTCATGTTAATTGATTTTTAAATAATTCATAGTTAACTTTTGTTAACACATCAAAAC
TATTTTTAAAATCACATGATAAATTATCGTTTTTGAAAAGATAATTTTATTTGCTGATAATCAGATTTTT
ATATATTTAATTTTTTTTAAATAGATAATTCTTTCCAAGACATTGAGTAATTTAATAAAGTGTTTTTTTT
AGGATGGGTAGTGCTTTTATTGTAAATCTTTTTTAGCATAGGAATGGAAAGTTTAGTGTTAAAATAGCTA
TGTAGATTTCTTATAATTTGAATTTTCTTTGATTTTTTAAGAGCGTTTTTTTCGGAAAGAAATAAGAACA
TTTCCATAATTTTTTCAAGTTGATCCCTATTTAGGTCTAATCTTTCATGATTAAAACTTTGTTTTACAAA
TAGAAAATCAAAAAAATCGTTGCTGTTTATTGGAAGTAGAGTGCAATATTCCTCAAAGAATCGTTTAATA
AATTTTGATAGATTTTGTTTGCTAATTGTAGAGGTGTCAATATTGATTATTTGAGTCAGATAGTCTTGAT
TTGATTTTAAGTCTTCGTTTGATTGTAATTGAGTTAATAGTTCCCAAATTGTAGATTCTGTTAAATCAAG
CAAACTTTTATTTGTTATTTTTTTATTCTCCAAGGTTAAAAAATCATTAGCAATTGTGGGATGCATATAT
TTGCTAGAATGGTTTACTATGGGTTCTTTATACTTTTTCAGTAAAAATTTTCTATACTGTAATCCAGTAG
TAATTCCATATAGTATTTCTAAAATAGAATCTGGGTCTGTTTCTCCATTATTAAAATTATTTCCTGTTAA
ATAGATTTTACTTACGATTTTTTGTTGAATTCTAACATGGTAATTGTTGATTTCAAGATGATCTATGTTT
TCAGGTTGATGAAGCCAATTAAAAGCTTCTAGTGCTGAATCATCACCTTGGGAATAATTATAATTGGCTT
CATCTAGCATAAGTTTATCATATATCAGTAACTCATTAGTATGCGGATGTATTCTGCAATACTCTAAATC
AAAAAACAGGTTAAAATGTCCTGGAGTGAATGGTAATGATAGAAGATCGTTGTCTTCAGGCATACCTAAA
ATTGAACCTAACAGTTTAATTCTATCCAAAAAAGGCAGATTAGCTATCATACCTTTAACGAGATAAAATT
CGGGAGTTTCTTTTTCAGAGTTGGTATCTAACCATTCTAAACTAGTTACCATTTTTTTAATGTATTCTAT
ATTGTACATATTCAAATTTTATTCCAAGTATTATCCATTTCGTTTTTCTTAAAATCATCAGCAATTTCTA
CATAGCGTTTAAACGACGATTCATCTTTATGACCAGTAATATTGCGTACTACCATTTCTTTCATTCCAAG
AATTAAAGAGTTTGTCACAAAAGTTTTTCTAGCTGTATGACTAGTAATTAATTGATGTTTTGGAAACACT
TTATCAACTCTTTTTTGACCAATATATCGTGTAGTGTTTACAGGAGTATCAATGCCAACTATTTTGCAAC
ACTCTTTTATATACTGATTAAATTTTTGACCTGAGATTTTAGGTATAGGCTCGTAAAGAGTGTCTTTATA
CTTGTTTAAAATGGCTTTGGAAAAAGCATTTAAAGGTATTTTGTGGTCAATGGTCTTTGTTTTTTGAACA
TTAAGTTTTAGGTAATCTTCATAAATATTTGAAGGTTTAAGCTGTTTTATATCGCTAAATCTCAATCCTG
AAAAGCAACCTAAACAATAAAAGTCTTTAACGTGTTCCAGGCGTTTAGATTCAAACTCGTAATTATAGAG
TTTCATCAGTTCATCCATGGTTAAATAAATTACCTCGATTGTATTGCTTACGGTCTTAAATTTTTTGAAT
TCTAAATTTTCATGGTATTTTCTTTCGTAAGACCAATTCATGAAAGTTTTAAGCACTGATATTATTCTGC
CGTAATAATTATTGAGCGTGTTTCTTTCTTCAAAAGCGTAATCTCTAAAATCTTCGTAAAAATTAACGTC
AACATTGTCAAATCTTAAGTTATATTTTTTTGCTACATCAAAATCCTTTATGAAATTTTTACAGGATATA
TATTTTTTAATTGTACCGTTTGCCTTAGTTGATTTATTGGTGTCAATAAATTCTTGGAATGATTCAAAAA
AACTTGGAGCAATACTATTTGAATTTATGCTGTCGTTTTCAAGCTTGTCAATTACATATTCCTTAGTTAA
TGGAATGTTGTTTAGCAAGGCATGCCTATGAATTAGCTTAAGCTTGTTTTCAAGTTCATCAAGCTCCTTA
TTGAATTCAATATGGAAATTGTAATCTTCATTTTTAAGATTGGCTTTAACTCTTTGGTTTTTCCAGTCCT
TTTGCTTGGTTCTTACGCTCTTTACGTTCCTACGAATCCTTTCACCGTTTAGAGTGATAATCATACGAAC
AGGAATAAATCCGTCTTTGTTTATTTTATCTTTTCGTAATGTGAATGAAACTTGCATAAAATTTTAATTA
TTACCTGCTAAAAGCTATAAGTGCTAGTAAGGATAGATTAGCTAAACTGCTTGTTTTGTATAAGGTTGAA
TTTTATTAATGTCATCTTCTTTTTCAATTTGAGCTTTCCTAATTTCGTAGAAGGATTGTAAGTTTGACCA
AAATTCTGGGCTGTTTCCAAAAAATTTGCTTAATCTTAATGCCATTTCGCCACTTATACCCATTTCTTCA
CGTACAATTTTACCTACTCTAGAATCACTTACGCCAATACTTTTAGCCAATTTATAGGCTGTTATTCCCA
TGGGTTTTAAAAAATCCTCTCTAAGCATCTCTCCAGGGTGTACGTTCATTTGCTTTTCCATTTTTACATC
TTTTTAGTGATAATCTATAATTTCTACATCGTAAGCATTGTGATTATTCCACTTGAAAATAATTCGCCAT
TGCATATTTATACTAATTGAGTGATATTCTTTTAAATTTCCTTGTAACTGGTGTAATCTATTGCCAGGCG
GAATCGTAAGATCATTTAAATCTTTTGATGAATGAATTTGTACGAGCTTTCTAAAAGCTTTTTTTTGAAT
TGATGCATCTATCTTTTTAGATGAATGACCCGCAAACAATTTTTCTGTTTCTTTATCGCCAAACGATTTT
ATCATTTCAATTATATGTTAGTAAATATACACAACAAAAAGTTAGTAAACAACAAAAAGTTTGTATGTAA
TTTTTTTTGTAATGTTTCATTATATTTATTGAAGTTTAACTTAAGCCTTATTAATATTGATTGTTATTAA
TTAATTAGGGGGTTAAAAAGGGGGATAAAAACTATGTTTAATACATTAAATAGTATTAAACATAGTTTGT
GTAAACCCTTATGTGTTCAAATATAGGGAATTAAATGACATTAATAGGAGTTAAAAAAGTATGGTGGTTC
TAGTAGACCAACTTAAAAGGAGCTTTCATTTTTGAAAGCTCCTTTTTTTTGTTTATATGTGTAGGTTTTT
TTGGGTGGCCTATGTTGAGTAAGTTTTTGTCATATGTTAAGCTTATAGTTTGTAGGTGAGTATGGGGATT
TGGGTATGGTTAATAAGGTCTTCACTAATACTTCCGTTTATAAAGTGCGATAGGCCTTTTCTTTCGTGTA
CGTCAACACATATTAGATTGGCATTTATGTCGTTGCTAAAATTAAGTACGCCTCGTTCAATGGTAGTATC
GTTATATATGTGGAGGTTGTCTTTTTTAAATGGGGTTTTGCTTAGAAAAGCTTTCATTTCTTCTTCAATA
GCATGTGTTGTTTTGAAATTTCTAGGGGTGTTAATATATAGTAAGTGAATTTTAGCATTCACTTCTTCTG
AAAATTCGTGTAATGCATTAAGTGAACGAACTTCCTCATCTTTGAAATTACAGGCAAAAACAATGTTTTT
TACATTCTTTATGTTGGTGGGTTCTTTTACTACTAGAACAGGAGTGTTGGCAGTTCTAACAATTTTTTCT
GTATTTGATCCAACGAACAGATCAGAAAAAGCTTCTTTTCCGTGGGATCCAACAACAATGAAATCGATTT
CGTTGTCATTGCAGCTTTTTATAATTCCTTGAGGGATGGGTTGTGTGTTTACGTCTTCATGAGTTTTTAG
GCCTTCAAGTAATGGGGAATCAATAAGTTCTTTGAATTTAGAGTGAATGTTTTTCATGAATAAAATGGCT
TCGGGAAAATTGCCGTTAGAGCCAAGTATGGGGTCGTTAATGTGGGATGGAAGCTCCAGTAAATGAAGCA
AGTGAATGGTGCTATCGTTTTTTCTTGCGAGTTGCGCCGCAACCGATAGTGCGTTGTAGGCATCTGATGA
AAAATCAGTGGGTACTAGTATGTTTTTCATAACTAATTGATTTTTAATTGAATGTATCTAACAAGTTAAT
AAAAAATAATGAAAACTTCAAGCTTTTTATTTATTGAATATAATTAGCTATATTTGCACTGTTGAAAATG
AAAAACAAGGGTGAGGGGACGGGAAGTCCCCTCTTTTTATACTAAAAAATGTTCAAACAAAAAGTAGAGA
GCTTATTAGAAGAAGCTTTAGTTGAAAGGTCTAATTTGTTTTTAATTAGTTTCCAAATAACTGGAGCAAA
TATTATTCAAGTGATTCTTGATGGGGATGAAGGAGTGAGTGTTGATGATTGTATTGAGATAAGCAGGGCT
ATAGAGCATAATTTAGATCGAGAGGAAGAAGATTTTTCTCTACAAGTAATGTCAGCAGGAATTACAGAAG
GTTTAGTGCATATTAGGCAGTATCCTAAAAATATAGGACGAACTTTAAATGTAGTAACTGAAAAAGAAGA
AATAGAAGGGGAACTTATAGCTACAACAGCGGATGATTTTACACTTCAATGGAAAGCCAGAGAACCTAAG
CCGGTTGGTAAAGGGAAAGTAACTGTTCAAAAAACAAAGGTTATTCCTTATGGAGAAGTAAAAAAAGCGC
ACGTAGTCGTAAAATTTAATTAATACAGAGTATGGAAAACATTGCGCTAATAGACTCGTTTTCGGAGTTT
AAGGACGATAAGTCTATCGACCGAGTTACGTTAATGTCTATTCTAGAGGAAACCTTTAGAAGTGCCTTGA
AGAAAAAATATGGTTCAGATGATAATTTTGATATCATTGTAAATCCGGATAAAGGTGATTTGGAAATCTG
GCGTAATCGTATTGTTGTCGATGATGGTGAAGTTGAGGATGAAAATCAAGAAATTTCAATTTCTGAAGCG
CGTAAAATAGAGCCTGATTTTGAGGTGGGTGAAGATGTTTCTGAAGAGGTGAAATTGATAGATTTAGGGC
GTCGTTCAATTTTGGCATTGCGTCAAAATTTGATAGCTAAAATCCATGAGCATGATAATACAAACCTGTA
TAAGCAATTTAAAGAGCTTGAAGGGGAAATGTATACGGCAGAAGTGCATCATATTCGTCATAGAGCAGTA
ATATTATTGGATGATGATGGTAATGAAGTGATTCTTCCAAAAGAGAAGCAAATACCATCTGATTTTTTCC
GTAAAGGAGAAAACGTAAGAGGGGTGATTGAAAAGGTGGAGCTAAAAGGGAATAAGCCTTCAATTATAAT
GTCAAGAACAGCTCCTTCGTTTTTAGAAAAATTATTTGAATCAGAAATCCCTGAAGTTTTTGATGGGTTG
ATTACAATAAAAAATGTAGTACGTGCGCCAGGTGAAAAAGCAAAAGTAGCTGTGGATACTTACGATGATC
GTATAGATCCTGTAGGAGCATGTGTTGGAGTGAAAGGATCTCGTATTCACGGTATTGTTCGTGAATTAGG
GAACGAAAATATTGATGTCATTAATTATACAAATAATGTTCAGTTATATATTACTAGAGCATTGAGTCCT
GCAAAGGTAACTTCGGTTAAAATTAATGAAGAAACTAAGCGAGCAGAGGTAATGTTGAAGCCTGAAGAGG
TGTCGCGTGCCATTGGTCGAGGAGGGCATAATATTCGTTTAGCAGGAATGTTAACAGGGTATGAAATAGA
TGTATTTAGAGAGGGAGTTGAGGAAGATGTAGAATTAACTGAATTCTCAGATGAAATAGATGCATGGATT
ATTGAAGAGTTTTCAAAAATTGGTTTGGATACTGCTAAGAGTGTATTGGAGCAAGATGTGGCTGATCTTG
TAAAAAGAACGGACTTAGAAGAAGAAACCGTAAATGAGGTAATGCGTATTTTGAAATCGGAATTTGACGA
TTAAATAACAGACTTACCTTATAATAGTATTACATTAGATACAGAATAGAATAGGCATTTATGGCTGGAG
TTAACAACATGAGATTAAACAAGGTTTTGCGCGAATTTAATATTTCGTTAGACAGGGCTGTGGACTTTTT
AAGTGCAAAAGGTCACGAAATAGACGCGCGACCTACTACCAAGATTTCTGCGGAAATTTATCAGTTATTG
ACTGATGAATTTCAGGGAGATAAATCTAAAAAGGTGGCCTCAAAGGAAAAAGGGGAAGAAAAGCGCAAAG
AAAAGGAAGCGATCCGTATTCAAATTGAAACGGAGCAAGAAGAGAAGCGTAAAAAAGCACAATCCAATGA
GGTTGTTAAAGCGAAAGCAAAACTTGATGGACCCAAACAAGTTGGTAAAATTGAGTTAAACAAACCAAAC
CAAGAAGCTGCTCCAAAAACAAGTTCAAAGCCCGAACCTGTGACAGAAACTGAAAAAGAGGCTCCTGTAA
AAAAAGAAGTCCCTGTTAAAAAGGAGGTAGCTACTCCTAAGAAGGAGGTTGAAAAAGCTCCGGAAGAACC
ACAGGTAGTTTCAAATAGGCCTAAAAAGCAAGGGATAAAAATTACTGGTCAAGCACCAATTGCAAAACCA
GTAAAGCCTAAAGTTGCAAAAGTTGACGAAGAAAAAGCGAAGGCGGCACCGGCTGCCAAGCAAGCTGCTG
CTTCTCCAGCTGCGACATCTGGTCCTAAGCATGCCGAAGTTGGTGATGCACCATCTGAAAAGGTGAAAAC
ACAATATAAAAAACTTGATGGTCCTAATTTTACAGGTCAAAAAATTGATTTGTCTCAATTTAAAAAGCCT
GAAAAGAAGAAGGATGATAAGTCGTCTTCAAACGATGCGAATAAGCGAAAGCGAAAGCGTATAAGTAAAG
GGCCTAACCAAGGTCAAGGTGGAGGCCGTGGTGGTAATAACCGAGGTGGTGGTAAATTTCAACCACGTGG
AAAACGTGCGCCAATTGTTAAGGCAGAACCAACAGAAGAAGAAGTACAAAAGCAAGTACGTGAAACTCTT
GAAAAACTTCAAGGGAAATCAGGTAAAGGTAAAGGAGCTAAATACAGAAGAGATAAACGAGATCAACACC
GTCAAAAGACAGAGGAGGATCAAGCAGCTCAAGCAGCAGAAAGTAAAGTAATTAAGGTTACTGAATTTGT
TACTGCAAGTGAGGTGGCAACTATGATGGATGTGAGTGTTACTCAAATTATATCGGCATGTATGTCGCTT
GGAATGATGGTGACAATGAATCAGCGTTTAGATGCCGAGACATTAACTATTGTTGCAGATGAATTTGGAT
ATACAGTTGATTTTGTAACAGCTGATATAGAGCAAGCAATTGAAGAAGTTGTTGATGCACCAGAGGATTT
ATTAGAAAGAGCGCCTATTGTTACGGTAATGGGACATGTTGATCATGGTAAAACATCGCTTTTAGATTAC
ATTCGTAAAGAGAATGTAATTGCTGGAGAGAGTGGAGGAATTACACAGCATATTGGAGCCTACGGGGTGC
AGTTGGATAGTGGTCAAAAAATTGCCTTTTTAGATACTCCGGGTCACGAAGCCTTTACGGCGATGCGTGC
ACGTGGGGCTCAGGTGACTGATATTGCTATTATTGTAATTGCAGCGGATGATGATATTATGCCTCAAACA
AAAGAAGCAATTAGTCATGCGCAAGCTGCTGGAGTGCCTATCATATTTGCAATTAACAAGGTAGATAAGG
AAACGGCTAATCCAGATAATATAAAGACAAAATTAGCGGCAATGAACTTGCTAGTTGAAGAGTGGGGTGG
TAAAATCCAATCTCATGATATTTCAGCTAAAACAGGTTTAGGTGTTAAGGAGTTGTTGGAAAAAGTATTG
CTAGAGGCTGAATTATTAGAGTTAAAAGCAAATCCAAATAGAATAGCAACTGGAACAGTTGTTGAAGCCT
TTTTGGATAAAGGACGTGGATATGTATCTACAGTATTGGTACAGTCGGGTACATTAAAAGTTGGTGATTA
CTTGTTAGCTGGTAAAAACAGTGGTAAGGTAAAAGCAATGCAGGATGAGCGCGGTAATCGTGTTTTGGAA
GCTGGACCTTCAACGCCAGTATCTGTTCTTGGATTAGATGGAGCGCCTCAAGCGGGTGATAAGTTTAATG
TGATGGATGATGAGCGTGAGGCTAAGGATATTGCTTCAAAAAGAGCGCAGTTACACCGTGAGCAATCTGT
ACGTACACAGCGTCATATTACACTTGATGAAATTGGTCGTCGAATTGCACTTGGAGACTTTAAGGAGTTA
AATATTATTCTTAAAGGTGATGTGGATGGTTCAGTTGAGGCATTAACAGATTCATTCCAGAAGTTATCTA
CCGACGAAATTCATGTGAATATTATTCATAAAGCGGTAGGAGCAATTACAGAAAGTGATGTATTATTAGC
TTCGGCATCTGATGCAATTATTATTGGATTTAATGTACGACCAGCAGGTAATGCACGTATGGTTGCTGAC
AAGGAAGAAATTGATATCAGAATGTATTCAATCATTTATGATGCGATAAATGACTTGAAAGATGCTATGG
AGGGAATGCTTTCGCCAGAAATGAAAGAAGAAATTACTGGTACAGCAGAAATTCGTCAAACATTCAAGAT
TTCAAAAGTTGGTACAATTGCAGGTTGTATGGTGCTTACTGGTAAAATCTTTAGAAATAATCAGATACGC
TTAATTCGTGAAAGTGTAGTGATCTACACTGGTGAATTAGCAGCCTTGAAACGTTTTAAAGATGATGTTA
AGGAAGTGGCTAAAGGATACGATTGTGGTATGCAAGTCAAGAATTATAATGATATTAAAGAAGGTGATAT
TATTGAAGCTTTCCAAGAAGTGGCTGTGAAAAAGAAGTTGAAATAACAATTTTACAGTAAAATAAGTATA
AACCGAAATCACATTAATGTGGTTTCGGTTTTTTTTTTTTTTTTGCAAGTCAAAGACAGGGCAGTACGAT
AGTGATGAGTCAGTTGATGCTTGAAGGTAGAGGGAAATAGCTTTAGTTATTGTTTCATTTTTTAACGCAT
GAATTGTAAAAAAGAAACAAGATATATGTGAAATATTTATTCGCAAATCCTATAATTTATTGTTCAAGGG
CTAGGGTGTAGTATATATGTGGTGTTCTTATTTGTATCTTAATATTAGCCAATATTTTGACGCAACCTTT
CTTCTGATTATTCATCTTATTGAGGTGAAGTCTAATTTAGGTATTCTGGTATTGAATAATGAAGAATTTT
AAATGAAAACACAACATCAATATAAACTAAATATAAAAAATGAAAAAAATCAATCTATTACCCTTGGTAT
TACTAGCCTTGTTGCTTTCAAATTGCTCTAATGATGATGATAATTCCAATTCAAAAGAAATGGATTTTAG
TGGGGATTGGATAGGAACAAAGTTTCTGGTTAATGAAGCTTATGATTTTAATAATGATGGAATTCCAAGT
AGGGATTATAAGATAGAGTTGCCGTGTTTAATTCAAAATATAACTCTTAATCCAGATGGAACAGGTTTGT
TTAAAGCTAATATTCATGGACAGGCAGAAGGGCAGACAACTCCTTTTCCTTTAACTTGTGTTGAGTACGA
AGAGAATCCCATGACTTGGTCTTTAAATGAGGAAGAAACAAAAATACTGCTTAGGTTTTCTGAAACAGTT
GTTGAGGAATTTCCAATTGTTAGTGAAGTTGTAATAGAGCGGTTTTCTGAATCGTTATTAGATGATACGA
TCGGTATTCCTGGAAAAGTAGTTTATGAAAAACAAACTAAATGATAGAGGAGAAAACAGCTGAGTTTTTA
AGTTGAATGCAAAAAAAAATACCATAATTAGATATTCTAATTGTGGTATTTTGGTTTCTATACTTGTGAT
TTTATAGGGATTTATTTCTCGGGTTTAAAAATAAAAGCATGGGGGAAATTTTTGCTTATTTTCATTAGGG
CTCTATCTGCTTCTAATCTTGTTTGGAAATTGCCTACCCAGACTTTGTAGTTGGGAGTTTCGTATTCTAT
TTTTCCAGGCCAATCGGTAAATTTTGTGTTGAAATTGCTTAAAACAGCGTGTGCTTTATTCAGGTTCCCG
TAGTACAATTGTATTTTGTAATTGTCTTTATTGTTTTCAGAAAATTTAGTTTTGACTAATTTTTCAATAT
TTGGATCAACATTTATGTTAATTGTGGCGGGGCTATTGGTTTCAGAATTAGCGTTGTCAGAGCTATTTTG
AGCTTGACTTGCTATGCTTAATAGTAAAAAAAGGAATGAAAAAAAATTAAATCTGTCTTTCATTGGGTTG
TAATTTATGATGTATACAAATGTAAAAGAAAAGCTTATACTCTTATAGGAAATCTTTATTTAGAATTTTT
ATAAATTAGGTTTTAAGCTTTGGCTAACATTTTGCGAACCGACTTTATGTAGTACTTTTGCTCTGCAAAT
TTATGCATGCTTTTTTGTGATTAATAACTACAGAATTCATGCCAAAAATTAGATGATAACTCTATAATTT
AATATGAGACAGGTAAAACACCGAAATTCGGTTTCTAAACTACTTCTTTTAGGTCTTGCGTTTCTACTTA
CGTTTTCGACAACAACAACTGCTTTCGCTCAAGCCGATGCGGGAAAAGGTAAAGAGTTGTTTAATTCATT
ATGTGCAGCTTGCCACAAACGTTACAAAAAAGCAACAGGTCCAGCGCTATTTGGTGTTACGGAGCGTCAT
AGTACGGAGTGGCTTTATAAATGGATAAAAAATAGTACTGCTTTGATTGCTTCGGGAGACGCTGAAGCTA
TTGAGATTTATGAGCAATACAATAAGACGCCAATGAATTCATTTCCGCAATTATCAAATGCGGATATTGA
TAATATATTAGCTTATGTAATGGAGCCAAAAGCAGCTCCTGCTCCAGGTGCAGTTCCTGTGGGTGGAGCT
CAGAAAGCAACAGATGACTCGGGTTCAGGTTCTGTGAATTCTTGGGTTTTAGGTTTGTTGGCTGTTGTGT
TGCTTGTTTTGGTAGGGGTGTTGTTTATGGTGAACAAAACATTGCGTCAATTTGCGAAAGCTAACAATAT
TGACTTGCCAGTTAAAGAAGAAAGAAAGCCAATTTGGAAAGCTTTTATTGAGAATCAATTTCTATTATTG
GTTTCTGCGGTATTTTTACTTTTGCTAAGTGGCTATTTTGTGTATGGGTATTTGATGCAGGTTGGCGTTG
ATCAAGGGTATGAGCCGGTGCAGCCAATTCATTATTCGCATAGGATTCACGCGGGTGATAATAAGATAGA
TTGTAAGTACTGTCACTCGTCTGCTAGAGTATCTAAGCACTCAGGTATACCTTCGTTAAATGTATGTATG
AACTGTCATAAGTCAATTGGCGAGGTTGCTGAGGCGACACAAGCAGAAGGATTGGCTGAGTATGGAGTGG
ATTATAACAAACAGATTCAGAAGTTGTATAAAGCTGTGGGTTGGGATGCGGATAAGCAAGCTTACACAGG
TAAAACAGAACCTGTAAAGTGGGTGCGTATCCATAACTTGCCAGATTTTGCATATTTTAATCACTCGCAG
CACGTAATGGTAGCTGGAGTTGCATGTCAAAAATGTCATGGTCCTGTGGAGGAAATGGAGATTATGTATC
AGCATGCGCCATTAACTATGGGTTGGTGTATAAACTGTCATAGAGAGACTAATGTAAAGGTGGAAGGAAA
TGCTTATTATGAAAAAATTCATGAGGAGCTTTCGAAAAAGTATGGTGTGGATAAGCTTACGGCTGCTCAA
ATGGGTGGTTTAGAGTGTGGAAAGTGTCACTATTAAGAAGGTTTTTATTCTTGCCGAGAAGTCGGTCTAC
TCTTGAGATTGTATTGAGAGTTGGAAACTTTAAAAATAATTTAAGAAGCAAATAAGTTATATATATGTCA
TCAAACAAGAAATACTGGAAAAGTGTTGAGGAGCTAAGTGATAGCTCTATGGTTGAGGCGCTCAAGCAAA
ATGAGTTTTCTGAGGATATTCCTGTAGAGGAGTTTTTGGGAGATAAAGAAATGCTTGATGAATCTTCTAC
ATCACGTAGAGATTTTTTGAAGTATGTTGGGTTTAGTACTGCTGCTGCTACATTAGCGGCATGTGAAGGC
CCAGTTGTAAAAGCTATTCCTTATGTAGTGCAACCGGAGCAAATTGTTCCTGGGGTTGCTAACTATTATG
CAACTACTATTGCAGATGGATTTGATTTTGCAAATGTACTTGTGAAAACTCGAGAAGGTAGGCCAATTAA
AATTGAAAGCAATCGTTTAGCGGGTGCAAATGGAGCGGCTAATGCACGTGTGCATGCTTCGGTATTGTCA
ATGTATGATAATACGCGTTTAAAAACTCCTCAAATTGGTGGTAAATCTACTGATTGGGCTAAGTTTGATA
AACAATTAGCATCAAAGTTGAGTGGGGTTTCTGGTAAAATTGTGTTATTGACACAGACTTTTGCTAGTCC
TTCAACGGATAAATTAATTGGTGAATTTGCTTCTAAATATCCAAATGTTTCTCATGTAATTTATGATTCA
GTTTCTAATTCTGAAGCCTTAGCTGCTTATGAGCAGGTGTATGGTGTTCGTGGATTAGCTGATTATGACT
TTGAAAAAGCGTCAACTATAGTAAGTGTTGGTGCTGATTTTGTGGGTGATTGGCAAGGTGGAGGATATGA
TGCTGGATATGCAAAAGGACGTGTTCCTCAGCATGGAAAAATGTCACGTCACGTACAGTTTGAAGCTAAT
ATGACATTGTCTGGAGCAAATGCTGATAAGCGTATTCCGACTACGCCATCACAACAGAAGCAAGTATTGG
CTGCGTTGTATGGGTATGTAATGGGGTATGCTGTAAATGCAAGCTTACCAGCTCCAATAAATGAAGCGGC
TAAAAAAGCGGCACAACAATTAAAAGCTGCTGGTAGTAAAGCAGTGGTTGTTACGGGTATTCAAGATAAA
GATGCACAAGTAATTGCTTTAGCAATTAATAATAAATTAGGGAGTAAAGTATTTAATGCTGAGCGACCTA
AATTAACCAGTCAAGGTGATGCTGCTAAGGTAAACGCTTTGGTTGCGGATATGAATGCTGGTAAAATTGG
AGCATTATTAATAGCAGGAGTGAATCCTGTGTATTCATTACCAAATTCAAAGGAGTTTGTTAGTGGATTA
AAAAAGGTAGGGGTGACAGTTTCTTTTGCTTCAAGTAATGATGAAACTGCCGCTTTATGTGAATTTGTTG
CAACAACTCCACATTATTTAGAATCATGGGGTGATGTTGAAATCAATAAGGGGGTGTATAGTTTGGTGCA
ACCTACTATTAGACCTTTATTTAAAACACGCCAATTTCAGGATACATTATTGCAATTAATTGGTTCTGGT
TTGACGTATGACGCGTACATGAAAAATGTATGGAAGTCTTCTATTTTAGGTGGAGCTTCGTTTAATAAAG
CCTTGCATGATGGTGTGTTTAAAACAGCTGTTGTGTCTAGTGTTGCCGCTGAAGGTGATGTTGAAGAAGG
TGCAGAGGCAGCTGCTTTTACAAGTTCGTTTGCTACATCTGTTAGAAGTTTAACTTCAGCGAAAGCGAAA
GGTTTAGAGCTTACATTATATACAAAAACAGCTATGGGTAGTGGTAATCAAGCTGTTAACCCTTGGTTGC
AAGAATTGCCAGATCCATTAACAAGAGCTTCTTGGGATAACTACTTAACAGTTTCTAAGGCTGATGCAGC
AAGCTTAGGTTTGGAAAACAAAAATGTAGCTAACGGAGCATTAAATGGTAGTTATGCTACAGTAACTGTT
GGTGGTGCTACCTTAGAAAATGTACCAGTGATCATTCAGCCAGGTCAAGCTAAAGGATCTGTAGGTTTGG
CCTTGGGGTACGGAAGAAAGCAAGGATTAAAAGAAGAGATGCAAGTTGGGGTGAATGCTTTTTCATTGTA
TCAAAACTTTAATAATGTACAATCGGTTAAGGTTGATAAAGCTGGAGGAGAGCATGAATTTGCTTGTGTA
CAGTTGCAAAAAACATTAATGGGTCGTGGTGATATTATAAAAGAAACGACTTTAGAGATATTTAATACTA
AAGATAAGCCAGTTTATAATCCGACTCCAATGGTTTCATTGGATCATGAGGAAACACCAGTAACTTCTCC
AGATGTGGATTTATGGGATGAGTTTGATCGAACAATTGGTCATCACTTTAATTTATCTATAGATTTAAAT
GCATGTACAGGTTGTGGGGCGTGTGTAGTAGCATGTCATGCAGAAAATAATGTGCCTGTTGTTGGTAAGT
CTGAGGTACGTAGGTCTCGTGATATGCACTGGTTGCGTATTGATAGGTATTATTCTTCGGAAGAAACATT
TGAAGGGGATAACGAAACTAAAGATGGATTTGATGGTTTAGGTGATAGTTTATCTGGATTTGGAGAGCTT
GAAGTAGCTTCAGAGAATCCTCAGGTAGCTTTTCAGCCTGTAATGTGTCAGCATTGTAATCATGCACCAT
GTGAAACAGTTTGTCCAGTAGCGGCAACTTCTCATGGTAAGCAAGGTCAAAATCATATGGCATATAACCG
TTGTGTAGGTACACGTTATTGTGCAAACAACTGTCCTTATAAAGTGCGTCGTTTTAACTGGTTCTTGTAT
AACCAAAATGACGAGTTTGATTTCCATATGAATAATGATTTAGGTCGTATGGTGGTTAATCCAGATGTAA
CAGTGCGTTCTCGTGGGGTAATGGAAAAATGTTCAATGTGTATGCAAATGACGCAGAAGACTATTTTAGA
TGCTAAGCGTGATGGACGTGTCATTAAGGATGGTGAATTCCAGACTGCATGTTCAAATGCATGTGTTAGT
GGCGCTATTACATTCGGAGATATTAATGATAAGTCAAGTAAAGTGGCAAAATCATTAGAAGGAGATCGTA
TGTATCACTTGTTAGAGCATGTTGGAACAAAACCAAATGTGCAGTATCAAGTAAAAGTACGTAACACAAA
AGAAGCTTAATTAATTAACAAAGAAACTAATAGATAGTATATTATGTCTCATTACGAAGCACCTATACGA
AGACCTCTTGTAACAGGCGATAAAAGTTACCACGATGTAACTTTGGACGTTGTCGCGCCTGTGGAAGGAA
AAGCAAATAAACAATGGTGGATTGTGTTTTCAATTGCCTTTGTAGCTTTTGCATGGGGATTGGGTTGTAT
GACCTATACCATTTCAACTGGAATTGGTACTTGGGGATTAAATAAAACAGTAGGATGGGCCTGGGATATT
ACCAACTTTGTATGGTGGGTAGGTATCGGACACGCAGGAACATTAATTTCAGCAGTATTATTATTATTCC
GTCAAAAATGGCGTATGGCAATTAACCGTTCTGCGGAGGCTATGACCATATTTTCGGTAATGCAAGCAGG
TTTATTTCCAATTATACACATGGGGCGTCCATGGTTAGCATATTGGGTATTACCGATACCTAACCAATTT
GGTTCGTTATGGGTAAACTTTAACTCGCCATTACTTTGGGATGTATTTGCAATTTCAACTTACCTTTCGG
TTTCATTAGTATTTTGGTGGACTGGTTTGTTACCTGATTTTGCAATGATACGTGATAGAGCGGTAACACC
ATTTACAAAACAGATTTATAGCGTACTTTCTTTTGGTTGGTCTGGTCGTGCTAAAGACTGGCAACGTTTT
GAAGAAGTATCATTGGTATTGGCAGGTTTAGCAACTCCATTAGTACTTTCTGTACATACCATTGTATCCT
TTGACTTTGCTACATCGGTGATTCCAGGTTGGCATACGACAATTTTCCCTCCTTACTTTGTGGCAGGGGC
GATTTTCTCAGGTTTTGCCATGGTAAATACCTTACTTATAATCATGCGTAAGGTGTGTAACTTAGAAAAT
TATATCACACTTCAACATATCGAGTTAATGAATATCGTTATTATGTTAACGGGATCTATTGTGGGTGTGG
CATATATTACTGAGCTTTTTGTAGCATGGTATTCTGGAGTAGAGTATGAGCAGTATGCTTTCTTAAACAG
AGCAACTGGACCTTACTGGTGGGCATACTGGTCAATGATGACTTGTAATGTGTTTTCACCTCAATTTATG
TGGTTTCCTAAGTTGAGAAGAAGTATTATGTTTTCTTTCTTTATATCAATTGTGGTAAACATAGGAATGT
GGTTTGAGCGTTTTGTGATTATTGTAACATCACTACACCGTGATTATTTACCATCATCATGGACTATGTT
TTCACCTACATTTGTTGATATCGGAATATTTATTGGTACCATTGGTTTCTTCTTTGTGTTATTCTTGTTG
TACTCGCGTACATTCCCTGTAATTGCTCAAGCGGAAGTGAAATCGATACTTAAATCTTCAGGTGAGAAGT
ATAAGAAATTAAGAGAGGCCGGAAAGCCTACTTATGAAAGAGCTGAAGGAATTGTTGAATTATTAGCGGA
TAGTCAAGACGACCATCACTAAACTATAAAAGTAACTATAGATGGCTTCAAAAGTTGTTCATGCCTATTA
CCTTGATGACGAGGTACTGATGGATGCAGTAAAAGCATTAAAAATTAAGCACTACCACATTGAAGAGGTG
TTTACACCTTTTCCAGTGCACGGATTAGATAAATTGATGGGCTTGCCACACACACGTTTGGCTATATGCT
CTTTTTTATATGGATTAGTTGGTTTAACTGTAGCCGTTACCATGATGAATTACATCATGATTGAAGACTG
GCCACAGGATATCGGAGGGAAACCAAGTTTTAGTTATATCGAAAACTTGCCTTCGTTTATTCCAATTATG
TTTGAGCTTACGGTATTTTTTGCAGCTCACTTAATGGTAATAACATTTTACATGAGAAGTAAATTGTGGC
CATTTAAAAAAGCTGAAAACCCAGATGAGCGTACTACTGATGATCATTTTTTAGTAGAGGTTGATGCAAG
TCATACAAATGTCGATGAGTTAACAGCATTTTTGAAGGATACTGGTGCTGTAGAAATTAATTTAAAAGAT
AAGGAGTAGCTTTATGAGAACATTAATTAATTCACTATTTGCGTTTGCAGCTGTTGCATTGGTTACTTCT
TGTAATAGTAAGAAAAAGCCAAACTATCAGTATTTTCCAAATATGTATGAGTCTGTAGGCTATGAAGCTT
ATAGTTCTCACGAAGTATTTGCCGATAATAATACATCCGAAGCTTTGTTACCTGTCGAAGGTACAGTTAA
AAGAGGATGGTTGCCATATGACTATACAAATTCTCCAGCAGGTTATGCGTCTGCTAAAGCAGGATTGAAA
AATCCACTGCCTTACACCAAGGAGAATGCAGCTAAAGGAAAAGCATTATATGATATTTACTGTGCTATTT
GTCATGGTGGTAAAGGAAACGGAAAAGGAACTTTAGTAAAAAGAGAAAAAATATTGGGGGTACCTAGTTA
TGATGACCCAGGACGTAATATAACTGCTGGTAGTATATATCATGTAATGTATTATGGTATCAACTCTATG
GGGTCATATGCTGCTCAAACAAGCATTGAAGAGCGTTGGCAAATTGCTCAGTATGTGGAGTCTTTAAAAG
CTTCATTAGAGGGTAAAAAACCAAGAATAGATAAAGTTTCTGGTAGTAAATCAGATGTTTCAATAGTTGA
CGCTTTATTAGCTAATACAGAAGGATATTATAGTTCCGATGTAGAGTTTGAAGGTGAATTTGATGAGCAT
TCAGAGATTAAAGAAGATGTAAAAGATAAAGTTTCTTATAGTAAGAAAGATCTATTGGGAGGTAAATCAC
ATCATTCACACAAAGAAGCTGGTAAAAAATAATTAAGCACGATTAACGATTTTTTTAAGATATGTATACG
TTATCAAAAAATTTAAAATTAATTCCTATCATATTGATGGTTGTAGGAGCTATTGGGTTAGCTATAGGTT
TTACTACTACACCTAGTACAATAGAGGAAGTAAAAGAGCAATTAGCAAGTCATCATGATGCTCATGGAGC
AGCTCATGCACCTGCAGCAGCTCACGGAGCTCATGACAAAGCAGAACATGGGCATGGTCACGACACTCAT
AAAGCAGCAGATACGCATGGTGCACACGCTGCTAAATCTCATGATGCGCATGATAGCGATAAACATTATG
AACATGTATTGCATCAATTACAGAATAAGCCTTGGGCTGCATTATATGTAGCAGCTTTCTTTTTCTTTAT
GATTGCATTAGGGGTATTAGCATTTTATGCGATTCAATTTGCTGCCCAAGCTGGTTGGTCACCATTGTTA
TTAAGAGTAATGGAAGGTATTACTGCTTACTTATTACCTGGAGGGATTATACTATTTGTGATTCTAGCAT
TGTCTGGTTTCCATATGAATCACTTGTTTGTTTGGATGGATCCAGAAGTTGTTGCTCATGATGAGCTAAT
ACAAGGGAAATCGGGATGGTTAAATGTACCTTTCTTTTTAATTAGAGCAGCTATTTACATTGGAGTGTGG
AGTTTATATCGTCACTTTGCAGTAAAGTATTCTCGTAATCAAGATGAAAGTCCAGAAGGGAATGTATGGT
ACAAAAAGAGTTTTAAATTAGCAGCCGTATTTTTGGTATTCTTTATTTATTCAGAATCAATGATGTCATG
GGATTGGATTATGAGTTTTGATCCTCACTGGTTTAGTACATTGTTTGGATGGTATGTGTTTGCAAGTTTA
TTTGTAAGTGGAATTACTGTAATTGCATTAGTTACTATTTATTTGAAATCTAAAGGATATTTAGAGCAGG
TAAATGATAGTCATATTCACGATTTAGCTAAATTCATGTTTGGTATTAGTGTATTTTGGACGTATTTATG
GTTTTCTCAATTTATGTTAATATGGTACTCAAACATACCTGAAGAGGTAACGTATTTTATAACACGTATA
AATGACTTTAAATTACCATTCTTTGGTATGTTAATAATGAATTTCTTATTCCCAATATTATTATTAATCA
ATTCAGATTACAAAAGAATCAATTGGTTAGTAGTTATGGGAGGAATTGTAATATTATTAGGTCACTATAT
TGATGTGTTTAATATGGTAATGCCTGCTACAGTTGGTAAATCATGGTTTATTGGAATTTCTGAAATAAGT
GCAGTATTATTATTTTTAGGAATTTTCATTTACGTTGTGTTTAATGCACTAACAAAAGCACCATTAGTAC
CTAAAGGGAATCCATTACTTGAAGAGAGTAAACATTTCCATTATTAATAGAATTTAGACATTAAATTAAG
ATAGATTACAATGACGATTTTTTTAATCTTACTAGTAGTAGCCCTTTTGGGTATCACTTTTTGGCAACTT
TCTAAAATATTAGAATTGTCTCAAGGATCAGCCGATAATTCACAAGTGGCTAATGATAAAGACAATTCCA
TGCAAGGAAAGCTCATGCTTGCATTTGTAGGTTTTTTATATTTTTTGACAGTTTGGTGTTTTGTAAAGTA
CGATAGTTATTTTTTACCTGAAGCTGCCTCTGAGCACGGAACAGATTATGATAGATTAATGATGATCTCG
GTAGTGTTGATCATGTTTGTTCAAATCATTACACAAGGTTTATTACACTTTTTTGCTTATAAATACCGTG
GAAAAAAAGAAAATAAAGCTACCTTTTTTGCAGATAGTAATTTACTTGAGATTATTTGGACAGCTATTCC
AATTGTTACATTAGCAGCATTAATTATCTACGGATTGTATACATGGGTAGATATTATGAGTATTGATGAT
GATGAAGATGCTTTAGTAGTTGAATTATATGCTTATCAGTTTGACTGGAGAGCACGTTATGCTGGAGCGG
ATAATGAATTGGGAAAAGCAAATGTCCGTTTTATTGAGGGCGTAAATATTTTAGGTGTAGATGCTTCTGA
TAACTATGCTCAAGATGATATTATTGTTAATGAATTGCATTTACCAGTAGGTAAAAAAGTGATTTTTAAG
ATGAGATCTCAGGATGTATTGCATTCAGCTTACATGCCTTTCTTTAGAGCACAAATGAATGTGGTACCAG
GAATGATTACTGAGTTTTCATATACGCCTACAAAAACTACTGAAGAAATGAGAACTTCTGAGTTTATGGT
AGAAAAAGTTGAAACAATTAATACAATCAGAAAAGCTAAGAGTAAAGATTTGTTAGCTAAAGGTGAAGAA
GCATTAGAGCCTTATGAATTTGATTACTATTTATTGTGTAATAAAATTTGTGGAGCATCGCACTTTAATA
TGCAAATGAAGATTATCGTTGAATCTGAAGAAGATTATAATAATTGGATAGCAGAACAAAAAACATTCAG
ACAAGTAGTTTCTAAATAAACATAGGAGCAATTTAACAAGAGAAGTATAATTTTATAATTTGTTCGATAT
ATAGTATCAATAATTTATAAGATATTTATAATAGAAAACATACAAAAGGTTTTAAATTATGTCAGCAGAC
GGACACGGACATCACAAAGAAACATTCATCACTAAGTATATTTTTAGTGAAGACCATAAAATGATTTCAA
AGCAGTATTTAATTACTGGTTTGCTTATGGGTATTATAGGTATTGCAATGTCGATATTATTCAGAATGCA
AATTGCATGGCCTGAACAATCTTTTGCAATTTTTGAGGTATTGTTAGGGAAATGGGCTCCTGATGGAGTG
ATGGATCCTAATGTATATTTAGCTTTAGTAACAATTCATGGTACCATTATGGTATTCTTTGTACTTACAG
CAGGATTGAGTGGTACATTTAGTAACCTATTAATTCCATTGCAAATTGGAGCACGTGATATGGCTTCAGG
TTTTTTAAACATGGTGTCTTATTGGTTATTCTTTTTGAGTAGCATTATCATGGTCTTTTCTTTATTTGTA
GAGGCTGGGCCAGCAGCTGCAGGTTGGACAATATATCCTCCATTAAGTGCTTTACCACAAGCAATGCCAG
GATCTGGAATGGGAATGACATTATGGTTAGTGTCTATGGCAATATTTATTGCTTCTTCATTATTAGGATC
TTTAAATTATGTAGTAACTGTAATTAATTTACGTACAAAAGGAATGTCAATGACGCGTATGCCTTTAACA
ATTTGGGCATTCTTTGTTACTGCAATTATCGGTATTGTTTCTTTCCCAGTATTATTATCGGCAGCATTGT
TATTAATTATGGATAGAGGTTTTGGTACTTCATTCTATTTAAGTGATATTTTTATTAAAGGTGAAGTGTT
ACATAATCAAGGGGGGTCACCAGTATTGTTTGAACACTTATTTTGGTTCTTAGGTCACCCTGAAGTATAC
ATTGTATTATTACCAGCTTTAGGTATAACTTCTGAAATTATTGCGACAAATTCTCGTAAACCAATTTTTG
GTTACCGTGCCATGGTAGGATCAATCATTGCGATTGCTTTCTTATCTACAATTGTATGGGGTCATCATAT
GTTTGTATCTGGAATGAATCCATTCCTAGGATCGGTATTTACATTTACAACATTATTAATTGCAATACCA
TCTGCTGTAAAATCATTTAACTATATTACTACATTATGGAAAGGTAATTTACAGTTTAATCCAGGTATGT
TATTTTCAATAGGTTTAGTATCTACATTTATAACAGGAGGTTTAACAGGAATTATTTTAGGAGATAGTAC
ATTAGATATTAACGTGCATGATACTTATTTTGTAGTTGCACACTTCCACTTAGTAATGGGGATATCTGCA
TTGTATGGTTTATTCGCAGGGGTTTACCATTGGTTCCCAAAAATGTACGGTCGTATGATGAATAAGAACT
TAGGATATGTACACTTTTGGGTAACGGCTATAGGTGCTTATGGAGTTTTCTTTCCAATGCATTTTGTAGG
AATGGCTGGATTACCTCGTAGATATTATACGTATACTAATTTCCCATACTTTGATGATTTAGCTGATACC
AATGTTTTGATTACTGTTTTTGCAATCATAACTGCAGCAGCTCAATTGGTTTTCTTGTATAACTTTATAT
CATCAATTTTTTATGGTAAAAAAGCAACACAAAACCCATGGAAATCAAATACCTTAGAATGGACTACACC
AGTTGAGCATGTACACGGTAACTGGCCCGGTGAACTGCCAACTGTGTATCGTTGGGCATATGATTACAGT
AAAACAAATGCTGATGGTGAGTATGTAATAGCAGGTCAGGATTATGCGCCTCAAGTAGTTCCTTTACAGG
AAAACGAAGAAGAATTGCATCACTAGGATGTACTTATATATTGAAAGCCCTCTTTTAGAGGGCTTTTTTT
GTTTTTGTTAATTCCTTATTTATGAAGTTTACCTATTTTTATAATCTACATTAGATACAGTTATTTTGAA
TAGTAATTTAGACGCAACGGGAGAGAATTTTACTCCACAAGAACATGATATTGAAAGAGCTTTACGTCCA
TTAAGCTTTGGTGACTTTGCGGGACAATCTCAAGTACTCGAAAACTTAGAGATATTTGTAAAAGCCGCTA
ATATGAGAGGGGAGTCTTTGGATCATACGTTGTTTCATGGACCTCCAGGATTAGGAAAAACAACACTTGC
TCATATATTGGCAAATGAGCTTGGAGTGGGCATTAAAATTACTTCGGGTCCTGTATTGGATAAACCGGGT
GATTTGGCAGGATTGTTAACTAATTTAGAGCCCAGAGATGTGTTATTTATTGATGAGATTCATCGTTTAA
GTCCCGTAGTAGAAGAGTATCTTTATTCGGCAATGGAGGATTTTAAGATTGATATCATGATAGAAAGTGG
CCCTAATGCTAGAACAGTTCAAATTCATTTAGATGAGTTTACTTTAATTGGTGCTACTACACGTTCCGGG
TTGTTAACTTCTCCTATGAGAGCACGTTTTGGAATTCAGTCCAGATTACAGTATTATACTACTGAATTAT
TGGCAGGAATTGTAGAACGAAGTGCTTCGATATTAAATGTACCTATTGATGAACGAGCTGCATTCGAAAT
TGCAGGTCGTAGTAGAGGAACACCTAGGATAGCTAATGCATTATTGCGTAGGGTACGTGATTTTGCCCAA
ATTAAAGGGAATGGATCTATTGATATTGAAATATCTAGATTTGCGCTTAAAGCGCTTAATGTAGATGCTC
ATGGTTTGGATGAAATGGATAATAAGATTTTAACCACACTTATTGATAAGTTTAAAGGTGGACCTGTTGG
AATCACTACACTGGCTACCGCAGTTAGTGAAAGTGCCGAAACTATTGAAGAGGTTTATGAGCCTTTTCTA
ATTCAGCAAGGTTTTATTATGCGTACACCTCGTGGAAGGGAAGTAACGGAATTAGCCTATACACATTTAG
GAAAGACAAGAGGTTCTGTTCAAGGGGGCTTGTTTTAACTAGTATGTTTAAAGCATTAAAAGTAGGGTGT
AAAAGTAAGACACCCTATTTTTAATGCTTTAAACTAGTTTTAAAGTTTAATTAGCTGAGTAGTAAATAGA
CCTTTATTAGTTTGAATTTTTACAAAATAAGTATTAGGAAATAAATAGCTTATGTTCATTGTGCGCATAA
TTCCCGGGAAAAATCCTACTATATTACCATTAATATCATATAGGGTAATTGTAGTAGGTTTTATATTTGT
ATCCAATAACTCAAGGTTTATTATGCCTGTTGTGGGATTAGGAGTTAAAGAAAAGTAATCGGAAAATGTA
GGGACTTCAATAACTTCTCTTTTCACTGTTACAATTTCATCTTCGGTGATTACAGGAGGATTAAAATCAA
AATAAATACCAGCCCCATTAACAATTTGATCACCTTCAACTAAGTTATCTTTTGATTTAATTTTAAATAG
CACATAACCATCATTATTAGCATCATCAAAAGGGAGGTTAATATTGTTGAAATGGAAATTTACAACCTTA
TTATTAGTCACAGTAGTAGTAAATAAATGACTAGAATTTAAAGGGCTAAAAGATTTAATGTCAAGTTTTG
TGGTATCAATATCATCCTGAACTCTAATGTTAACCGCTTCAGCTGTTCCTTTGTTTTCAAAACGAATTAA
ATAATGTAAATACTCACCTACATCATCAGGGTCTAATATGTCCCCTTCAAGACAAGTTTTATCATTAGGA
TCGTATGAGTTAACAACAGTTTGAGTTAGTTTAGCGATGTTATTTTCTGGAGTTTCTTCATCTAGAGATG
CTGTTACTTTAGCTGTATAATTGAGTATATCTCCATTGTTTAAAGCAGGACTATCAGTAGGAGTGTTTAA
CCTATAAGTAACAATAATATCTTTGGATTGCATAGGAGCAAGGTTTGTGAAACTCCAAGTTAATAAGCCA
TTAGTATTACTATCTATTGTTGGGCTTGCTGTTGAGTAGGTTAACACGTCATTTTGATATGTCAAAGTTA
CCTCTCCCGACTGAGTTGTTGTACCAATATTTTTATAAGTTACTTTGTATATGGCACTAAAACCAGGTCT
AGCTCTTGTAAGTGGAATAATAGAAATTTCAAGGTCATTAAAAACACCTACAGGTTGAATACAAAAATCA
GTAGTAATAGAATCAATTTGTTCAGGAATATTGAAAGAATCATTTATTGGATCAAAAATGATAGTAGGAA
AAAAAGTAAAATAAGCCGAATTAGCTATGTTGTTAAACATTAAATAATTATTTCCATCAGGGACGTGAAA
AGTGTATTCTCCTTCTCTATCAGGGAAAACAGTATAAAAGCCTGCTGGTCCAGCCAATGAAAAGCTAACA
CTTTCGGTAAAAGCTTCATCTTGGTTATCACAGCCATCACTTTCATTATCGTAAGTGACACTACCAGAAA
TTCTATTGTGAGGGGTTTCACAATCGTTTGATAATAACACATCAGTTTGATTAGCTTCTTTTAAGAGCTC
ATATATAGCGCTTAAATATTGTTGATCAGCACAAATGAATTCTAAGTTTTGTCGATTATTATATAGTCTG
ATATTAATTTCACCATTTGCTCTAAATTGAAAAGGTTGTCCTGTCATATAAACTTTTTTTAAGTTTCTGT
TAGAGTCAAAATGAAAATTCAGAAGTTGGCATTTGCGTACATCAATTGTTTCTAATAAGTTACTATTTAA
ATGTAAGTACTGAATTTTAGTGTTTTCTGAAAGATTAATAGTATTTATTTTGTTGTTATTAAGATATAAA
TAAATTAGTTCTTTGTTATTAGTAACATTAATAGTTGATATTTGGTTTTGTCCCGCAGATATAAGTTCTA
ATAAAGTATTGTTGTTTACGTTTAGTTCTGTTATTTGGTTGATTCCAATATTTAATCGCTCTAACTTTGG
ATTGTTTGTAATGTTAATGTTAGTCAATTGATTATTTCTAACATATAGTGTTTTTAGTTCTGGATTCTGT
GAAACATCTAATTCAGTAATAATATTATTGCTTAAAAATAAACTTTCGAGTTTTGAATTATTTGATACAT
CTATTTGAGAAAAATTATTACTAAATAACGATAGATTTTTCAATAAGATGTTTTTAGATAAATTTATAAC
ACTCAAATTGGCTTCGTGTGCAGCCAGTTCTTCTAATTTTACATTTTTAGTAATATCAATAGAAGAAATT
TGGGTTATAGAAATAATTAATTCTTTTAAATTAATATTTTGGCTAACATCTAAGTTGGTAATAGGGTTTT
TACCTATATTAAATTTTTGTAATAGTTTATTGTTCGAAATATCAATTTCTTGAATATTATTACTAAACAG
AGAGAGTTCTTCTAACTTAGTAAAGTTCTCTATTCCTTTAACGCTAGTTAAGTTTTTTAGATTTAAATTG
ATTCTTTTTATATAGCTAGCTTCTTGCGAGTCAATTTGTCCATCATTATTCCTATCTAATGAATACCATG
TACCATTATCATTATAGGTGATTTCTAATAGCGCAGCTTTAAAGTTAGGATCAGGGAAATCAATAATTTG
TGCATTTCCGGTAGTAAATAAGCATACTGTCATGCTCAAAAATAAAAGTAAATTTTTCATAAGAATTTAG
TTATTAAAATAGATTTAAGTTTAAGTGAAGATACCTTTGATTTGTAAATGTTTAGTTATCAATATGTTAA
ATGTTGTTGTGTTGAGTTACAAAGATTTGTTAATTCAAGGTTTGAATGAATTTAGAGTAGAGAAAAAATG
ATGGTTATGGTGTTATATAGGAAAGCAAATTAAAGAAAAACAAAAGTTAGATTGTTTTATATCAAAATAG
AGTGGAGTTAGTTTAGAATAGTAAAAGGAAATTACATATGTAAATTGATTTTAATGTGGATAGGCTTAGA
TGTGTTAATATTTTATTGAAAAACTAGTTTTTGATTAGGTGAGTTTGTTGTAAAATTTAAAACATTTACT
AGATATTTATCATTTTGTATAGAGCTTAAAAAGCAGAATTTATATTTATTCTTTTGTAAAGAAATATTTC
CTGAACCATATAACAAGTACAAAAAAATAGGAACTATAACATACTAAATACCCAATGGCAGCACCTTCGT
ATCCGTAATTGTTTATAAAATAAATACTAGAAAAATACCATATTACCGCAGATAATATTTCGGTAAAAAC
GTAACTTTTCGTCATTTTTTTTGCCATAAATTGATAAGCAAGTACCGAGGATAAAATTCTAAAAAAATCA
CCTGTTAATTGCCAAGAAAATAACCGTTGCATAGGTAAAAATTCTGATGTCAATAGGAGCTTAATAAAAA
AGACTCTAAAGAAATAGAGTATAAGCAGTCCTATAATTACTAGTGGCATTAATGTTTTATAAAAGCTAAA
AATTTCTTGTTTAAATTGTTTTGTAGTTTTTACAGCCGATAGTTTAGGAAATAAATATAAACTGAGTAAT
GAAGTAACAAATACTAAATAATAATTAGAAATTCGATTCATAGCTTCCCAATAACCCATTTGGGTTAAGC
CTTCAACATCTACAATATGATTTCTGATAGCAATAATAGTTGGAGGAATAATAACAGCGGTTAACAATGC
CATTAAACTGTATTCTATTAGCTTTTTAGAGTAGTCCCAACTTATATTAGATGCTTTTAAAAGTTGTACG
AAGCTTTTTTGCTTAAATATGATGATCAAAGTAATAAATAATGCAAGGGCAGGGGTGATTACTATAGCAT
AAAGCATTCCCTCTAGTCTGTATTGCCATAGTAAAATAACAGTTACAATTAGACTAAAAACTGTCGTTGT
AATATTGAGTATGGTATATACTTTATAACGGGAAAAACCATTTATAATAGCCAAACAAAAATAGTCGACA
ATCATTAATGAAATTCCTGCAGCTAATATTTTGATAACATGTGCATAATCCGAAGAATTTAATACATAAC
TACTCCAAAATGGCGCAAAAAAATATAAAATCATAGATGTGCCTAACATGGCTATAAAGCCTAAATAATA
GCTAGTAGATAAGATTTTACTTAATTCTTTGATATTATTTTTATGTTCTGCAACATATTTAACAACGCCG
TTATAAAAACCTAATGAAGCGATGGTTTGAATACTATTTATAAAACTACGAAGGTTACCAATAATGCCTA
AACCTTGTGGTCCTATAAAAATAGCAATAGCTTTTGATAAAATAAAGCCTGTAACTAAACGGACAAGAAC
GGCAATCGAATTGATTGACATTACTTTTAGTAATTGTTTATTAGGAGTGTAATTTTTTATTCCTGGCATG
TATAATTGTTTAATACCTGAATAATATAATCAATTTCTGACACCTCTAAAATTGGATTTAGTGGAATGCT
AACTATTTCGTTACTTATTTTTTCGGTTATGGGAAATGATTGATTTTTAAATTCATTTGTAAGTGCCTTT
TGTTTATGAGGAGGAATTGGGTAATGAATCATATGACCTATTTGGTTTTCATTTAAATAGTTGCAAAAAT
TAATTCTATTTTTTACCCTTATAACATAAACATAAAAAACATGATTTTTACTACCATTCCAAAATGGCAA
TTTTATGTTTTCATTTGTTATTTCATTTGAATATCTAAGGGCAATTTCTCTACGTTTGTTATTGTCATCA
TCTAATAAATTTAATTTTTCAATTAAAAAGGCAGCCTGAAGTTCATCCAAACGAGAATTGATCCCGATTA
ATTCATTTCTATATTTTTCCGATGTACCGTAGTTCCTTAATTTTTTTATACAATTAGCTAATTCGGTGTT
ATTGGTAGTAATAGCGCCACCATCACCTAAAGCACCAAGGTTTTTTGAAGGATAAAAGCTAAAAGCAGCT
GCATGAGCAATGCTTCCCGCTTTATTTCCATTTTGATCAATAGCTCCGTGTGCTTGAGCGGCATCGGCAA
TTAAAAGTAATTGCGCATTTGAGCAAAATTCTTTCAATTCATCCATTCCATAAACTTGACCGTACAAATG
GGTTGTAATTATTGCCTTAATTTTAGGGGTGATTTTTTGTTGCACATTCCTCACATTAATAATAAAAGAG
TCTTCATCTGGTTCAATTAAAACAGGAATGAGTCCCGCTTGTTTTACAGAAAGTAGGGTTGCAATAAATG
TGTTTGCGGGTACAATTACTTGATCACCTATATTTAATTTCCCTAGTTCGATATAAGCTTTTAATATGAG
CGTAAGTGCGTCTAATCCATTGCCCGTACCAATACAGAAAGAAACATTACAATAACTAGCAAAAGCATTT
TCAAATTCAGTTAGTTTAGTGCCTAAAATATAATGTCCACTAGTTAAGAATGTATCAAATTGTGATTTGA
AATTGTTTTCAAATCGTTTGTTGAGTTTGTGTAGATTTAAAAAAGGTATTCTCATTTAGTAAATGAATAA
AGAAATTATCAACTATTTTTTGAATAGTTTTTTTTCAATTATTTGATGTGAAAATTCAGATATTTTATGT
TCAAAATGTGTACTATCAATAATTACTTTAAATTCAGAACTAGGGCTTAACTTTTTAACTTTTTCTTCAA
CAAAAGAAGCATAGCTTTTATACATATAGCCTGAGCAGCATTTCGGGTCGTATAAATTCAAAATTTGATA
CTGTTTTCTGTTTTCTCCTAGACACGATAAAATATACATATCTAGATAATTTACTTTTTTAAATAAAGCG
CTATGGGCTCCTTCGAAATGGCCATAATTTAAATAAGGATCTTGAAATCGAATATACATTGGATAAGTTC
CAGCAACGGGAAAACTATTTTTTATTCGTTCATCTATTGCGGCAGCTATGGTAGTTGCCCATCCTCCTCC
ACTAATACCAATCATATTAATCTCATTGTACCCTTTTGATTCAAGTATATCTAAAATGTTAATAATCGGA
TTGATAAAAAAACTAATAGGATCATCTAGATGTTCCATAAATTTGTGGTTATTTAAAACTACATTACCAA
ATTTTTTTAAATAAATGCTGGGAGTATTATTAAAGCCTACCAAAGGTAAATCAAGTGCTGCTACTGTGAA
ACCTTGTTTAACTAAAAAATGAATAGTTTTTTTTCCTAACAAAAAATTTCCTCTATGACCTTGATGATAG
ATAAAAGATTTGCCATTACTTTTTTTTGGATAAAAAATATAAGCTATTGAATTTATATGATATGATTGTT
CAATATAGACTTTATCAATGTTTGCTAAATTTTCTAAATTATTATAATCTTTGTCAAAAATGTTTTTTTT
GATCTTATATGATGAAGTTTTATTACCAAAAATAGTTTTTCTTAGTTCAGCTCTTATTTCGGTATAATTA
TCTTTTGTAACGGATAATATACTATCTAAGTTTGGAACGTGTAAGTCTGTAACATCGTATGCATTTTTTT
TTAGAATTTTTAATTTAATATTCTGATTTATATTTCTTAATTGGTTGTAAGGAAATAATTTATATTGAGT
GATGATCATACCTAAAAAAATAGATATAGGCACAATTAAAGATATATGTAAAATACTAAATTTAAACTTC
ATTAGTTTGGTCTATTGAAAGTTGATAAAAATCTTGAAGATACTGATTACAACCCAATTCTTCTTTTTGT
TTTAATAAGCTTATATTTCCAGCTATAATACCCATATCGAAAAACTTATATCCTTCACTTTTATATTTTT
TTATTAAATAGATAAAGAGAAATTCTAAAGCCCTTAGCTTTTCTCCATCGTTAGTTGTTGCTCCATATTG
AGACTTTACAACGGTATCTGTTTTAAAAATAGTAATTCCAGCTAGTAATTTATTTTCTAAAAAAATATTA
AACTGTTTGATGTTATTAGGGAATTTACTTTTTAAAAATAATATTTCGCTTTCTGTATGAACAGGTTTAG
CATTGTGTTTTGTTTTTAGTCTAGGTTTTAAAATTTCCTCCCAAAAGTCAGTAAAATTATCTGTTTCTAT
AATCTTAAAATTTAAGTGTTGATTTTTCTTATAATTTTTAAGTTTAGTTTTATGTATTTCAAATGGCAAG
TTATAGTCAATGGCAAAATTTTGCTCCCTTCTAAAAATTTTAGCTCCAAGCTTGAGGAATAATGATTCTA
ATTCAAAACTAGGCGCTTTATGATAAAATACAGGAAGTGTTTTTATCCGAATTGTTGAAAATTGATTCCT
TTTCAAATATTCTATAATAGTCAAAAAAATAGTTTCAACTTTTGTTACACCAATACTTTTTAAAAGTAGT
AATCCTCCATAAGTAAGCCCTTGGTGGGAATAGAAAGTAGTATCATTTTTATTCGCAGGAACTAAAGCAA
CAATAGTTTGTTTTCTTAATACAAGTAAAGAATGATCTTCAAAACGATCATTATGATACTCCATAAAATC
TCGATGGAATAAAAAAGTGCTGTTTTTACTATTTTCAATAAAAGTATTCCAGCTTTGATAATGTGTTTTA
TTGTATTTTTTTACGGTATATTGTTGAATCATTTTTTGGAATAAATAATTTTAGATATTCTTTACGAGAA
TAGTATTTTTTAATATAAAATAATCTAATGCATAACTATATTATATATAATTTAGCCAATATAGAAAAAT
ATTAGTACGATTTACCGTTGATATGAGCAGAATTATCACAGTAAATTTTTACTGTGATAAATTAAAATTT
GATAAGGCTGCTCCATGTTTAAAGTTATGATTAAAAAAATTACATTCCTTTTTTATATACTCTTTTTTAT
TTTTAATGTTGTTGTAGTTATTGACAAAGGTTATGTGTTTACTTATGATACTGCTAGTTATTTGTATATC
CGTCCCAATGTACAGCCTGCGTACTCCATTTTTCTAAATATAGTGAAGCGTATATTTGGAATAAATTATA
AGGAAGCAACTATTGGTATTCAATTGCTGATGTCTTATTTGACAATGCTATACTTTAGTGAGGTGTTAAA
AAAATATTTTAAGTTTAATTCAGTAGTTATGATTTTATTATTCATGCTTTTAACATACCCTATTTATGGT
TCGTATGGCATGTGTAATAAGTTGGTCACTAAATCATTGTCAACTACTTTTTTTCTTTTTTTTATGGCTT
CTTCTGTAAAATGGTTTTTTACAAAGAAGAACAAGCATATTTTTTTTATGATTACTTTTTTAGTTCTTTT
ACAATTAACAAGGGCGCAATTTTTAAGTATTTCAATAGCATTGGTTTTGTTTGTCTTTTACATGTGGAGT
TTAAAAGAACTTAAAAAAAAGATGATTTTAGTTGTCTTAATATTGAGTATTCCTCTTATTTCAGGTTTAT
TAGAAAAGACAATTTATGGAGTGTTTCATGGGCATTACACTTCTAGGCAGTTAGGTAATGTGAGTATAAG
TACATTGCCTTTTTATTTGTCTGAATTACAGGATTATAAATTGATGCCTGATGAAGAGGTAGTACAATAT
TTTAGATGTGTACATGGCTCTTTAGAAGAAAAGAAATTATTATTATGTCAATTACCCAAAAATTCCTCTT
TAAAAGAAAAGCACCAATTTTATCATGATAATTATCCTAAAATAATGAATCAAACCATAGAGTATGAGGC
CAAGTCTATGTACAGAGGTAAAGAGATGAGTTATGCAGCATCCTATAAAAATGTTGATAGAATTGTAGGA
AAAACTCTTATCCCATTATTTATGGCTAGGCCTTTAGCATGGAGTGAAATGTTTTATATGAATTTAGCGT
TCCCTTATTATTCAATTATCCCCGTTATTTTTCTTATTCTATTGGTGAGCTATCTTTTTTTTAAAAAGAA
GTCTAAAATATTACAATTCCAAGGATTAATATATTTCTTTTCATTATTGATTCTAGGTAATTTATTTCTT
ATTAGCATATCGTTGCATTGTATACGAAGGTATTTTATGTATTACGATATTGTATTTGCTCTTTTGGCTT
TATTGCTATTATGTAATTTTAGACCCATCAAAAAATATATTATGCAGGTATAGTAATTAAAAAAAATGAA
AAAAGAGGTTCGAACAATTGTTCGAACCTCTTTTTTGTGAATGTATAAATTGTAGTTTATATTTTTTCTA
AAGTAACAATAATTTGTCCTTTTGGGTTAGTAGTTGTAAATCCATTTAAATCAAAACCTTCTTCTATTAT
CGAAATAAAGCTAGTTTGTGCGATGTCTAGTTTATACTGAATTTCGTTTTTAGTAAATTTAATGATTTCA
GCTTTTGAGCCAGCTATAACGGAATCCCCTTCGCTAATAGACCAATCGTTTAGTGTCGAAGTGCCCCCTA
AAATTTTGCTTGATTCAAACGTATCTTCGCGAGTTGTAGGCTGGTTTATCATTAAAGGTGTTACAAAGTT
TGTATTTGCTTTAAAAGTACCATCAAATGTTACTTTATTAGGAGTAGTTTCAAATAAAGCAGTGGTGTTA
AATTCAGAACCTTCAGTGGTAAAAGGAATTTCTATAGTTGTTTCGTCAACTTTTAAGTCGACAGTACCAT
TACTAACTTCAAAATTTGTAAGTTTCCATTTTCCAACTAGGTTTTCATCAACTAGGTCTATTACGGGTTT
AATTGGTGCTCCGGCATCATCCCCAGAGCAAGAAACTATAAATAGGGTAACTAGGGTTAATAAAGAGCTA
AAAAAAAGATTTTTCATAAGTTAAAGTTTAGGAAAGTAAAAAGGTATCATATTCTATGAATATAACACCT
TTTTATTGTTTTTATTATTTTTTAAATGAATTAAGCTATTTTGTTGCGCTTACGTTCATTTTCTGTTAAA
TATATTTTTCTTAATCTTAGGTAATTAGGTGTTACTTCAACATATTCATCTTTCTGTATAAATTCTAAAG
CTTCTTCTAAAGAGAATTTAATTGCAGGAACAATTTTAGCTTTGTCATCTGCTCCAGAAGAACGGACATT
AGATAATTTTTTTGTTTTTGTAATATTTACAGTCATATCATCACCTCGAGAATTTTCTCCAATAACTTGA
CCTTCGTAAATATCTTCACCTGGATCAACAAAGAAACGACCTCTGTCCTGTAATTTATCAATAGAATAAG
GAATTGCTTTTCCTAATTCCATAGAAACTAATGATCCGTTTTGACGTTCTGGAATACCGCCTCGCATTGG
TTGGTATTCAGTAAATCTATGTGCCATAATAGCTTCTCCGGCAGTGGCAGTTAATAATTGATTACGCAAA
CCAATAATACCTCTTGAAGGAATAATAAATTCACAAATCATACGGTCACCTTTAGTTTCCATACTAAGGA
GTTCTCCTTTTCTAAGCGTAACCATTTCAACAGCTTTACCTGATACGTTTTCTGGTAAGTCAATAGTTAA
CTCCTCAACAGGTTCGCATTTAACACCATCAATTTCCTTAATGATTACTTGTGGCTGACCTATTTGTAGT
TCGTAACCTTCTCTACGCATAGTTTCTATAAGTACAGAAAGGTGTAATACTCCACGTCCGAAAACTAAAA
ATTTATCGGCACTATCGGTTTCATTTACACGTAAAGCAAGATTTTTTTCAAGCTCTTTTGTTAAACGATC
TTTAATATGGCGTGATGTTACAAATTTTCCATCTTTTCCAAAGAAGGGAGAGTCATTAATGGTAAATAAC
ATACTCATAGTTGGTTCATCAATGGCAATAGTTTTTAAAGCCTCAGGGTTTTCTATGTCAGCAACGGTAT
CACCAATATCAAAACCTTCTAAACCTACTAATGCGCAAATATCACCTACTTGAACCTCAGAAACTTTTTT
ACGGCCTAAACCTTCAAAACTATGAAGTTCTTTAATTTTTGATTTTAAAATAGAACCATCCCTTTTTACT
AAAGATACTTGCTGTCCTTCAACTAAGCTACCTCTTTGTAAACGTCCAATAGCTATACGACCAGTAAACG
AAGAGAAGTCTAATGAAGTAATAAGCAATTGAGTGGTCCCTTCATCAAATTTTGGTGCAGGAATATGTTC
CAAAACCATATCTAATAATGGTTCTATGTTTTCAGTTTGGTTTTTCCAATCGGTACTCATCCAATTGTTT
TTAGCAGAACCATAAACCGTTGGGAAATCTAATTGCCATTCTTCTGCGCCAAGCTCAAACATTAAATCAA
ATACCTTTTCATGGACTTCATCGGGAGTACAATTTTCCTTGTCCACTTTGTTTACAACTACGCATGGTTT
TAAACCAAGATCAATAGCTTTTTGCAATACAAAACGAGTCTGAGGCATTGGTCCTTCAAAAGCATCAACA
AGTAATAAAACCCCATCGGCCATGTTTAATACACGCTCAACTTCACCACCAAAATCGGCGTGACCCGGAG
TGTCGATAATGTTAATTTTTGTTCCTTTATAAGTAACCGAAACGTTTTTAGACGTAATGGTAATACCACG
TTCACGTTCTAAATCATTATTGTCAAGAATTAAATCTCCTGTGTTTTCGTTTTCACGAAACAATTGACAG
TGATACATGATTTTATCAACCAAGGTGGTTTTTCCGTGGTCAACGTGTGCAATAATGGCTATGTTTTTAA
TCGTATTACTCATAAAAGCTAATTTATTGATACTAAAATTTGGCGCAAAGGTACGTTTATTTGGTTAATT
ACTGTGTAGTGAAGTGTTTTTGTTGTCTTCTTCTTTATTTAAATAAGGATTTTACAAATAAGAATAGTAT
TTAAATTAAAAAATCTAAACAATTTTTAGTTGGAAATGAAGGGCATTTCTGTAGACTGATTACCCTGATT
TAGGTGAGTGCAGTTGCACAGAATACTGTTTTATAATGTTGGTATAGTTTTTTAATTAAATTACTTTTGT
GTAAACTGAAATAAAATGCAACTAAACAATATTCCTAAAATAAAAAATTTAGATAGTAATAATTTTTTTT
TACTAGCTGGTCCATGTGCGATAGAAGGGGAAGAAATGGCGCTTAGAATTGCTGAAAAAGTAGTTCAAAT
AACATCGGATTTAAATATTCCTTATGTGTTTAAAGGCTCTTTTAAAAAAGCAAATCGTAGTCGTGTAGAT
AGTTTTACCGGAATAGGTGATGAAAAAGCCTTGAAAATTTTAAGGAAAGTATCAGAAACATTTGATGTTC
CTACAGTGACAGATATTCATACTAATGAGGATGCTGCTAAGGCGGCAGAATATGTGGATGTGTTGCAAAT
TCCTGCTTTTTTAGTGCGTCAAACAGATTTAGTGGTAGCAGCAGCAAAAACTGGAAAAACGGTAAATCTA
AAAAAAGGACAATTTATGAGTCCTGAAGCTATGCAACATGCGATCAGAAAAGTGCACGATAGTGGTAATG
ATAATGCTATGATTACAGATCGAGGTACGATGTTTGGATATCAGGATATGGTAGTAGATTTTAGAGGGAT
ACCTACCATGAAACAGTATGGAACTACGGTGTTAGATGTTACACATTCATTGCAACAACCCAATCAATCA
AGTGGAGTAACTGGAGGAAGGCCAGATATGATTGAAACCATTGCTAGAGCTGGAATTGCAACAGGAGTAG
ATGGTTTGTTTATCGAAACTCATTTTGACCCTTCAAAAGCAAAAAGTGATGGTGCTAATATGTTGCACTT
AGATTATTTGAAAAATTTACTAACTAATTTAGTGGCTATTAGGCAAACTATAAATAGTTTGTAAATTGGA
GTTAGTCTAAACTCCATGCTTTTAGGTATTTTTTTGCTACTTCGGTACATTCGTGATGTTGCTCAATAAA
TTTTCGAGCTCTTTTCGAAATAGCTAACATTTTATCAGGGTTTTCAATAAGCTCTGATAATTTGTTTACT
AAATAATCTACATTAGGCCTAGCTTCAACTAATGGCATGGTTGCTTCAGTGAGGTTGTAATAATTTTTAA
AATCCTCATTAGCTCCGCTAACTACGACTTTCCCTTTAGCCATAGCTTCTCTACCATTATAGCCTTGATC
GTAACTCAAACATTGGTCTAGTAGAATATGGGATTCATTATACACTTTCATATACTCGTTATAGGGTAAA
TTTCGAGTAATTTTTACAGTTACTTTGCTTGGGTATTTTTGTTTAATAATATCAAGCGCATCTAAAAAAT
AGGGAATTCCTTTGGCCAGTTGATTAGTAGTATTAATGCCACAAAAAATATTGATTTTATTACTCAAGTC
TAAAGCTGTAAATTTTAGTTTTGATAGATCAATAGGGGTAGGGATCATGTTTAGGGCCTTAGGAGTGCCT
TTGTAAACAATTTCATAATCAATATCGCTTGGTATTATCCCTTTAATATGGTTTAATAAATAATTGAAAT
GGTTTACATGATTTGTTTCAAGATATTTTAAGGCATATTGAAATTCTTTTTTTAAGCTCTTATCTTTTAT
GTAAGGAGTTAAACTAGAAAAACTTATATGCTTGTTAAGCATATAATCTACCCATGGAGTTTCCATACTA
CCTCCATGTAAATAGATGTTTTTATTATATGCTGTAATACTATTAAATAATACTTTTTCAGTTTTAGGAG
TTCCTAAAAAAGCGATGCTATTTATAAATTGAATAGCGTCGTACTTTTCAAGTAATGGAACTGTTTTTTT
AAATTGATTTCTTAATTCAAGCATTGAAAGATCAATTTTAAAAAATGTATAAAACCCATTTTTTATAAAA
TTTAATAAACGGTTTTTTTTAAAATATTTGATGCCTAAATTAATATCTACAGGATAATTTTTAAATCCAT
CTCCATGAGCAATAATAGTAACTTCGTGACCTAAATTTGTAAGGCCTTTTTTTAATGAATTATGGAAACC
ACTGTATTCTCCAACTAAAAGTATCTTCATTAATCTTCTTTTTTATCAAAACGGAGTTCTAAAGCAATTC
TTGTAACATCGGTATTTTTATTGATAGCAGCACCGTGAATTAAAAATGGAGAAAAAATTAAAGCTTCATT
TTTTTTGGGATTTGGTCTAAACATTTTGAAAGGACCATTTGTTGTTTTGATAATACAAGGAACATAGTAT
TGATTACCATTTATATATGCCCCCTTAGCTTTGGTGCGAATAATTTGATCTTCAGGAATAAGGTGGCTTC
CTTCAATTACAGGTAGGGAAGAGTGTTCATTGCAACCTGCAATAGGAATCCAAATATTTAAAATATTCTT
CCAATAATCAAGGTAGCCATCTCTATGGGGAGGATTGATGTCTAAGCTATTTGGGCGACTTATTCGTATT
TGAATATGAGAGCTTTGTAATTGTTTAATATATGGGGTTAGTTTTGTATTTGTGTGTTTACTAAATTTTA
AAGCTAATTTTTCAAAATCAAGATCGAAATCTTCATTTCTTAAGTTTTTGGTGTGATTAATTACCTTTAA
ATGATTCTCTTGATTGGTTATATATTTATGGTAATCTCCAATGTTAAAATCGTTTTCAGTAACGGTTATA
CCTGCTAATTTGATCCCTTTTAATATATTTTTTTTAATTGAATTACTTAATAATTTAAATTCGATATCAG
AAAAAGCAGAAATTATTTTAAACCCTTCAGATTCCCATTCAGTATTTTCTAAAATATTGCCTTGAGATTG
ATAAAGCACTTCTGGCTTTCCTTTAAAAAATGATCCAGAAACATTAAATGAAAATGGCTCATTATCAATT
AAAAGAGCGCAAGTGTGTTTTTCTAGTGAATTATCCAAAATTAAAATAACTAAGTTGGTTTGTGTTGAAA
ATAATAAATTGAAATATTATTCGATATATTAGTGCAAAATACTAATAATTTACATTAATGATATCATCCA
AAATGAATAAGCTAAACGTAGCAGTCATTGTTATTTCATTATCAAGAGGTGGAGCAGAGCGTTCAACGGG
GACCATTTCTAAAATTTTAGAAAATTTAGGTCATTCTGTTACTTTGATTTCGATTATTGATGAAAATGAA
TTTGAGCATGGGGGTGAATATTACGCTTTAGGGAGTACTAAAAATTATAAAACAGTTTTTGGAAGAAAGA
TCAGTAAGTTTTTAGATGCTTATCAACTATTCCAAAAAATAAATTTTGATGTTGTTATTGATGGAAGAAC
ACGACCACTTTTTTTAAAAGAATTGATTTTTAACAATTTAATATTTAAAAATATTCCTGTTGTCAGAATT
ATGCATAATTCATATTTACCTCAAAGTTTTCCAAAATTAAAATGGCAAGCAAGATATTTATATAAGAATG
ATTCTTTAATTGCTGTTTCTAAAAAAGCCCAACAAATTGTGGAGGATACTTATGGCTTTGATAATGTAAG
AACAATTAACTACCCGGTTTCTCAAAAAAAGATAGTTGAAAGTGCTCAAGCCGAATTAAATATTTTGGAA
ACCAATTATGTTTTATTTTATGGAAGATTTGATAACGAAAGTAAAAATCTACTTTTTTTATTGGAAGCTT
ATTCTATGTCTAAATTATCTGAATTGGGGATACCACTGATTTTGGTGGGAAAAGGGCCAGATAAACCGAC
TATAGAAAATAAAATAAAGGAACTAAATTTAATTTATCATGTTATATTTAAAAATTACACACCTAATCCA
ATGCCATATGTTAAAAAGGCATTATTTACAGTAATGACTAGTAATTTTGAAGGTTTTCCGATGACGTTAA
TTGAGTCGCTAACTTTAGGAACACCTGTAGTAACACTAGATTTCATTTCTGGGCCTTCAGAAATTATAGA
AACAGGGGTAAATGGTATTTTAGTGACAACAAAAACAACTAAAGCTTTTAGTTTAGCTTTAAATAAAATG
GTTGAAGATGTTGAGTTTTATAATAAATGTGTACAAGGTACATTTGAAAGCATAAAATATTTTGATAATT
TTTATATTGCCAAAAAATGGGAGACTTTATTAAATGAATTATGAAAAAGACAAGAATTAATGATTGTCAC
ATTATTGAGCTCGATAAAATAGAAGGAGACGATAGTAGAGGGAGTCTCTCTGTAATTGAAAAAGATAGTA
TTCCTTTTGAATCGAAGCGGATCTATTATTTATATGATGTTCCAAGTGATGCTAGGCGTGGTGGACATGC
CCACAAAGAATTGCATCAATTTTTAATTCCAGTTAGTGGTAGTTTTGATATAATTTTAAACGACGGAAAA
AAAGAGCAAACCTTCACAATGAATAAGCCTAACAAAGGTTTATATTTATGCCCTGGGATATGGCGCGAAA
TTGAAAATTTTTCTTCTGGAGCTGTCTGTTTAGTATTAGCTTCCGAAGTTTATTTGGAGGAGGATTATAT
TAGAGATTTTCATACTTTTTTAAGATTAAAATTACCTAAAATTCAATAATAACTTTATCAACCAATGAGG
TAAATGTAATAGTACTAATCTTTTAAAAGATAGATTGCTTAAGTTGATTTGTGATTTAAATTCTTTGAAT
TTTCTTTTTTTTCCTAAAATTTTGTATTGATTAGCAATAGCAAACCTATTTTGGTCTAAATAAGATTTTA
AATAAGGTGTATTGCCTTCAGAATTTTTATTTTTTGAAATTAATAGCGCTTTATTGTCTATATTTTTTGA
GTCGGATAAAGAATCAAAAACAAATAGTGCATAAATTGTTGTTTCTCTTTTGTTAAATATAAATGAATGT
TTTATTCCTAATCGAGTCCATAAGTCGATATCTTGTATGGATATAATATCTGGATCAAAAAAGAAATCAT
TATCAAGTATTAATTTCTTTTCAATACAAACTGCAGAGGTCCATGCGATATCGGCAATTAAACTGCTTTT
AAAGTAATTTTGAATAATGTATAAGTCTTCAAATTCTGGTTTAGGTAAATAACTAAAACGGTTTTCTTTA
TACGTGTTTTTCTTAGTTTCTACTTTATAATTGTTACAGAAAATTTTATACTCTGGATATGCGGAAATAG
CTCTATTTAATTCAGAAAGATGATTAGGAAACCAATAATCATCAGCATCTAAAAAAGCGATGTATTTTCC
ATTAGCAAATTTTATCCCATTATTACGTGCTGTTGAAACACCGCTATTTTTTTGAGAATAAATTTTAATT
TTTTTATCATTTATTTTTTCAACAACAGATAAGCTGTTATCTGTTGATCCATCATTTATAATTATTATTT
CATAATCAATGAAATTCTGTTTTAAAGCAGAATCTAGTGTGGTCTTTATAAAATCTTCTTTATTGTATAA
TGGTATTATTACTGAAAAAAATGGTGTCATAAAAATTAAAAATATAAGTAAATAAAAGTAATTTTTTCTA
GACAAAGAAAATTACTAATATTTGTTTTAATTAAGATTTAAGTTTTGGCATCAAAAAAAATTCAAATTAT
AGCATTTAATAATCCTTACCCTGTAAATTATGGAGGGGTTATTGATGTTTTTTATAAGATAGAGGCACTA
AAAGAAATAGGTTATCAGGTATATTTGCATATTTTTTATGATGATAGAGTTAATATCTCGGTTTTAGAAA
AACTATGTGAAGAGGTTTATCTGTACAAAAGAAACAAATTATTTTATAATTTTTTTAGTTTAATACCTTT
TAGTGTTAAATCAAGAAATTCAAAGGAGTTGTATGCAAGGATAACAAATAAGACAAATATTCCTGTGCTT
TTTGAAAGTATTCAAACTACATATATTCTTAAAAAGTTTCATTTTAATAATGAAACTTTAGTAAGAACTC
ACAATATTGAGCATGAATATTATTTTGGTATAGCTAAGAGTGAGTCTTGTTTTTTTAAAAAGCTTATTTT
TTATATAGAAGGTTGGAAGTTAAAAAGATATCAGTCTGTGTTGAAAAAAGCGGATATAATATTGACACTT
TCGGAAAGAGATACGAGTTATTTTAATTCGATTTTTAAAGGGAAAACACTATTCCTGCCTGTGTTTCATG
GAAATAAAAAGGTGAAAGAAACTATGAATTCTAAAAGCAAATTCGCTCTTTATCATGGTGATCTTTCAAT
TTCAGATAATGTAGAGTCGGCAATTTTTATATGCTCACTTTTTTATAATTTAAAACAGGAACTGGTTATA
GCTAGTTCTGTTTTGCCAAATCGTATCAAGAAAATTATAAAAAATTATTCAAACATAAAATATATAAATA
TTAGAGAAGAAGAGGTTTTAGAAGATCTGTTGGCAAAAGCACATGTTAATATATTAGTATCACTACAAGA
GTCTGGAACTAAATTAAAGGTGTTTAATGCTTTGTATAAAGGGAAATATTGTATTGTGAATGCTAATATA
GTTGATGATAAAAATATACTAAAACTATGTTATGTAGCCAATACAAAATCTGAATTCCAGAAAAGTATAC
AAGAAATTTTTGGTAAGGATTATCAATTTTCAAGTGAACGAGCTCGCGTATTGAAAAATTATGAATCGTT
GAACTTGGTTAAAAAGTTATCCTACTACCTTGAGACTAATAAAATCACATAGTTTTGTTAGTCTTGAATA
AATTAACGTTAATATTTTTATAATAGAAGCATGATTGTTATGAAACTATTTAAAAAAAAGATAAACGTTT
TTTAGTGTATTATGTATGAATTTAACCTTAGTTCGTGTTTTTTGAAACAAAGCGATCTAGAGTTTTTATT
GAATACAAAATGATTTAAAATTAATTTTTTCTTTGTACCACCTCAAAAATCTTTTGATTTTCGCACTTTA
AGGTTTTTGAAGGATATTTTAAAAGTAATGCATAATCATGTGTGGCCATTAAAATAGTATTCCCATTGGC
ATTAATTTCTTTGAGTAGGGCCATTACTTCCAGGGAAGTTTGTGGGTCTAAGTTTCCAGTAGGCTCATCG
GCTAAAATAAGTTCGGGATTATTTAATAAAGCCCTAGCAATAGCAATACGTTGTTGCTCACCGCCCGAAA
GTTGATAAGGGTAAATAGTACCCTTTGATTCCATGCCAACTTTTGTGAGTACTTCCTTAATGCGGTTTTC
TATTTTGTCTTTTTCTTTCCATCCCGTAGCTTTTAGAACAAATGCCAAGTTATTATTAACAGTACGATCA
TTAAGTAATTTGAAATCTTGGAAAACAACACCAAGTTTTCTTCTTAAAAAAGGGATTTTTTTTTCTTGTA
GTCCATTAAGTTTAAAATTTACGATTTCTCCTTCACCTTGGACAAGCGCTAAATCTCCGTAAAGTGTTTT
TAAAAAACTACTTTTTCCAGAGCCAGTTTTTCCGATAAGATACACAAAGTCACCTTTTAAGACTTGTAAG
GAAACGTTGGATAATACTGCTTTTTCACGTTGAAAAATAGTAACATTAGTTAATTTTAGCACTGCTTCAC
TCATAATACTCCTGTAAATTGTAATGGTAAAATTATAAAACTAAATCAGTTTGCAAAATAAAGTAAAGGT
TTTAGTGTTTTTAAAATAAGGAATAGGTAAGTATAGGGTAAACTGAAGCAATTTAATTTTAGAAAAGTAT
GTTGTTATTGAGGATGTTTTATCAATTTTAAGCTTGTATTTTGTGAATTTGATAGCTGCAGAAGGCAAAA
TATTTCAAGAATTTTTAAGTTTTACTTATTTAGTAATTATTGTAAATTAATTCCTTCATAGTGGGAGTAT
CTTAATATATTTGGAATAGGGTTTATTTTTTTAATTTCATGAAGAAAAGTTCGATTATTACCTGTTTTTT
TGTGTTGATATCATCATTGGTTTTAGCACAGCAGACCGAAATTTATAACACCACCAACGGGTTATATCAA
AGAGCAGTTGATTTATACAACAATAAAGAATTTGCTGCAGCTCAAAGTTTTTTTAGAAAAGTACAAGCTA
CAACTGTTGATCAAAATGTAAAAGCAAATACTTCTTATTACATTGCTCAATCTGCCGTGCAAATGCAACA
GAGAGGAGCCGATGTTTTAATGACAAATTTTGTAACTGATTACCCTACGCACCCCAAACGTAATAGTGCT
TTTTTTGGAGTAGGGAGTTACTATTTTAGTGTCGGAAAGTATGCGCAAGCCCGTAAATGGTATCAAGATG
TTGATGAGCAGCGTTTGAGTGCACCAGCACTTGAAACCTTTTACTTTAATAAAGGATATTCATTGTATCA
TTCAAAAAGATATGATGATGCTAAAAAATCATTAGAGCGCGTTGTAGGCTCCGAAAAATATGGAGAGCAA
GCAAAGTATTATCTGGGGTATATAGCTTACAAGGCTAATGATTATGACCAAGCAGATACTTATTTTAATG
AAGTAAGTGATTCTGAAAATTACAATAAGAGCTTATCTTATTACAAAGCAGATCGTAATTTTAAAAAGGG
GGAGTTTCAAAAAGCGATTGATAATGCAGAACCTCGCTTGGTGAATGCAAATACCAAAGATAAATCACAA
CTAAATAAAATTATTGGGGAAAGTTATTTTAACCTTGAAGACTATGAAAAAGCAGTTCCGTATTTAGAGG
CTTATAAGGGAAACAAAGGAAAATGGAGTAATACCGATTATTATTTATTAGGGTATTCATATTACAAACA
AGGGGAGTATAGCAAAGCAGTTTCTCAATTTAATAAAATCATAGCAGGTAAAAATGCAGTAGCTCAAAAT
GCTTATTATCACTTAGCGGATGCCTATTTAAAATCGGAACAAAAGCAACAGGCTTTAAATGCATTTAAGA
ATGCTTCGGAAATGAATTTTGAAGCTATTATAAAAGAGGACGCCACTTATAATTATGCAAAATTAAGTTA
CGAAATAGGGAATTCTTTTGAAAGTGTGCCCGCAGTGTTAAAAACATTTTTATTAAAATATCCAGATTCA
TCGCACAAGCAAGAAATAGCCACGTTGTTGGTAGATTCTTATTTGTCAACAAAAAATTACAAGGAAGCTT
TAGTAGTTTTAGATTCAGGAAAAGGAACGGAAAATAAAAAAGTATTTCAAAAAGTGTTGTTTTATAGAGG
GTTGGAGTTGTTTAAGGAAAAAGATTTTAAAGAAGCGATTCTTCTTTTTGATAGGGCAATTTCCACAGAT
GCCTTACCTGACTTTACACAACGTGCTCAGTTTTGGAAAGGAGAAAGTTACTACGCGTTAGAGGATTTTG
TAATAGCAATTTCAAATTATAAAGCGGTAAAAGAAAGTGGTGATAATACTTGGGAAGAATTAAAGTTAAC
AACCTACCAGTTAGGTTACAGTAACTTTAAAATTAAAGCCTATGACAAGGCAATTGATTATTTTAAGAAA
TTTATAGCTTCAAATCCAGAGCAGTTTTATTTACAAGATGCCACATTGCGTTTGGCAGATAGTTATTTTG
TGACGGCTAATTATTGGCCAGCAATGGAAACATACAATAAATCCATAGCTCAAAAGCACAAGCGTGCAGA
TTATGCTCATTTTCAAAAAGCAATTAGTTATGGTTTTGTAAATAAGCATGATCGGAAAATACAGGATTTA
GAGGCTTTTTTAATTAACTTCCCAGATTCGGGTTACAGGGATGATGCTTATTATGCTTTAGCTAATGCAT
ATGTGGCTAAAAATAATATCAATAAGGGTTTAGAAAATTACAAGCAACTTAGAAGTGAATTACCTAAAAG
TGCATTTGTTTCTAAAGCACTTTTAAAAGAAGGCTTAATTTTTTATAACGATAATAAATCACAAAAGGCG
TTAGATAAGTTTAAACTTTTAGTAGCAGAGCATTCAAATACTACAGAAGCTTTGCAAGCCGTTAAAACAG
CCCGCTTGGTGTACATTGATTTAGGAAAAACAGATGAGTATGCGGAATGGGTTAAATCATTAGATTTTGT
TGATATTTCTAATGAGGAATTGGATAATACCACCTACGAAGCAGCAGAAAAGCCCTACCAGGAAAATAAT
ATAAGTAAAGCAATTGTTGGTTTTGAAAAATACTTGAAACAATTTCCTAAAGGTTTACATAAGCTGAATA
GTCATTTTTATTTAGGACAATTGTATACTAAAAAAGGGGATAAACAACAAGCTTTGCCTCATTATTTGGC
TGTTGCTGAAATGGATAAAAATGAATACACAGAAACGGCTCTTTATAAAATTTCGCAAACCTATTTGGAA
AACAAATCTTATGATAAAGCTATTTCATTTTTAAAACGTTTAGAAGAAAGTGCTGATTTTACTCAAAATA
GCATATTTGCCCAATCTAATTTGATGAAATCATATTATGAACAAAAGCAGTTTGAAGAAACATTAGTTTA
TTCGGAAAAAGTACTAGTCAATTCAACTATTGAAACGAGTATTAAGGCCGATGCTCAAATTTATAAAGCT
AGAGCAGCATTGGCACTTCAAAAAACAGGAATAGCAAAAAAAGCCTACGCAGAAGTAGCAAAAATAGCTA
CGGGTAAATTAGGTGCCGAGGCGATATATAACTTAGCTAATTTTAGTAATCAAAACGGAGATTACGAAAT
TTCAAATAATTATGTGCAGCGTTTAGCAAAAGATTATTCGGCTTATAAAGAGTTTGGAGCTAAAGGACTA
GTACTTATGGCTAAGAATTTTTATGGATTAGGGGATGCCTATCAAGCTACTTATTTGTTAGAATCAATAG
TAAAGGAGTTTACAAGCTACCCCGAGGTTATAAGTGAAGCTAAAGAATTACTACAAAAAATTAAAGCAGA
GGAAGCTAAAACAAATTCATCAATCAAAGAATAAGTAACGTATTTATGAGTTTATTTTTTAATAATAGAA
GTGTACTATTTGTTGTGTTTTTTATTGGAGTATTAGGTTATTCCCAAACAAAAAAAGAAGAAAACGATAC
TTTGAGTACCGAAAAGGTGGTGATAGTAAAAACATTTAATCCTACGATTAATGATGCTTTTAAGATTCAC
CCAGAGCCTAATTTTGATGAAAAAGAAGCATCTATTAAGGAACCCTTAAAGTTTCAGATCAATTCCGTGC
CAGTGGCAAGTACTTTTGTGCCCGAAAAAACAAAATCAATTGCTGTAAAAAAAGAAGCCCCAGAAGCCTC
ATTTAAAAATTATGCGTTATTAGGAGCAGGAAATTTTGGAAATGTTTTAGCTGAAGTATTTAGTAGTATT
GATATAAATAAAGAAAGTCAATTTACAGCTTTGTTGGAGCATCAATCATCTCAAGGCGGTATCAAAAAGG
TAAGGCTTGACGACTTTTTTTATGATACGGGGGTACAACTAAGCTTTGGAAAACAGCAAAAACGTAAACA
ATGGACAATAGACTTAGAAGCACAACATCAATTGTATAATTGGTATGGTTTATCCAGTAATTTAGAAATT
CCCGAAGAACAATTTAATGCCATTGATCCATCACATAGTTTTATTGATGTTAATTTAGGAGGGAATTTAC
AGTTAGATCATGAGGTGTTTAATACGGCTAATGTTAGGTTTAGACATTTTAGAGATGATTATGAGAGTAC
AGAAAATAACTTAAAACTGAATCCTAAATTTACAGCACCTTTGGATGATTATCCTATTTCGATACCCATA
ATTTTTGATTATTTAAGTGGTGAGTTTGCAGATAATAATGTGTTTCAAGGTTCGAAATATAGTTTTTTAA
TATTAGGAGTTCAGCCTACTATAGCATTAAATTTTAAAGGGGTAGATGTCAAAATTGGAGTTTCAGGTTT
TTTAAGTAATGATTTTGAAAATAGTGAGTTAAAATTAACAATCCATCCTAATTTAACCGCTAATTATAAT
TTTAACGCTTATAATTTAAGTGTTTTCGGAGGAGCTACAGGTGGTTTAAAACAAAATACATATCATGAAG
CCATTGAAAAAAATCCGTTTGTTGCTCCTGGAATTGGAATCACTCCAACAAATCAGGTATTTAATGCATT
TGGAGGCGTGCAAGGACAATGGCAAGAAAAATTTTCATACATGTTAAAGGGAGAAGCGGAGTTTGTAAAA
GACTATGCCTCTTTTATTAAAAATCCGATATTGAATTCAGCAACAGAAAATTTGAATTATGGGTTTAATA
ATTCTTTTGGATATTTTTATCAAGATTATGTAGCGGCAAAAATTACTGCCGAAGTTGGTTATGAGGAGCA
AGGTTTATTTAATGTACTTTTGCAAACAACTTTTGCTAGATATAATGAGACACCAAGGCAGCCTTTAAAT
ATACCCGCTTTTACAACAAGTGCTAGGGGGAATTATATTGTTAATAGTGCATGGAGTATTGGAGCTAATA
TTTTTTATGTGGGAGTTAGAGAAGACCGTGATAGATTAAATAGTGATTTATATACAGAATTAGACGGTTA
CTTTGATCTTAATTTACGTGCAGATTATAAAATTACAGATCAATGGTCGGCTTTTGCATTAGGGAATAAT
TTAACAGGACAAAATTACGAACGTTGGTTAGACTACCCTGTACAGGGAATTCAACTTTTAGTAGGTGCTA
AGTATAAATTTTAGCTATGTGAACTTGGATGCTGAGTTTGTTTATTGCCAATATTTATTAAGGAACTCTT
AATTTAATTGTTTAATTAGCGACCTCCATTGGCTTGTAGGTCTTTTACACATAAAGGATCAAGTTCTAAT
GCTTTTATGTTTCCCATTAAATTGCTTTCAAAAAGTGCGTTGGCTTGCATAAGGCAACCTCTAACATTGC
AATGTTTATTAGGCTTACCGTTTTCGTCTGTGTCTTCATGAGGTGTTTGCATTCTAGTTCCTAAATTAAC
TAAACCAAGCAAATGGCAAAATTCATGCTGTAATGTAAAAGTTTCAACTCTAGCTAAAACTTCATCGGGG
ATAACTGAATTACTTTGATTAACTATTTTTTTTAAAGTATTTTCGTAAACAACCATAGATGTATTTCGAT
AAGCAGAGCCTAAAACCAAACTAGACATAGAATCGTTATCATTATTCATTTCTCCTTCAGAGTTTTCTGG
ATTAGCATCGGCATCACTAAAGTAAATGAAAATAGCATGTTGGTTAGGCGTGCTTAATTGTGTGCGGTTT
TTTTGTTCAATGCTATCAATTTGTTTTATGCTAAGCTTTTTTTTATTGGTGCTAGCAATGCTACGTTGAA
TAACTTGAACACCGTTTGATTTAAATGTTCTTTTTTCAATAAAATTAACAAGATTTTCTACGGCTTCTTT
TTTGGGTTCAAAACCTTTTACAGCAACTAATTCTAAAATCAATTTGTTATGCGTTTTTGAACTTAATAGT
TCATTTGCAGAGTTTCCTGTACTTTGTAAATTTAGTATTCGAGGATTCCGATTGCCGTTTGAATCGTCAT
CACTTGCACAGGCTACAATGAATATAGTTAGTGCAATTACTTTGAAAAAAGTTTTAATAGATATCATTCT
TATGATTTTATTACATTTGTCTAACGCAAAAAATACTTATTTATGAAATTCAAATGTTTTAGTTTAGTAT
TATTTTTAATACTCTCCTTACAATCCACAGCGCAACAATCCACATTAACTGAGTCAATAACTCAGTATTT
AAATATTAATGGGACTACAGAACAATATGAACATGCTGTAAGTTCGTTGTTAGTGATGTTAAAACAACAA
TACGTATCAAAGAATGTTCCAGAAACGGTATGGGAGGAGTTAAATCAGCAAAAACCTACAGCAATTAATC
AAATTAAAGCCATGTTAGTTTCGGCTTACCGCACACATTTTGATCAAACGGAAGTTAATGACATGATTGA
GTTTTACAAAACGCCAACGGGTCAACAAATGATAACGGATCAAACAAAGTTGACTCAGGATGATCGTGAT
AAAATGTCATTTTTTTATAATTCACCAACCGGTAAAAAGATTTTAGAAGAAAGTGATGCATTAAATCAAT
CCGTAAGTGAAATTAGTGAGAATTGGAGTAGAGCATTATATAAGTCTATGACAGCAAGACTTACAGAAAA
AGGTTATGATCTATAGTGTTAATCTAGCTAAATAGTCATAATGTGCTCCTTCAATAATTAACTCGCAGTT
AAAATTATTAAATGCTGCAGCACGTTGTAATGTATTGTAATCTACATATAGCCAGTCAAATTTTTGACTG
GTTTTGTTTTTATATTCCAATTGGTATTGCATTTCACCATAATAGCCTTGTGCAGCATCTACCCAATATT
CGCCATTTTCATCTTCAAATAAATAAATGAGATCCGATGAATCTATAAGGATTTGTCCATTGGAGGTTAG
TAAGCTTTTTAATTTGTTAAAAAAAGAAGCAAAATTAGTTAATGTTCCTACAATACCACTACCATTCATT
AATAGTAAAATGGTATCATACGTGCCTTGATGAATATAAAAATCTTCATTTAAAACAGTAGTAACTCCTC
TTTTTTTGCAAATTTCCACAGCTCCAGCTGAGGTGTCAATAGCAGTTAGGGTTAATTTTTTTTCGTTTTG
AAGGTGCAATGAATGACTACCAGCTCCACAGCCTACATCGAGTACTTTTCCAAAAGATAAATCAAGCGCT
TTTTGCTCAACTTTTGGCATTTCATTAAAAGTTCTAAACAAGTAAGGAATAGGAATTTCATCATCATCAA
ATTCATTTGATTTTACAATAATTGAATTTGGAATGCGAGTTTCAAAGTAGTCCGTTATGGCGGCGCCAAA
AATGTCATTTTCCATGGTGGGTGTAAAGTTATGTTTTACATTTGCTGTATGCAAGAGGAAATTGATAGAC
TACCAAAAGAGGCAAAAGAGCAATTTAAAGAGAATAAGAAGTTTTTAGAGCGTTTGAGGCAAAAACCTCC
GAAAAAATTGGATGTTATAATGCAAGATTTGCATAACAAAACATTTGATCAAATAGATTGTCTGGAATGT
GCCAATTGTTGTAAAACAACTGCGCCCATTGTTACTGATCGAGATACAGAACGTATTGCGAAACATTTAA
AAATGAAAGCAGTTGATTTTGAACAAAAGTATGTTAAAGTGGATAGTGATGGAGATCAGGTTTTTAAAAC
TACTCCTTGTGAATTTTTGGCTCATGATAATTATTGTTTAATATATGATGTACGTCCAAAGGCATGTTCG
GAATATCCACATACAAATAGGAAACGTTTCCACCAACTAAACAAAGTAACTTTAGCAAATACATCCATTT
GTCCGGCTACATATAGAATGGTTGAAAAGCTTAAAGCACAGTTTGGAGTGCTAAATAAAAAAGAAAAACA
ACGTTAATTTTTTAAATATTTTTTATCGGCCCAAAAAGTTCCAAAAGGAATAATAGAGCATAAAAGAATA
ATAGCCGTTTGTTTGTTCGACCATTTTAATTCAGTCTTTAGGAAAATAGCAAAAACAACATAACCTAAAA
ATAAAACACCATGTACCATTCCTATAATTTTATTGGGCATGGGATTTTCAAATAAATATTTTAATGGCAT
GGTTATAAAAAGAATGATTAGGAATGAAATTCCTTCGAGTAAAGCCAGTATTCTAAATTTTTGAAGCATG
TTTGTTTTTTGTGGTAAAGATAACTTCCGATAAAATATTACGGGTATAATAAATACTTTTTTCTAATCAA
ATTAAATTGATCTAAATCCTTTTGCCAAGTAGCCTTAATTTGTTTAGCAGTCATTCCGGCTTCAATTTGT
TCTTGTAGTTGATCTGTACCAGCTAATTTTTTAAAAAATGAGGTAAAGAATTCATTTTTATTAGGGCTTT
GTTTGTAAGCCTTAAGTAACCAATTTAAATGTAATTGGTCCAGTTTTTTATGCTGTTGTAAATTTTCGCC
ATAACATAGTTTTGCTTCAAATTTAGGGTGTTTAGCACCGGGTTTAGGAGTTGGTGTAAAGCTAAAATCT
GTTTTAGAAAAATTTGGAGCTCCGTATAGTTGAAATTGTAAATCTGTGCCTCGACCTACACTTACATTAG
TGCCCTCAAATAGACACAAACTTGGATATAAATTTATTGATTGATCATTGGGTAAATTTGGTGAGGGTTT
TATGGGCAAGGAATAGGCAGTGGTATGGGTGTAATTTTTTAAAGGGATAACGCTAAGTTCACATGTTAGT
TTGTTGGCTAACCATTGTTCGCCATTAATCATTTTGGCATATTCACCAATAGTCATTCCATGTACTATAG
GTATAGGGTGTAAGCCAACAAAGCTTTTAAATTTCGGTTGTCGGATAGGTCCATCCACATAATGTCCATT
TGGATTGGGTCTGTCAAGCACAATAACTAGGATGTTGGCCTCAGCAGCAGCTTCCATAATATAATGCAGT
GTCGAAATGTAAGTATAAAAACGAGCGCCAACATCTTGGATGTCAAAAACAATACAATCAATGTCCGAAA
GCATTTCGGGATTAGGTTTTTTATGCTTCCCGTAAAGGGAAACAATAGGCAGGCCAGTAGCAATATCTTT
ACCATTTTTGATCACTTCACCGGCGTCGGCAGTACCTCTAAACCCGTGTTCGGGAGCAAAAACTTTTTTT
AAATTAACCCCCCTGCTTAGTAAAGAATCTACTAAATGTATAGGTTGTTTTTTTATGTTAAAAATAATAC
TGGTAGGGTTTGCGACTACGGCTATTTTTTTTTCTTTAAGAAGTTTTAAATAGGAAGTTATTTGTTGCGC
GCCTGTTAAGATACTTGTTGTTTTCTTTTTTTCTTTAACAGAAGAAATGACTGTATGATCAATTTTAGAA
GCCGTTTTTATTGAAGGATTTGGTTTTCCACAAGAAAATAAGGGGAAGACTAGTATTAAAAATGTATTTT
TGAAAAAGGTCATTAACCATGAAAAATATCTTTTTCGAAGATTAAACGGATTAGTATACATTGAATTTTG
AGTATTTCATAGCCCAAAGGCTGATTAAAGAAAAGGCTTTTGCCAAAAATATATCATCACCTATTGTAAA
AATAGCCATTATAGCTATTGCTTTAGGGATCATAATGATGCTTATTGCGATCGCTACAGGTGTTGGTTTA
CAACGTAAAATTCGTGAAAAAATAGCACTTTTTAATGGGCATATTGAAATTTCTAACTTTGATAATAATT
CAAGTCAAGTTTCTATAAAACCGATTACCACAAATCAAACTTTTTATCCTAATTTTTCTGAAGTGCCCGA
GGTCACCCATATACAAGGAGTAGCTACAAAAGCAGGAATTGTTCGCACAGAAACCGATTTTGAAGGAGTT
CTAGTAAAAGGAGTTGGGTCGGATTATAAATGGGATGTATTTGAAACCTATTTGGAACAAGGAAGGTTGC
CTAATTATAATGAAAAAATAAATGAAGAGGTGCTTATATCTAGTTATTTAGCCAATAGATTAGGCTATAA
GCTAGGAGATAAAGTAGTGACTTATTTTTTAAAAAATGATAAAGCGCGTACCAATTTACGTTCCTTTGTA
GTTACTGGAATTTACAATTCGGGTTATGAAGAATTTGATAAAGCCTTTGTGATAGCGGATGTGAGACACA
TACAGCGTTTAAATAAATGGAAAAAAGATGAGGTAGGTGCTTTTGAAGTTTTTGTTACTGATTTTGATGC
AGTAAATCGTATCAATGCGGCCGTTTATAAAAACATTCCATCTAATTTAGATAGTACATCCATTTCTCAA
AAATATGGAAACATTTTTCAATGGTTGAATATGTTCGATTTTAATATTGCGGGTATTATTGGTATCATGA
TATTAGTGGCGGGGATCAATATGATTACTGCGATTTTAGTGCTTATTTTAGAACGAACACAACTCATAGG
AATGCTGAAAGCCATGGGGAGCTCTAATGTGAGTATTCGTAAAATATTTATGTATAATGCTACATACATT
ATTTTAAAAGGGCTCTTTTGGGGTAACTTAATTGGGCTTGTTTTAATAGGGATTCAGTACTTTTTTAAAG
TGATTACGTTAAACCCTTCGGATTATTATGTGAAATACGCGCCAGTGCATATCACCATTCAGCAAGTTTT
AGCTTTAAATATAGGAACATTAGTATTATGTGTTTTAGTACTTTGGATACCATCTTACGTAATTACAAAA
ATAGCTCCTATAAAAGCAATTAAGTTTCAATAGTTGTTTGTACGATATAATTTTTTAATTTAATGAAGGC
AAGACTGGTTGATAATGATGCTGATTTACATCAGATTTTAGCTATTCAAAAAGAAAATCACTTAGATAAT
GTCTCCATAAGTAATAAAAAAGAAAGAGGTTTTGTGACTGTAAAACATGATTTTGAAGTGCTAAAAAAGT
TGAATTCAAAAGCACGTCAAATAATAGTTAGTGATAAAAATGAAGTAATAGGCTATGCTTTAGTAATGCT
TAAAGAATTTAAAGACTTGATTCCTGTACTTATTCCCATGTTTACACTTTTTGAAAGTATTCAATACCGA
GGAAAAAAATTAAGTGAATTGAATTATTATGTAATGGGACAAATATGTATTGCAGATGGGTATAAACGTA
AAGGTCTATTTGAAAAGCTATATTTAAAACACAAAGAAGTTTATTCTGAGCAATTTGAGTATTGTATAAC
TGAGGTGTCATCAAGTAATATTCCATCCATGAAGGCACATGAAAAAGTTGGTTTTAAAACTATTTCTACC
TTTTGTGATACTACCGATGAGTGGAATGTTTTGTTATGGGATTGGCATTAGTAATAGGGTATAATTCAAT
TTTAATATTCAATGTGCTATTGATAATTAATGTAATTTTGCTTTTTTTCTAATTAATTGAAATGAGGAAT
GAGTAAAAAACACTTTTATAGACCCGATATTGATGGATTAAGAGCTATAGCAGTAATGCTTGTTATTTTA
TTTCATGCAGGTTTTACAAGTATTAGTGGAGGTTTTGTAGGGGTTGATATCTTTTTTGTGATATCGGGTT
TTTTGATTACAAGCTCAATTAATAAACAAATGAGTCAGGGAACTTTTTCGTTCCAAAATTTTTACTTGAA
ACGAATACGACGTATTATTCCAGTATTGGTTTTTATCATGTTTATTGTAACAATACCTGCTTATTTTATA
TTGTTTTCAGATGATTTTGAAAATTATTCCAGAACTATTATTCATACTATTTTAAGTACAAATAATTTTC
ATTTATGGATTAAAAGTAATGATTATTTTGCCGAAAGTACAGAATTAATCCCCTTGTTGCATACTTGGTC
GTTATCTGTTGAAGAACAGTTTTATATCATATGGCCTCCACTACTATTGTTATTGCACAAAAAGTTCAAT
TTAAAAAATAGGTTGTTAGGAGTGATTGTGTTACTGTTTTTAAGTTTTATGCTCTCGGTATTTTTAACAC
ACATAAATATGCAAATGGCTTACTTTTTATTGCCGGCACGATTGTTTGAAATGTTAATGGGAGGGGTGTT
AGCAATTTTTTGGTACAAATTACCTGAGTTTTCTAAAATTCAAAACCATATAATTTCCAGTGTGGGATTT
TTTATGATGCTGCTTCCTGCATTGTTACTTACTCAAAATGATAGTTTTCCTGGGATTAATGCTTTATGGC
CATGCTTAGGTGCTAGTTTGTTTATTATTTCTGGAAAAGAGGCATCAAAAATGGGAGTATTTAATACTAT
ATTAAAAATTCGTGTTTTGGTCTTTATTGGGTTAATTTCTTATTCTATGTATTTGTGGCATTGGCCATTA
TTAGTTTATGTAAAATATTTAGGTTTTGAGTTGACTAAACCGATAGCATTAGGAGTAATTATTTTAACTA
TTTTACTATCCTATTTGTCATGGAAATTTATTGAGCAACCTTTTAGGTATCGTTACATTTATGATTTTAA
AAACACATTATTAAAAGTGCTATTACCTAGTGTTATCATTTGTGTAAGCTTATATGGAGTCATAGACCAT
TTTAATGGTTTTCCAAATCGTTTTACAGCGCTAAGTGAATTTGATAAGGATGCTAATTTTCCAAGTAAAT
TGAGACGTAATTGTTATAGGAAGTTAAGGATTGGAAATATTGAAGAGTGTGGTTTAGGTACTCCCAAAGA
TCAATTAGATGGTATGCTTATAGGTGATTCATTTGCCAATCATTCCGCGGCATTTTTAGAGGTGTTAGCA
AACGATGCCCATATGTATTTTCATGATAGTGCAGCAGGAGGCTATCCGGTGTTAGCAGATGTTGACGATA
TTACAGGGGAATATAGATATGATCCAGAATTTGGAGAAAAAAGATTAGCCTTAGCAAAAAAATATGAATA
TGTAATTTTAGCAGCAAATTGGGAGCGTTTCTTAGATAAAAAATCTAAAAATTACCAGTTGGTACTTAAA
ACTGTAGGGGAGTTAGTGGAAACGGGAAAAAAAGTAATTGTAATAGATCCATTACGAAAAACCACTCCTA
TGGATCTACATAAGATGAAGATGTTTAAAGTAAGGAATATTGCTAAGATTAAAAAAGAAGATCTTTTGGT
GCCTTTTTATAAAAGACCAGACGATTATATAGTATATGAATTCAAAAGAAAATTCCCAACTATAAAGATT
GTTAATCTGAATACAGTAATGTGTAACGGTAATTATTGTGATTATGAAATTAATGATAATATAGTATACC
GTAATAGTAATCATTTAAATACAAGTGGAGCACGTTTACTTGGAGAACGATACTTGAAACAATATGGAAA
TCCATTAAAAAAATAACAATTAGCCACTGTTATAGTAGGGGCATTACACGGTAATGAAGGATAAATAGAT
AGGGTTCATTTTTTTTTAAAACTTACTAAGTTTAAATTGTTGCAGATCAGTATATTGTTAATTTTTTACT
TAATGAATTAAGTATGTAATAATTATTAATTAAAATAGTTCAATCTGGTCAGAAACAATTATATTTGCAT
GCAATTAAATCCTTAATTGCCATGATAGCACACGAATCAAAAATTGTTGGAGAAGGTTTAACCTACGACG
ATGTCTTATTAGTTCCAGCATTTTCAGAAATTCTTCCACGCGAAGTTAGTATTCAAACAAAATTTACTAA
AAACATAACCATAAATGTTCCGATTATTTCGGCAGCAATGGATACGGTTACAGAGTCGAGTATGGCAATT
GCTATGGCTCGTGAAGGTGGAATAGGAGTGTTACATAAAAACATGACTATCCAACAACAAGCTAGTGAAG
TTCGAAAAGTAAAAAGAGCTGAAAGTGGTATGATCATAGATCCAGTTACTTTGCCATTAACTGCTGTAGT
AGGTGATGCAAAAGCGAATATGCGTGAGCATAGGATTGGAGGAATTCCTATAGTAGATGAACAAGGTAAA
TTGGCAGGAATAGTAACTAATAGGGATTTGCGTTTTGAAAAAGATGTTGACAGACCTTTAATAGAGGTAA
TGACAAGCGAAAATTTAGTTACAGTGTCCGAAGGGACTAGCCTTAAAGATGCTGAGGTAATTTTACAGAA
AAATAAAATAGAAAAGCTTCCTGTGGTTAATGAAGATCATATTCTAGTTGGTTTAATTACATTTAGAGAT
ATTACTAAATTGACACAAAAGCCCAATGCAAATAAAGATCAATTTGGTCGTTTACGTGTTGCTGCAGCAT
TAGGAGTTACTGCGGATGTGGTTGAAAGAGCAACAGCTTTGGTAAATGTTGGAGTAGATGCTGTTATTAT
TGATACAGCCCATGGACATACTAAAGGCGTTGTTGATGTATTGAAAAAGGTGAAAGCAGCTTTTCCTGAT
TTAGAAGTAATTGTTGGTAATATTGCTACTGGTGAGGCCGCAAAATATTTAGTTGAAGCAGGTGCTGATG
CGATTAAAGTTGGAATAGGACCAGGGTCAATTTGTACAACACGTGTTGTAGCTGGAGTTGGTTTTCCACA
ATTTTCGGCAGTACTTGAGGTGGCAGCAGCCATTAAAGGTACGGGGGTTCCAGTAATTGCCGATGGAGGG
ATTCGATACACAGGGGATATTCCAAAGGCCATTGCAGCTGGAGCAGATTGTGTAATGCTTGGTTCATTAT
TGGCAGGGACTAAGGAGTCTCCAGGAGAAACAATTATTTTTGAGGGACGTAAATTTAAGTCATATAGAGG
AATGGGATCTGTTGAAGCCATGAAAAAAGGCTCAAAAGATCGTTATTTCCAAGATGTGGAAGATGATATT
AAAAAATTAGTTCCTGAAGGAATTGTAGGTAGAGTTGCATACAAAGGAGAATTAAATGAAAGTATCCATC
AATTTGTAGGAGGCTTACGTGCTGGAATGGGGTATTGTGGTGCTGCTACAATTGAGGATTTAAAAGAAAA
TGGACGTTTTGTGAAAATCACAGCAAGTGGAATTAATGAAAGTCATCCACATGATGTTACTATAACAAAA
GAAGCTCCAAATTATTCTAGATAATTAGATCTATTCATAAAAAAAGCGACTTTTAGTCGCTTTTTTTTAT
AAATATTGGGTGCAAGTTAGCTTTATTTTGATGCTGTAACTGCAATTTGAATACCCACATTATCTTTAAT
TAGGTAATCTCCTAATTTTGCAGGATCAGCAAATTTACCCGAGTTATATTTTACGCCCCACTCAGTTCGA
TCAATTTCAAATTCATCACTAGTAATAGTTACTGTGTTGCCATTTACAGAAACTGTTGCAGGGAATTCAA
TATTTTTCTTAATTCCTTTTATGCTTAGGTTACCAGCTATAACAGATTTTCCGTTTTTAGGAGTAACACT
TGTAATTTGAAAAGCAGCACTTGGGTGTTTAGCTACATCAAAAAAGTCTTCATTTTTCAAGTGACCAATT
AATTTGTCATAGTTTTCTCCAGCAGGAAGATCGGAGCATTTAATTGTATTTATATCAAAAATAAAGTTTC
CACCAACTAAGTCATTTCCTTTAACTTCAATTAATCCAGCAGAAGCATTAATAGTTCCTTGGTGTCCTCC
AACTATTTTGTGTGCATTCCACTTAATCATAGTTTGCGCGGGAACGGCTTTAAACTTTTCGGCAGTAACA
ACTTGTTCAACAGTTTTTGCATTAGTAGTTTCGACTTCTTTATTTTTTTTACATGAAATAAAACTTGCAG
TAAGTACAGTAACGGCAAGAATATTAATAAGCTGTTTTTTCATTTTAATAAGTTTATGTTAAAATTTTTC
TATTCAAAAGTATAGGTTTTGTGGCTTTTAAATCTTAATTAATTATTAAATTCTTAAAAGGGCACTTGAT
TTTAAGAAGTAATTTTAAATTTATTAACGTCTTTTTTGTTGATTATTAGGTTTTTTGGATTTTGATATTT
AGGGTTTTAACAATCATTTTTTGTTTGAATAATTCTTACAAAAAACATTTAATGACATATTGGCATATCA
ATTGAATTGGCAGTACTTTTGCACACTAGTTTTAAACCTATTAAAACCTTCGGTAACGAAGTTCTGGTGT
ATAATTTAGGTTAAGCATTAAAAAATAGAAGTAAAAAGAACTAAAGTAACATGAGTACAAAAGATAAAGC
TAAAGAAACAGTGGATGAAATAATCCAAGATTCAACTAAAGATGCGAAAGTAGAGGAAAAAGAAACTCAA
CCAGTAGAAGAAAAAGATGAGTTAACGCTAGCCAAAGAAGCAGCTGCTGTTGAAAAAGATAAGTTTTTAC
GTTTGTTTGCCGAGTTCGAAAATTATAAAAAAAGAACTTCAAAAGAGCGTGTTGAATTATTTAAAACTGC
AGGTCAAGAAGTTTTACAAGCCTTATTACCAGTTTTAGATGATTTTGATAGAGCAAGTAAAGAGATTGAA
AAGTCAGAAGATGAAGCTTTAAAGCAAGGAGTGACACTTATTCATAATAAATTAAAGGATATTTTAAAGT
TAAAAGGCTTGGAGCAGGTTGAAGTAAATACTGCCGATACTTTTGATGCAGATATCCACGAAGCAATTAC
GCAAATTCCAGCACCAAGTGATGATTTAAAAGGAAAAATCATTGATGTAGTTGAAAAAGGATATAAACTT
GGTGATAAAATCATTCGTTACCCTAAAGTGGTTACGGGAAACTAATTAATTAGGAAATAATGAAAGAAGA
TTTCTACGACATACTTGGTATTAGTAAAGGAGCTAGTGCTTCCGAAATAAAGAAAGCTTACCGTAAAAAA
GCGGTACAATATCACCCAGATAAAAATCCGGGAGATGCGGAGGCTGAAGAGAATTTTAAAAAAGCAGCAG
AAGCTTATGAAATATTAAGTGATCCAGATAAAAAAGCTCGTTACGATCAGTACGGACACCAAGCCTTTGA
AAATGGTGGAGGTGGAGGTGGCTTCGGCGGTATGAATATGGATGACATTTTTAGCCAGTTCGGAGATATT
TTCGGAGGCGGAGGTGGTTTTGGCGGCTTCGGTGGCGGTGGCGGAGGACAACGTCGTTCCAAAGGGAGTA
ATCTTCGTATTCGTGTAAAGCTTACCTTGGAAGAGATTGCTAATGGAGTTGAGAAAAAAGTAAAAGTAAA
ACGAAAAGTTCAAGCAGATGGAACTACATATAAAACTTGTGGTACCTGTAATGGAAGTGGTCAAGTAGTT
CGTATTACCAATACTATTCTAGGACGTATGCAAACTGCCGCTCCTTGTAATGCATGTGGGGGTAGTGGTC
AGCAAATTGATAAAAAACCGAATGGAGCAGATGCTCAAGGGCTAATTGTTAATGAAGAAACGGTAAGCAT
TAAGATACCTGCAGGAGTGCAGGATGGTATGCAATTAAAAGTTTCAGGCAAAGGGAATGAAGCGCCAGGA
AATGGATTTGCAGGGGATTTATTGGTTGCCATAGAGGAATTAGCACATGAAAGTTTACAACGAGAAGGTG
ATAATTTACACTATGATTTATATATAAGTTTTTCGGATGCTGTTTTAGGTGGATCAAAGGAAATTGATAC
CGTATCGGGTAAAGTACGTATTAAAATTGATGAAGGTGTACAAAGTGGTAAAATTTTACGCTTACGCGGA
AAAGGGATTCCAAACTTAAATGGCTATGGTAAAGGAGATTTATTGGTACATGTAAATGTTTGGACTCCAA
AAACTGTAACTAAAGAGCAAAAAACGTTTTTTGAAAAAATGAAGGATGATGATCATTTTTCACCTAGTCC
AGAAAAGTCAGAAAAATCTTTTTTTGAAAAAGTGAAAGATATGTTCTCGTAATTAACACGTTAGTTCTAA
TTTTTTGTCTATATTTGATAAAACACTTGTTAAAACGAGTGATTTTCTTTTTCATAGCAATTTTTTTCCC
ATCCTATTTTAATTAATAGGGTGGGTTTTGTTTTTTAGCATACTTATAACTCATATAAGTATGCTAATTT
TAAAACTATTTTATAGCAATTTTATTATGTAGTCTTTGTTAAATTCGGAACCTTACAAAAAGTAATACAA
AATTTAAAATGATTATATGATTAATGAGATTTTTGATCAGTTTTCATATTAGACAGATTGAATCTTTATT
ATAACCAGTATTTTTTTGAGTTAGGTTAAAAATGAGTATTATAGCATAAAAAATATTTTTTAGTTAAATT
CAATACATGATCATTTTATTTCTACAGCAAAAAATAGCCGAAAAAGTTGTAGACACATTAGACAAAAATG
TGTGGCAAAAAATACGTGAGATTCTTACTTTAAAATTAGAGTTGGGTGCATTTAAAATTAGTATTCTTTC
CCTTATAATTGTTATAGTCACATTTATTGTAACCAAATATGCATTATATTTTATAACTAAATTAATTACT
AAAAGACTAGACAAGGAAAATGTACCTAAGTTTGAATCACTATTTAGTTTTATAAAATATTTTATATATG
CTTTAGTGGGTGTAATGGTTTTTCAGGCTTTGGGTATCAATTTAACACCAATTTTAGCGGCTTCAGCAGC
TTTATTGGTCGGAGTTGGATTGGCATTACAAACTTTATTTCAGGATATTTTATCTGGAGTTTTTATTCTT
ATTGATCGCACTGTAATAGTTGGTGATATTATTGAATTAGATGGAAAAGTAGGACGTGTTGAAGAAATAA
AGTTGAGAACAACTCGTGCTGTAACTATAGATAATAAAGTTTTAGTAATACCAAATCATAAGTATTTGAC
TAAAAGTTTATTTAATTGGACTCAAAATGGTAAAAAAACTAGAGATACAGTTGCAGTAGGAGTAGCCTAT
GATAGTGATGTTAATTTGGTGAAAAAGCTATTACTTAAAGCGGTTCATGAGAATAAAAAAATATTGAGTG
AACCAGAGCCCATCGTACTTTTTGAGGATTTTGGTGATAGTTCATTACAATTTAAGGTAGTATATACCAT
TAGCGATAGTTTTATGGGAGCTATCCCCAGGAGTGAATTACGATTTGAAATTACTAGATTGTTTAGAGAA
CATAATATTCAAATTCCTTTCCCTCAACGTGAAATACGTGTATTGAGTGATCATAGGAATAATTAAAAAA
TAAGTATATGTCAAAAATTTTGATTATCGAAGATGAAGCAGCCATACGTAGGGTGTTGGTTAAAATCCTT
TCGGAAGAGAATGAAGCCTATAAAGTATCGGAAGCAGGTAATGGTTTAGAAGGAGTTGAGCTTATTAAAA
AAGAAGATTTTGATTTAGTACTTTGTGATATTAAAATGCCAAAAATGGATGGTATTGAAGTCTTGGAGGC
TATAAATAAAGTAAAACCAGAAATACCAGTTGTTATGATTTCGGGTCATGGTGATTTGGAAACAGCCGTA
AATACAATGCGTTTGGGAGCTTTTGATTATATATCTAAACCACCAGATTTAAATCGCCTTTTAAATACAG
TACGAAATGCTTTAGATAGAAAAGAACTTGTTGTAGAAAATAAGCGATTAAAGAAAAAGGTTTCCAAGAG
TTACGAAATGATTGGTAATTCGAAAGCAATTTCTGAAATAAAGGAAATTATTGAAAAAGTAGCCCCCACA
GAGGCGCGTGTTTTGGTAACGGGACCAAATGGTACAGGTAAAGAATTAGTGGCTCATTGGTTACATGAAA
AAAGTGAACGATCTAAAGGGCCTTTTATTGAAGTGAATTGTGCAGCCATACCTTCAGAGTTAATCGAAAG
TGAACTTTTTGGCCACGTTAAAGGAGCATTTACCTCAGCAAATAAAGATAGGGCAGGTAAATTTGAGGCT
GCTAATGGGGGAACAATTTTTTTAGATGAAATTGGCGATATGAGTCTTTCAGCGCAAGCAAAAGTATTGA
GAGCTTTACAGGAGAGCAAAGTGCAGCGTGTAGGTAGTGATAAAGATATTAAAGTAAATGTACGTGTTGT
TGCTGCGACGAATAAAGATTTAAAAAAGGAAATTGAGGACAAAAAATTTAGAGAGGATTTATACCATCGT
TTAGCAGTAATTTTAATAAAAGTGCCTGCGTTAAATGATCGTAGAGATGATATCCCTGAATTGATCAATC
ATTTTTCAAAAAAAATAGCTGAAAGCCAAGGGACAATACCAAAAGATTTTTCTGATGAAGCTGTTAAACT
ACTACAAAAATACGATTGGACAGGTAATATTCGAGAGTTACGTAATGTGGTAGAACGTTTACTAATTTTA
GGAGAAAAAGAAATTAGTGAAAATGACGTAAAATTATTCGCATCTAAGTAATGAAATTATTTAATACGTT
ATTTTTATTTTTTATAGTAAACTCAATTTTAGCGCAACATGAACCTGGGGCTTGGGTTGTAGGTGTGCAA
GGTGCAGCAAAGGTAGATAGGATTTCTGATGTAGGAGGAAGTTTTCAAGTACATTATGCTCCCAATTGCT
ATTCTACTTACATTGCAGAGGTAGGTGTTTTGAATACAAAAGATGGCATAGTACCCGAATTGGGAATAAC
CATAAATTCAATTATGTTCAATTTTCAAAGTTGGATGATAACAGGAGGTATGGGCTTTATTATGAACAGT
GCAGAATTATCTAAAAAAGAGCAAGACGATGCTATTTTTGCATTTTCGGATGGAAAAAATAGCTTTGGTG
CTTTACTAAAAATAAGAACATTAGTTCCCATAAATAAATGGTGGCAATTAAGTTCAGCATTTAATTTTAA
AAGTGTAGGAGGTAAATTTTCGACAGTCACTTTAGGTATAATTTATGAATTTCCATTAAAAGGTTATTAA
TATGAAAGCAGAAAAAGCAAACAGTAGTTTTAAAATTTCAGATGCTAAAACAACTATCGATATAGGATTA
TCGGAAGATGAATTGAAGGATGAATTAAAAAGTGTTCGTAAAAAGTTAGGTAAACTACAAGATACCCTAT
ATGCTCATGGAAAATATGCCGTATTAGTTTGTTTACAAGGGATGGATACGGCTGGAAAAGATAGTTTAAT
TCGTGAGGTTTTTAAAGATTTTAATACCAGTGGAATAATTGTACACAGTTTTAAAGTACCTAGTACAATT
GAACGTAATCATGATTATTTGTGGAGGCATTATATAGCACTACCTGCGCGAGGTAAATTTGGGATTTTTA
ATAGGACACATTATGAGAATGTTTTGGTCACTAGAGTACATCCAGAATATATTTTAGGGGAAAATATTCC
CCACATTAGTTCTGTTAATGACGTAGATGATAAGTTTTGGAAACAACGTTTTGAACAAATTAATGATTTT
GAAAAACACTTAACTCAAAATGGAACTCTAATATTCAAATTCTTTTTGCATTTATCTAAAAGGGAACAAA
AAAATAGATTACTCAGAAGGCTTGAAAAAAAAGATAAAAATTGGAAATTCTCACCTGCCGATTTAAAAGA
GCGCAAATTATGGGATGCGTATCAGGATTGTTATGAAGATGCTATTCGTAACACTTCAACACTTCAGGCT
CCTTGGTATGTAATACCAGCAGATCATAAGCCAGTGGCCCGATATCTAGTGGCAAAAACATTATATGACA
GTTTAAGTGCTTACACTGATATTCAAGAGCCTGAATTAGAGGAGGATGTTGTTTTTGAATTAAGAAATTA
CCTACATCAGTTGAAAAGCGAAAAATAAGGTTTTAACATTTTAGTAGTTTAAGTTGTTAAAACTTGTTTT
TTTGACATTTTTGTTGTGTTAAAATTGTTAAATCTGCATTTTGAAATCGATGAAAGGCAGAATTTGATAA
CATGTATTTTTATTTAGTTATCAAATTGGATAAAATTTATTTAGTATTTATAAATGTTTTTTTGGTTTTT
TGGTCTTTTGTATAAGTGACGAAAACATTTTCGAAAAACCTATTATGCTGAAAAACAATATTTTATGAAA
GAAAAATACTACACAAAATTAATGTAGTAATATTCTTACGTTTATAAAAGTGCTTACGATAAAAATGAGT
CTATTTTTAAGTTGAATGAAAAGTTTATGTTAATAAACTTTTTTGAAAAATAACTATAACTTAAAATTAA
ACTTATGATTCTTAAGAAATTAAGTTTGTATGCTCTAGCATTTTTTGGCACTTCGGGTTTTGCCCAATCT
AGTTTCAATTATGCTGAAGCACTACAAAAATCGCTTTTCTTCTATGAAGTTCAGCAATCAGGAGAACTTC
CTTCTTGGAACCGGGTGACATGGCGTGGAGATTCTGCGCTAAATGATGGTTCCGATGTTGGAGTAGATCT
AACTGGTGGATGGTATGACGCTGGTGATCATGTTAAATTTAATTTCCCAATGGCATTTAGCGTTACTGCA
TTGTCTTGGGGAGCAATTGAATATGAAGAGGCTTACAAAAATGCTGGGCAGCTAGATATTATTAAAAGAA
ATATCAAATTTGTTACTGATTATTTATTGAAATGTCACACAGGGCCAACAGAATTGTATGGTCAAGTAGG
TAATGGTGGTTTGGACCATGCTTATTGGGGATCGTCAGAGGTAATGGTAATGGATCGACCAGCCTATAAA
ATTTCGGCTTCAGCTCCAGGTTCAGATTTAGCAGCTGAAACTGCTGCAGCTATGGCAGCAGCAAGTATCT
TGTTTAAGGACTCTGATCCTGCATATAGTAAAACCTTATTAGATCATGCGAAACAGTTATATAAATTTGC
TGATGATTATAGAGGAGTCTACTCAGAGGCTATAACAGATGCAGCAGGTTTTTACAGATCTTTCAGTGGT
TTTCAAGATGAATTAGTTTGGGGAGCGGCTTGGTTATATCGAGCTACTAATGACGCTACTTATTTGGCTA
AAGCAGAATCAGAATATGATAACTTAGGTAATGAAGGTCAAAGCAGTAACAAGGCTTACAAATGGGGATT
GGCATGGGATGATAAGTCTTATGGATCTTATGTTTTAATGTCACAGCTAACGGGCAAAGATAAGTATAAA
GCTGATGCGGAAAGGCATTTAGATTATTGGACAGATGGTTTTAACGGTGATAGAGTACCTTATAGTCCTG
GGGGGCAGGCTCACTTAACTCAGTGGGGATCGTTGAGGCATTCATCAAATACGTCATTACTTGCTTTTAT
TTATAGTGATAAAGTAGAAACATCTGCTACCAACAAAAAGAAGTATCATGATTTTGCAGTAAGACAAATA
AATTATGCACTTGGTGATAATCCAATAAACAGAAGTTTTATGGTTGGTTTTGGAAATAATCCAGCTAATA
ACACACACCATCGTGCTGCACATGGCGCATGGGCAAATTCATTACAGAATAGACCAGACAAGCCAAGTCA
TACACTTTTTGGAGCATTAGCAGGAGGGCCAAGTTCTCCCAATGATCAGTTTGAGGATGATAGAGGAGAT
TTTATAGCTAATGAGGTGGCTTGTGATTATAATGCGTGCTTTACTGGAGCATTAGCTAGAATGTATAGTG
AATTTGGAGGATCTACTTTAGCAAATTTCCCAGTTAAGGAAACTCCAAGTAGAACTGAAATTAGAAGTTA
TTCTAAATTTAATAGTAATAATGCTTTCGGAAGTACAGTTAAAATTTTATTGCAAAATAGATCAGCATGG
CCAGCAAGAGTAATGGATAAGTTAAGTTATCGCTATTATTTTGATATTGCTGAAGGAGTAGCTGCGGGTA
AGACAATTGATGATTATGATATTCAATTAAATGGAGTTGGAGGATCTGCAACTATGTCAATCAAAAGTGC
AGGTGGTACATTGTATTATGCTGAAATAAGTAATATACCAAGTATTTCACCAATTGGAGACCCAGCTTTT
AGAAACGAAACTCAAATTAATTTTAGAGTATCAAACGGAGTGCCTTACGATACTTCAAATGATCCTTCAG
CTTCAGGCCTTACTGGATCAAGTGAAATTGAAAGTGTAAATATACCCGTTTATGATAATGGTGTCTTAGT
ATTTGGACAAGAACCAGACGGGACTACTACACCAGTAGATCCAGTAAATACAGCTCCAGTAGCTAGTATT
AATGCCGATAAATTTTCAGGAGAAGCACCATTAACAGTTACATTTGATGCAAGTGGATCTTCAGATGCAG
AAAATGATGCATTAACTTATGTATGGACTTTTGGTAATGGAGAAACGTCAACGGATGAAAACCCATCAAC
AATATATACTACAGCAGGATCTTATTTAGTAAGTTTAGTAGTAAATGATGGATTGTTAAATTCTACTGAA
GAAACGATAACAATTAATGTAAATGACCCAGCGGTTAATCCTGTAGTGGTAACTGGAGGAACATTAAGCG
GAGGTCCGTTCACATTTACAGTAGGTGATGGGGTTGCAGATAACGTATCTGGAGTAACAGTATCAGGAAA
TACTGGAGCAACAAGCCAATGGGTTGTAACTGATGAGACAGGAAAAATTCTTGGATTACCACCAGCACCA
GAAGCGGTTAATTTTGATGAAGCACCTCCAGGAACATGTTTTATATATAATGTAAGTTATAATGGAACAT
TAAATGGGTTGACTGTTGATGCAAATATTTCAGGTTTATCGGGTGATTTCCAATTATCTTCAAATAGAGT
AGAAGTGGTGCGTAATGCACCTATAGTTGTAACACCAATTACTGTTGCTGGAGGAACATTAAATGGAGGT
CCATTCACATTTACAGTGGGTGATGGAATTGCGGATAATGTATCGGGAGTATCGGTATCTGGAAATAGTG
GAGCAACAAGTCAATGGGTAGTTACTGATGAGGTAGGAAAAATTCTTGGATTACCACCAACACCAGAAGC
GGTTAATTTTGATGAAGCACCTGCAGGATCATGTTTTATTTATAATGTGAGTTTTAACGGAGCATTAAAT
GGTTTAGCTGTTGATTCAAATATATCAGGCTTATCTGGTGATTTCCAATTATCTTCAAATAGTATTGAAG
TAGTGCGTAATGCAGTAGTAGTGGTAACACCACCTACTGGTGATTGTACTTTTGGAGCGCCTATTGCAAC
TCCATTAGAAACTACTTATGGGTATTATACTAATATGTATGCTTTTGGTAGTAGTGCACCAAGTATGGGT
AACTTATCTGGGTTCTCATTTAATTGGGATTTAGCGAATAATGGATTGTGGAGTATTGCAATTCAGACTA
CCGATGGAAACCCTAGTTATTATGTGGATTTAAGAGATAAAACAACTCATAATTTAGGTGCAAGTCAGCC
AAGTATTACATTCGCTGGCACAGGAATTCCTGGTCTTGATGGAACATATTACACTGCAAGAGATGGTGAA
AATTTAGCTCTTGTATCTACTACAGCTGATTATACACTTTATTTCTCAAATTCATCTACCGCTCCAGATT
GTGGGGACGTTATTGATACTCCAATAGTAGTTAATGGAGGTACATTAACTGGAGGACCATTTGCTTTTAC
AGTAAATGATGGAATTGCAGATAATGTTTCGGGAGTAAGTGTAACAGGAAATACGGGATCTAATTTTGGT
TGGATAGTAACTGATGAAGATTTAAATATTTTAGGTTTACCAGGAACACCAGAGGCAGTAAACTTTGACG
AAGCTGGAGCTGGAGTTTGTTTAATATGGCATATTGCTTATGAAGATGGTTTGACTGGACTTACTGCAGG
AGAGAATGCAGGAAATTTAGTTGGTAACTTTGATTTATCAAACAGTATTCGTGTGGACAGGACAGCTGCT
ATACCATCAACTGTTGATGGAGGTACTATAGTTGGAGGACCATTTACTTTTACAGTAGGTGACGGAATTG
CGGATAATGTTTCGGGAGTAAGTGTATCAGGAAATACTGGATCTAATTTTGGTTGGGTAGTAACTGACGA
AGATTTAAATATTTTAGGTTTACCAGGAACGCCAGAGGCAGTTAATTTTGACGAAGCACCTGCAGGAGTT
TGTTTAATATGGCATATTGCTTATGAAGATGGATTAACAGGACTTACTGTTGGTGAAAATGCAGGTAATT
TAGCTGGTGATTTTGATTTATCAAATAGTATTAGAGTTGATAGAACAGGAACTAATGTTCCAACGCCAAC
GGTTGATGGTGCTACAGTTGCTACTTCAACTGGTGCTGTTGCAGTAGAAACAATTACTGGAGATGGTATT
GCTGATTTGATTAATTTCACAACAACAAGTACTGCTACGCTTAATTATTCATATTTAATTACGGATGCTG
CAGGTAATATTTTAGTTGTTGAAGCTGATTCTCATGATTTTGAAGGCGTATCAGTTGGAGTTTGTTTAGT
ATATGGTATTTCTTATGAAGGTACTTTATCTGTTACTGGAAAATCAATTACAGATACGGATTTAGCATCA
GGTGCATTTGATGTATCGGATAATTCAATTTCTGTAGATAGAAAAGATATACCAGTAGTGGTTGATCCAA
CAGATCCTACAACAGGAGGACCTGATGTAAATAATAAATATATCGAGCGTTTTACTGAAATGAGAAACGA
AATTTATGATCCAGCTAATGGGTATTTCAGTAAAGATGGTTCTCCGCATCACTCTGTGGAAACACTTATT
GTTGAAGCACCAGATCATGGTCACGAATCAACTTCTGAATTATATTCATATTGGTTAATGATGGAAGCTA
TGCAAGGTCGTATTACTAAAGACTGGCAGCCATTAGCTAAAGTTTGGAGTGAAATGGAAAGAATGATTAT
TCCAACTAAAGCAGATCAGCCAACAAATGCAGCTTATGATGCTTCTAGTCCTGCGGCTTATGCGGCAGAA
TTCCCTTTACCATCAGGTTACCCAGCACCTTTAGATTTTGGTGCAGCAGTTGGTCAAGACCCTGTTTCTG
CCGAATTAACAGCAGCTTATGGACCAGAGGTTTATCAAATGCACTGGTTATTAGATAATGATAACTTTTA
TGGATATGGAAATAGAGGTGATGGAACAAGTACTCCTTCATACATAAATACATTCCAAAGAGGGGAGCAA
GAGTCAGTTTATGAAACTATTCCTCATCCATCATGGGAGTCATTTGAATTTGGTAATTCAGAAAATGGAT
TCTTACCATTATTTATTTTAGATACTAATTATGCTAAGCAATGGAGATATACAAGTGCTCCTGATGCTGA
TGCACGTGCAGTACAGGCAATGTATTGGGCAGTTCAATATGCAAAAGAGCAAAGTGGAGCAATTGATCCA
ACACTTTTAGATAACACTAAAAAGATGGGTGATTACTTACGTTTGGCTATGTTTGATAAGTATTTCAAGA
AAATTGGTTCTCAAGACGAACAAGGTAGTGCAGGTACTGGATATGATAGTGCTCACTATTTAATGTCATG
GTACATGTCATGGGGAGGATCTGCCGATCCGGCTTCAGCATGGGCTTTCCGTATTAGTTCAAGTCACTGT
CACTTTGGATATCAAAATCCAGTTGCGGCATATGCGTTAACTACATTGGATGAGTTAGATCTTCAAACTC
CTAATGGAGAAAGAGATTGGACAACAAGTTTAGGGCGTCAAATGGAATTCTACAGATATTTACAATCTGC
TGATGGAGCTATTGCAGGTGGAGCAACTAATAGTTGGAATGGTGACTATAGTACTTATCCAGCTGGTAAA
TCTACTTTCTATGATATGGCTTATGATGATAATCCAGTATATCATGATCCAGGAAGTGGAACTTGGTTTG
GATGGCAAGCTTGGTCAGTAGAACGTGTAGCTGAATATTACTACATTACTAATGACCCATTAGCTAAAGA
GATCATGGATAAGTGGGTTGCATGGGTTAAACCTAATGTAAAATTAATTGGAAGCGATGATTTTGATATT
CCAGCAACATTAGAATGGTCAGGAGAGCCAGATACATGGAATGCAGCAAATCCTGGTGATAATGCTAATT
TACGTGTAACTGTTACTAACTTTAGTAAGGATTTAGGTATAGCATCTTCATTAGCTAAAACATTGACTTA
CTATGCGGCAGCAACAAGAAAGCATGCTACTTTAGATGAAGAAGCTAAAAATTTAGCTAAAGAAATCTTA
GATAGAATGTGGGTAACTTACCGTGATGATAAAGGAGTTTCTGCTCCAGAATCACGTGGAGATTACAAGC
GTATGTTCGAAGAAGTTGTTCATGTACCAACTGGTTATACAGGAACAATGGCTAATGGTGACGAAATTAA
AACAGGAGTTACTTTCTTAGATATTCGTTCTGGTTTAAAAGATGATCCTGAATATCCAGCAGTAAAAGCA
GCTTATGATGCAGGTGAAGACTATACAACTAGATACCACAGAACTTGGGCGCAAATGGAAACTGCTTTAG
CTAACGCTGAATATGGATTCTTCTTTGGTGAAGATGATGAGGCAGCTGGAGCAAAAGCTTTAGATGTTGA
GTTAACGGTGTATCCTAATCCAGCATCTGAATTAGTTACAGTTACTTATCCAACTGAAGAAGATGTTGCT
TTAAAAGTAACATTAGTAGATTTTGCAGGAAGAGTGATTACTACTCAAGAGTTATTGAATGAAAAATCAA
CAACAATTGATGTGAGTAACCTAGCTTCAGGAATGTATATAGTTCGTTTAGAAACTAAAGGAAATGTAAT
ACGTACCGAAAAGCTTATTATAAAATAAATTAATAGTAGTTTATTTGTTGAAAGAGGTTGACTTTTATTA
GTCAGCCTCTTTTTTTTATGTCAAATTTGTATTTGATTCTTGGGGAAACATTATGCCAAATATTACTGGA
ATAATAATACCTTAGCTTCAAAAAAAGTGCTTTCTAAATATATAAAGGAGTTCCCTGTTAATTTACGTTT
AGCTTACCCAATTATGATAGGTCAGTTAGGAAATGTGATGGTTGGTTTCATAGATAACGTAATGGTAGGA
AAATTAGGAGCTTCTTCATTAGCAGCCGTATCTTTAGGGAATGGACTATTTTTTTTGGCATTATCCTTAG
CAATAGGTTTTTCACTTAGTATCACTCCACTGGTAGCAGAAGCAGATGGTCAAAAAGATTATTTAAAAAT
AAGCTTACTTTTAAAAAATGGAATAGCATTATCAACCTTATTAGGTGGTGCTTTATTTGTTGTTATTAAA
TTATTACAACCTTTTTTAACATTATTAGATCAGCCAGAGGAGGTAGTGGTATTGGCCAATCCTTATATAA
ATATACTGGCATTTTCAATTATACCTTTGGCTATGTTTCAAGCTATGAAACAATTTTCCGATGGTTTATC
GGTAACTCGATATGCAATGATTGCCACTATAATAGGTAATGTGCTTAATGTTTTTTTTAATTATGTGCTT
ATTTATGGAAAATGGGGATTCCCAAAACTTTTATTAGAAGGAGCAGCGATAGGGACTTTAATTGCCAGGT
TTTCAATGGTGTTTTTTATGCTGCTAATATTTTATAAACAGCAAAATTTTAAAGTATATGTTAGCAATAT
CTTTTCAAATATTTTGCAATTAAATATTGTAAAGAACTTATTAAAATTAGGATTCCCAGCTGCATTACAA
ATGCTTTTCGAGTTTGGTATTTTTATTTCTTCAATATTTTTGTCTGGTTTATTAAGTACCGAGGATCAAG
CAGCGAATCAAATAGCGCTTAATGTAGCGTCTATTACATTTATGATAGCTGTTGGTTTAGGTGTAACCGC
AACAATACGAACAGGAAATCAATTAGGGAAAAAAGATTTTAAAGCTTTAATACGAATAGTGCGTTCAATT
TTATTATTGGTTTTTTTAATAGAATTTGTTTTTGCTATTGTTCTAGTATTTTTGAAAGATTATTTGCCTG
TTTTTTACATTAGTGATGTAAATGTAATTGCACTAGCTGCCAAATTATTACTCGTAGTAGCTTGTTTCCA
AATTAGTGATGGATTTCAGGTAGTTTTATTAGGAACACTCCGGGGATTACAGGATGTAAATATTCCTACT
TTATGTCTGTTTATTGCTTATTGGTGCGTAGGTTTTCCAATTTCATACTATTTAGGAAATCCTTCCTATT
TAGGTTCGGTGGGCATTTGGATAGGCTTATTTGCAGGTTTAACCGTTTCGAGTGGCTTATTATATATTCG
CTATTTGTATTTAAGTAAGAAGTTTAATTAATTGAGTAAAAGCATAAAAAAAGCCTTCTTTAAAAAAGAA
AGCTTTTTGATTTATTTTTAGGTGTATATTTATTTATACATCACTTTTTTTACAGCTTTAATAACATCTT
CATTATTTGGTAACCATTCGGCTAGCAAAGTAGGAGAGTAAGGAGCTGGAGTATCAGCGGTATTTATTTT
AATTACTGGCGCATCTAAGTAATCAAAACAATTTTGTTGTACTTGGTATGTAATTTCCGAAGCAATGTTA
GCTAATGGCCAAGCTTCTTCAAGTATGATAAGTCTGTTCGTCTTTTTTACAGATTTATAAATAGCTTCTA
AATCCAAAGGACGTACCGTACGTAAATCAATAATTTCACATGAAATTCCTTCTTTAGCTAACGTGTCTGC
AGCAATGTATGCTTCTTTAATAATTTTTCCAAAAGAAACAATAGTTACATCGTTTCCTTCTCTTTTTAAG
TCAGCTACACCAATTGGTAATACATATTCCCCTTCCGGTACTTCACCTTTGTCACCATACATTTGCTCAC
TTTCCATAAAAATAACAGGATCGTTATCACGGATAGCAGCTTTTAATAATCCTTTAGCATCATATGGGTT
AGAAGGTACAATAACTTTTAATCCAGGAGTGTTGGCAAACCAATTTTCAAAAGCTTGTGAGTGTGTAGCT
CCTAATTGTCCAGCAGAAGCTGTTGGTCCTCTAAAAACGATAGGGCAAGGGAATTGTCCTCCCGACATTT
GACGAATTTTAGCAGCATTATTGATAATTTGATCAATACCTACCAATGAAAAATTAAATGTCATATATTC
TACAATAGGGCGGTTACCGTTCATGGCACTACCTACAGCGATACCAGCAAAACCAAGTTCAGCAATTGGA
GTATCGATCACACGTTTTGCGCCAAACTCATCTAACATTCCTTTACTTGCTTTATATGCACCGTTATATT
CTGCTACTTCTTCACCCATTAAGTAAATAGATTCATCTCTACGCATCTCTTCAGACATCGCTTCGCAAAT
AGCTTCTCTAAATTGTATTGTTTTCATGTAAGTTTATAAATTTTAGCATCACATAAAATGAATGCTAGTT
TTAGTTACTCTAAACGCAAAAATAGTAAAACCACAATGTTGGGGCAAGCTACAAGCTTGGAATCTGTAAA
TATTTTTAAGATTAAATGGTGACTGTTAAAATTCGCAAAAATACTATGCATGCATAGTATTTTTGCGAAT
TAATTTGTAACTTCGTTTATATATAAGAAACCGCTTATAAAACTTTTGATTTGGTAATAAATTAAGAGTT
TATTTTTTAAGTAAGCAATTGATAGATTGATTATTCAAAAATAAGATATGCGTAGTTTATATGTGAAAAA
GTTAAAAAATACACTAATTTAAAATACTTACTGTGAAGATATTAGTTTGTATAAGTCATGTGCCAGACAC
GACTTCAAAAATCAATTTTACTGATGACGATACTAAGTTTGATACCAATGGAGTATCATTTGTGATTAAT
CCGAATGATGAATTTGGATTAACAAGAGCCATGTGGTTTAAGGAGAAACAAGGAGCTAGTGTGGATGTTG
TAAATGTAGGAGGTCCAGATACAGAGCCAACAATTAGAAAATGCTTAGCAATAGGAGCAGATAATGCGAT
TCGAGTAAATGCGAACCCAACAGATAGTTTGTTTGTAGCCCAAGAGCTAGCATCGGTAGCTAAAAATGGG
GGGTATGATTTAGTTATAGCGGGTCGCGAGTCTATTGATTATAATGGAGGTGTAGTGCCAGGAATGTTAG
CCGCTTTATTAGATGCCAATTTTGTAAATACTTGTATTAGTTTGGAAGTCGAAGGAACATCGGCTACAGC
TATTCGTGAAATTGATGGAGGTAAAGAAACCATAAAAGCAACCTTGCCTCTAGTCATAGGAGGACAAAAA
GGTTTGGTTGAAGAAAGTGATTTAAGAATTCCTAATATGAGAGGAATTATGATGGCTCGTAAAAAACCAC
TTAGCGTTGTAGAACCAACGGGTAGCGCTAGTCAATCTGAACCAAGTTCATTTTCTAAGCCAGCTCCTAA
GGGAAGTGTGACTTTAGTATCAGCAGATAATTTAGATGAGTTGATTAACTTGTTACACAAAGAAGCTAAA
GTAATTTAATTACCAAGGCTTTGATTATCTTTAAGTGATTGATTTTAACTGTAAATTATAGTTAATTTTA
ATTTTTTGTTGAATAAAATATGCTGAATTATTTAGCATGATAAAATATAAAATATGTCAGTTTTAATATA
TGCCGAAAGTGATAACGGAAGCTTACGTAAAGGAGCTTTTGAAGTAGCATCATACGCAAAAGGAGTGGCC
GATGCATTGGGAACTACTGTAACTGCGTTGACAGTGAATGTTAGTGATGTATCAGAACTAGGGAATTATG
GAGTATCAAAAGTGCTTCAAGTATCAGATAATGCATTAACTAAATTTCAAGCAAAAGCTTACTCAAGTAT
TATTGAGCAAGCTGCTAAAGCAGAACAAAGTAAAGTTGTTGTATTAAGTTCATCTACAAATAGTAAATAT
GCAGCACCTTTATTAGGAGTAGCATTAAATGCAGCTGTGGTTTCAAATGTAGTGAGTTTGCCAAAATCGA
CAAGTCCATTTGTAGTAGAGCGTACAGCTTTTACAAACAAGGCTTTTCAGGAAACACAAATAAATTCGGA
TGTAAAAGTGATTTGTGTATCAAATAATTCATATGGATTAAAGGAAACTAGTGTTTCTATTGAAGCAGAA
GCTTTTTCTCCGAGTGTGAATGGAGGTAGTTTAGAAGTAGTAAGTATTGATAAAGCTACTGATAAAGTAA
GTATTGCTGATGCAGAAGTCGTAGTATCTGGTGGACGTGGGTTAAAAGGACCAGAAAATTGGCATTTAAT
TGAAGATTTAGCTACTGTTTTAGGAGCTGCAACAGCATGTTCAAAACCCGTTAGTGATATGGGATGGAGA
CCACATTCGGAACACGTAGGTCAAACAGGAAAACCCGTAGCTACAAATTTATATATTGCCGTAGGTATTT
CTGGAGCAATTCAGCATTTAGCAGGGATTAACGCTAGTAAAGTAAAAGTGGTTGTTAATACGGATCCAGA
AGCTCCATTTTTTAAAGCAGCAGATTATGGTGTTGTAGGTGATGCTTTTGAGGTAGTGCCTCAGTTAATT
GAAAAGTTAAAAGCATTCAAGTCAACAAATTAATATTCTTTACAAAAAAGAGAAACTATATGAATTGAAT
TTTTAGCTGTAAGAATTTCGCTAAAAATGATAAATTCGTTTTTTTTATATAGAAACCGTATGAAACTTCT
TTTTTATACGGTTTTTTCTTTCTTAAATAGAAAAATTATACCGAATTTAGCTTAACATTGTTATCAATAT
ATGAGTTTAGTACGTTTAAACATTAGAGGGATTTCTTATAGTCAGACACAAAATGGGGCTTATGCACTTA
TTTTGAGCGAAATGGAAGGAGAACGGAAATTACCTATTGTAATTGGTGCTTTTGAAGCACAATCTATAGC
TATAGCATTAGAAAAGGAAATAAGACCGCCAAGACCCTTAACACACGATTTATTTAAAAATTTTGCAGAT
AGGTTTGATGTAGTAGTAAAGCAAGTTATTATCCATAAGCTTGTGGATGGTGTATTTTATTCCAGTATTA
TTTGTGAACGTGATGGCATTGAGGAGATTATTGATGCAAGGACGAGTGACGCTATAGCATTGGCTTTACG
TTTTAGAGCTCCTATTTTTACGTATAAAAATATATTAGATCAAGCAGGAATTTACTTGAAACAACAATCT
GATGGAGAATTTTTATCCGAAAATGTAGATGGTCCAGAAGAGGATTCAAGTGATGAGAAATCGGTAGAAC
TAGTATCGTCATCAGCTGATTTTAAAAATTTAACTGTTGATGAACTTTATAAGTTATTAGATAAAGCGGT
AACGGATGAAGATTATGAAAAAGCGGCCCGACTTCGCGATGAAATATCAAACAGAAACTAGCAGTCATTG
ACTGCTTTTTTGTATAATGTTTACAAATTAGTAATCTTATTTACTTTTTTTAAGTAACAATATTCACCTA
TTTTATATTTTTGTTTTTTCATAAATATATTATTCCAGTAGTTTACATTGGAATAAGCCTACACTCAATA
AAATGAAGCAATATTTAGACTTAGTGCAGCATGTAATGGATAATGGAGCTGTAAAAGGAGACCGTACAGG
TACAGGAACACGAAGTGTTTTTGGATATCAAATGCGTTTTGATTTATCTAAAGGCTTTCCTATGGTAACT
ACAAAAAAAGTACATTTTAAGTCTGTAGTATATGAATTACTTTGGTTTTTAAAGGGGGATACTAATATTA
AGTATTTATCAGACCATGGAGTACGTATTTGGAATGATTGGGCTAATGATAATGGGGATTTAGGCCCTGT
ATATGGTCACCAGTGGCGTAATTGGAATAATGAGGAAATAGATCAGATTAAGGAAATTGTTGAAACTTTA
AAAAAGAATCCAAATAGTCGCAGAATGTTAGTTTCAGCTTGGAATCCATCGGTAATGCCAGATACGTCTG
TTTCTTTTGAAGAAAATGTGGCTAATGGAAAAGCGGCTTTACCGCCATGTCATGCATTTTTTCAGTTTTA
TGTGGCTAATGGAAAATTGTCATGTCAATTATACCAACGTAGTGCCGATATATTTTTGGGAGTACCTTTT
AATATTGCATCATACGCATTGTTAACTGAAATGATGGCGCAAGTATGCGGTTATGAGGCAGGGGAGTTCA
TTCATACTTTTGGTGATGCTCATATATATAATGATCATGTGGAGCAGTTACAATTACAACTTTCTAGATC
GCCAAAGCCCTTACCAAAAATTAAAATGAACCCTAATAAAACAGATCTATTTGATTTTAAATTTGAGGAT
TTTGAATTAGTAGATTATGAACATCATCCGCACATAAAAGGTAAAGTTTCGGTCTAATCTTTTTGCAGTT
ATATAGGAAGACTATCCTAAAATAAGATCTCATAATTTTTAAAAGAGCTCAATATCAATAGTTTGATGTT
TGAGCTCTTTCAGGTTTAATAATGATTACTTATGCTATGATGTTACATAAGTAATTTGAATTATTTTACC
AGTTAAAAACAAATATTATTTTGTGCATTGCCGCCATACATTTTTCTTAACGCTCTTTTATCAGCTTCAG
TAAAATTATTAAAAGGCCAAACAGCCGGGTTAAAAGGAAGGTTGCCTGCAGAATTCATAATTGAATTTCG
ATCCCTATTAGGTGTTCCCGGAATATGTTGCCCTTTTTCTTGATTGTCAATTTCATTAGTATGTAAAAAT
CCTAAGTTGTGACCAATCTCGTGTCTTATCACAAAACGCATTCTTTCACCTCTTCTGGGGATTCCTTTAT
AAAAATCAGGATCAAAATAAACTGTTCGTCCTGGTTTTCCGTTTCTAGGTCTGTCAGCAGCTCCAGCTAC
CCCTTTTACACGCATTATGGTCATATCTGCATTGCCTCCATTTACTAAACGTAACCTTAAAAAGCTTCCC
CTGATTCTATTCCAGTCGTTTAGTGCATTTCGCACCTGGGTATTGATACTAGGGATTAAGTTTCTAACGG
TTACATCTCGGGCTTCACTACATCTCATAATACTATTAAATCGACGTTGTTTACCTTTTGGATCTGTATG
AGCAGCTTCAAGTATACTTTCTTTATCTACGATCATATCACCTCCCACAAGGTAGTGATTCCCTAGGTTT
TCAATTTTGTCTAGTACCGTATCATATCCCATATTTTGTAAGCCTTTAACAATTTCTGGAGATACTTCAT
TACTAACGGGAGTGAAATTAACAACAGGTAAATCTAAATTGGCTTCTTGGTTTTCTATACTTGTCTCTTC
GGTTGGTTGAATGTCTGCGGTGTTTTCATCCTGACATTGGACCATTAAAATAGCAGTTGTTGCTATTGCA
ACTATTTTAAGTTTTTTCATTCTTTGTGAATTTTTAAGTTAATTATTTAAATTTTGTTTGCAAACGACTG
ACTATTATAGTTAGTAATATAACGTTTGAGTACGTGTAAGACCCTATTGATGTAATAGTTAAAAAAAATA
TAATTTCAAGATTAAAAAATGGAAGGAGTTTATTTGAGAGATAAAAATTATTCAATTAGAACATATACCA
TTTAAAAAGTTAAAAAGAGGAGTATAGCCTTGGAATAAAAGTTGATTTTTTAAATTAAAAGTGGATTTAT
CGATAGAATTTTAATGTATTCATTGTACATAACGACTAAAAATTACTACGAACATACGAACAGTTGACTA
TATAACTGTAATGGATTTTTAAAAAAATCTCAGATATACGTACTAGTTAGGGTATGTTTTAGATTAATTG
ATACTTGAATTTTGAGTATGAATTTACTCACTTATTATTTTCGATTATGAAGAAATAAAAAAGTAATGGT
TTTCGTTTTTTAATGAATAACATTAACTAATTAACAAAACATTTATGAAGAAGTTATCGAGATTCGCATT
GGTCATGTTTTTGATCAATATGTTTATAATCGTTAGTTGTGATCCTACGGAGGATCCAGAAAACACACCA
GAAAAACCACCTATTGAAGACCCAGATGATGGAGGTATTATGAGGCCAGACGAACCTATGGTTCCCGTTG
TACCAACTAATCCAGAACCCGAAAAGCCGACTAATCCAGAGCCGGAGAAACCAACTAATCCAGAGCCAGA
AAAGCCGACTAATCCAGAGCCAGAGAAACCAACAAATCCAGAGCCAGAAAAGCCGACTAATCCAGAGCCA
GAGAAACCAACAAATCCAGAGCCAGAAAAGCCGACTAATCCAGAGCCAGAGAAACCAACAAATCCAGAGC
CAGAAAAGCCGACTAATCCAGAGCCAGAGAAACCAACAAATCCTGAGCCTGAAAAGCCGACTAATCCAGA
GCCAGTGATACCAACTGATCCTGAGCCTGAAAAGCCGACTAATCCAGAACCAGTAATACCAACTGATCCA
GAACCAGAACCGGAAAAGCCAACTAATCCAGTAAATGAAGGACAAAATACTTCATATACAGATGAAGTAG
ATCGTGAGCTTTTTAAGCAATTAAAAGGTCATGTGGATTACTATAATAAAAAAGAATTTTTTGATGATTT
TCTTTTTGAAAAATATCCTATGTATTTAGTGCAAACAGACTCGTGGTCTTTTAGTAGTGCGGGTAATGCA
AAAAAAGCTTTTGTAATTAACCCTAAAAAAGTGACTAGTGCAATGAAAAAATTAGGGTCTAATGAATCAA
TGGGATTAAATGTATATCGTTTTGATGATTCCATGAACAATGCTATGAATAGATTAGCTAATGGAAATGA
TTTTTTTACATTTAACTATTCGCTAAATAATCAAGAGGGATATTACTTGCAAGTGTACGCTAGAAACATA
ACATTAGGTAGAAATAATGAAACAGCGGTAACCACAATTACTCATGAAGCTTTCCATGCATTACATCAAA
AAAAGGGGCCACTTAATCCAAATTGGAAGTTCAATTTTGATGGGATTCAAGATAAATCATCTTTTCCGTA
TACTAGAGATTTAGTGGAGTTACAAATATTAGTTACAGAAGTGTTGATTGATTTCCCTAATGTTACCGAC
AAAAATGTGTTGAAAGAAAAATTAAAGCAATATGTAGCTATTCGATCTAAAGAAATGGAACTAGATCCTA
CTAGTCGAAAACTAATAAAAAATATGTCACTCAATCAAGAGCGTTCTGAAGGGGCACCACATATGATTGA
ATTTATGGGAAAAAGAGACTATTTTAAGAATAATGATAAATTCTTTGGAACTTTGTATGGGATTCCTATG
AAAGCTAAGGATAGAGCAGACCTAAAAGATATGTTGAATTCTGGGAATTTTTATCCTGTTGGGGCATCTG
TACTTTATGCTATAGCTAAACTGGATAAAGAAAGAATGAAAGACTACAATAGCAAAACACCTTTCCAAAT
GGCAAGTGAAATGTTAAATATGAGTGATAGTGAAAAGGAAGAAGCTATTGAAGCAGCTAAATTATCAGTT
GATTGGGGTGCCATTCAAAAAAAGGCAGCTGATTTTACTCCTTAAAATAACTAGTAACATCACTTAATAG
ATTTTTATAGACTAAAAATCATTTAAAACCTCTGGATAAATAGTAGTGTATTTTGTTCAGAGGTTTTTTA
TATAAAATAGAGGTTAATATGTATGTTGTTACTGTTTAGTATTTGCAAATCAATTATTCACAAAAAAAAA
TAAATCTTTTGTTCATTTGTTCTGAAAATCCTTAAAATAACATATCCATATAAAATCAATAGCTTTAATT
TAATAAGGATGAATACAAGGTTATAAAATAATTACTCTTAAACCATATAATCTCTTCTTGGTTAGCTTTA
GGGAAAAATAAGAACTAACTGTAGAATTAGAAATAACTCCAAGTTTATGGACATGAATACTTAAGTCTAG
CTTTGTTCAAGTAAAACTATATCATTGTGTATTGTTTTTATCCACAAAACTATTAATTAGGACGTAGTTG
TTTTTCGATAAATTGAATATTATATGTAAATAATAAGGCAGAAAGCTTATAAAAATTAGAGTTCTAACAC
TCCATTTTCGCCACCAGCAAAATCATTCCATATATAATTATCTGCGCTATCATCATTGACCCATGAGTTA
TTATCAACTAGGTATTTAAATTGAAATGAGTTTTCAATGGGTAAATTAATTGAGCCTTTAAAAGTACCGT
TTTTTAATTTTTTTAAGGGTAATTGAGTGGTTTCCCAATTATTGAAATCACCAGCAACAGTAACCGATTT
TGCCTCTTTTGCATTCCATACAAAAGTAACTTTACACTCAGGTTTAGATTTTAAAAATTGTTTTGAAATT
GACATAATTTAGTTTTAGTAATAAAAAATTCTATTACTAAATTTACAAAATAATTTAAAAATAAATTATT
GTTACTTATTTAGTTTACAGTAAATTAACATAAGTATTTGATCGAACTAGACTTTTTTAATACAATAGCG
ACTAAATTTTTGATGGTATTCATAAAATTTAGCCGCTATTAATATAATGTTCACTTATTATTTTTGTTTT
TTTTAATTTTTAATAAATAACAAGTCTTTTAGTTTCTACAAGCTTTTTGTGATCATTTTTAAAAATTAAA
TAATAAATACCACTAGCAACTGTACTCACATCAATAGTTGTTGTTGTAGCTAAAGGGTAGGAGTTAATTT
CTTTACCTAAAGCATCACATAAAATCACATTTTTAACAGGTGAATTTTTAAGATTTTCAATGCTAAGAGT
AGCTGTTACTGGTATGGGGTAAATTTTGAATTCTTCATCATGATCAGTGATATCATCAATACTAAGTGTA
TTTGTTTTTTTATGAATTGTTGGATTTAAAGATCCAATTCCCCTAGTAGCTTGCCAAAAATTGTAGAGTC
TTTTATCATCGTGATCTGCTTTTTGAGTGGTTACTTTAATTATGGCATCATATTCTTCCCATTCTTTTTC
TGTAAGGGCAGTTTTAGTTATAATTACCGTCAACATATTAAATTCTTTTTGTGAGTTTTTATATGAGGGA
TTTCTAGGGCCAAGATCATTTAATATTTTTTCTGGCGTATATCTTATTACCTCACCTGCTTTAAATGTGT
AGGAAGTAAAATCCCCAGTATCCTTATCTTCCTCAAAAGAAAAATCCGTTACATTTGAAAATGAATCAAA
TGGTGCGACTTCCTCTAAGGGAATCATCCCCATTAGATATAATTCAAATTCGTTATAGGGTACTTGATTA
CCTCCGTTGGCATTAAAACTAAACCCCGGAGTGGTAAAGCTTCCATCTTTGTTTTTAATTAAATCACTTT
GTTTAAAGCCCCCAAGTTGTCCAGGAGTACTCCCTCCGGTTAATCCCCAATGCCCTGGTATTTTACTAAA
AGTAAACGAACCGTCTTCATTTTCTTCTGAAGGGGCTTCCCCGGCAATGACATCAAAATTGCCCCAATTA
TGCATAATTTCATGTAAAAAAGGACCAAATAGCATGCCTTCTTTTTCAGGGAAATGCATTATTGATTTAA
GCACTCCATCAGAACCATAAAATTTTGAATCATCACTTTTATCATTCGTAAAACTAATGCCTTCAATTTT
ACTGTTAATTACATTATTAATTCCAAAATAGTCTATTTTGCCAGTTGTAGGAACTTCTTTTTCATTTAGG
ACAAAAACAATAAAATCATAGTTGTCTTCAAAATTATTGTAAAGCTCTTTTGTTAAGTTGGAAACAACTT
CTTTACTAGTAGTAAAGTCATCATTTTGTATCCAACTATCATATTCTTTTTCAGATAGCTGTAATGAAGC
AAAAGTGTTGTTGGAATTTACTTTAATAATGTGTTCTTGTGATAGCGCAACACTAACCGAAAGGCTGAAA
CCAATATATAAACAATTCTTGGCTTTGGATAATAAGTTAATTTTCATAGCATAATTTTTTTATTGATTAT
ACTTGTTAACCATATAGATATTGTGAAAATTGCTTGCTTGTAAATGAATTTTTACAAATGTTTTGATAGA
AAAAACTGAACTTAATAAGTTTTTGTTTTAATTGTTATGTGTTTGTAGGTTAATTAGTTAAATTGAAGGT
TTGTACTAGGTATTATATTTTTGTAGGATATCTCGCTATTGCTAAATGGAAGAGCATCCGAGTTAATTTT
GGGTGAAATTTATGTGTAAATTATCACCGATATTTTGATGATATTGTTTCCGTTTTCGTGAGAGTGTTGT
ATTTCGTAGGACTCGTCTTTTTTAAATTTCATTAGTAACAGAATAAAAAAGAATCATTTAAAGTGTTTTG
TGAGGTGTATTAAAAAAAGGAAAGTAATTATGTTAAAAATTCCTAGCTTTGATGTATTAAGATGTAATAG
ATTAAAAATATGTTTTCAAGGTCAAAATCCAAGGAGTCAACTATTGATTTAGAGCAAAAAGAGCTTTTTG
AGCATGCTCAGGCACGCATAAAAGAAAAAAAAGGTTTGTACAGGCATTTTATTGTTTTTTTAGTGAGCTG
TATTTTTATGATTGTATTAAACCTGGGACTTAATTTTGGAAAAGAATATAAGTTTTTAGAATTAGATTGG
TTTGTATTTGGTGTATTAGGGTGGTCTTTTTTCTTTTTAATACACTTTTTTAGAGTAGTGCTCTTTAGTA
AGTTTATGGGAAAGGAATGGAAAGCGAAACAATTGGAGCGTTTAGTGGCTAAACAAAAAGCTAAAATTGC
TAAAATGGAACAAAAATTGAATTTAGAAATTCCAAAGGATATAGTATCGGAAAAAAGTATTTTATTAGAT
AATACAGATTTAAATGATACTGAAAAATTACAATAAATTATGATAATACTTATTGCTGCGGCAGCTGAAA
ATAATGCATTAGGAAAGGATAATGATTTGTTGTGGCATTTGCCAGATGATTTTAAGCGTTTCAAAAAATT
GACTTCGGGACACCCTATTATAATGGGAAGAAAAACTTTTGAATCCCTACCTGGCATGCTGCCCAAAAGA
ACACATATTATAATAACACGTCAAGATGATTATTTTAAAGAAGGTTGTTTGATCGCAAATTCATTAGAAC
AGGCCGTTGAGCTAGCGGGTACTAGTGCTAAAATTTTTATTATTGGTGGTGGCGAAATTTATACACAATC
CTTGAAAATAGCGGATAGTATTGAATTAACTCGAGTACATGCAAATTTTGAAGCGGACACTTTTTTTCCA
GAAATTGATACAGAACAATGGGAGTTAGTAGATAACGAACAGCACGAGGCAGATGAAAAACATACCTATT
CGTTTTCCTATTTAACCTATGTAAAAAAGTAATAATTTTCTAAGTAAAGACAAATTAAACCGACTATACT
CATTCATTCAAGTTATGATTTATGAAACCGTTTAGCTTATTTCTTTTTTTATGTTGTATTACAGCCATGG
TATCTTGCGCAAAGCAAAAAGAAACTAAGACTGTTGTTGCTTTGGAATCTTTAGAAAAAAATGGAATAAA
AACGCTTGAAGATGCTATTAAAGGTGAAGAATTCACAGATTCAATAGAAATAGAGGGAGATGAGGACTTC
ATAGAAGAAATTAAGGAAAAACCTTTAGTTGTAAATGATGAAGAGAAAGTAGTTGTTGAAACTTTAAAAA
ATACCGAAAAACCAATTAAAAAAAAGGATGCTACAAAAGGAGTAGTCATTGAAGAAGAGATAGCAACTGT
TCCTGTCAAAGAAATAGGCTCCAAAAATGAAAAAGAAGGAACTTCTAAAAAAGTACAAAAAATTGAAAAA
GAAAGTACTCAAGTTCAACATAAAGTAGCAAAAATAGCAACAAAGGAAGTGGAATCGATTGGAGCAATGG
AATTTGATCATACTTTATTTGATGCTTTTTTAAATAAATATGTTTCGTCAACAGGTAATGTAAATTACAA
AATGATGAAATCGCATCAAATTGAGTTGGAAAGCTATATTAACTCACTCCAAAATAAAACATTAAAAACT
ACTTGGACTACTAACCAAAAATTAGCTTATTGGATTAATGCCTACAATGCCTTTACATTAAAGCTAATTT
TAGATCATTATCCTGTAAATAGTATTACAGCTATTGCAGGTGGAAAACCATGGGATAAAAAGTGGATAGC
GCTCAATGGGAAAATGTATTCATTAAACCAGATTGAAAATGATATTATAAGACCTCAATTTAAGGAGCCA
CGTATTCATTTTGCAGTGAATTGTGCCGCAAAGTCATGTCCTAAATTGGGTAACTTTGCTTATACAGCGT
CTAATTTGAATGCCAAGTTAACGAGTCAAACAAAAGCGTTCATTAATAGTAATCTTAATCAAATAAGCGC
TACACATTTAAAAATATCTAAAATATTTGAATGGTATAAAAGCGATTTTGGAGATTTAGTTCCATTTATA
AAAAAATATTCTACGGTTGTAATTAATGATAATGCGACTGTTGAGTATAATGAGTACGACTGGAGTTTAA
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTTTAGCTACATTTGTGTTT
CAAAATTTATAAAAATGAAAGCATACGTTTTTCCAGGTCAAGGTGCTCAATTTGTGGGTATGGGAAAGGA
TCTTTATGATAACGCTCCAATAGCAAAACAACTATTTGATAAGGCTAATGAAATTTTAGGTTTTTCGATA
ACTGATATTATGTTTGAGGGAACTCCCGAACAATTAAAAGAAACTAAAGTTACTCAGCCGGCTATATTTT
TACATTCGGTAATTTTAAGTAAAGTATTAGGGGATGATTTTAAGCCAGATATGGTAGCTGGACACTCTTT
AGGAGAATTTTCGGCATTAGTAGCCAATGGAGTATTATCTTTTGAGGATGGTTTAAAATTAGTATCGCAA
CGTGCTTTAGCTATGCAAAAGGCATGTGAAGCTTCGGCTTCAACTATGGCTGCTGTTTTAGGTTTGGACG
ATGAAGTAGTGGAGACTGTATGTAATGAAATTGGAGCAGAGGTAGTGCCTGCAAATTATAACTGTCCGGG
GCAATTAGTTATTTCGGGTGGCGTGGATGCAATAGCAAAAGCTTGTGAGATATTGAAAGAAAAAGGAGCT
CGCAGAGCTTTGGTTTTACCTGTTGGTGGAGGTTTTCATTCTCCATATATGGAACCAGCTAGAGCAGAAT
TAGCTGCTGCTATTGAGGCAACAACTTTTAATGAGCCAGCTTGTCCAATATACCAAAATGTAACTACTAC
TGCAGTAAATTCTGCGGAAGCAATCAAAGAAAATTTAATTGCACAATTAACAGCGCCAGTGAAATGGACG
CAAAGTATTCAGCAAATGATTGCTGATGGAGCTACATCATTCACAGAAGTTGGACCGGGTAAAGTATTAC
AAGGTTTAGTGAAAAAGATTGATAGAAGTGCCGAAACTTTTGGAGCAACGTTATAACGTAACTATCTATA
AATTTCATACTATAAAAAAAGGAGGCATTGCCTCCTTTTTTTATAGTATGAAATTCCCTTATTAAATCAA
AGATCTAAATACAGCTTATTGTAAGTTTTAGAAAAGTAAGCGGTTACTTTTTGATTTTCTTTGTATTTGT
TACAGTCCTTTTCGTTTTTAAAGAATATATAATAGACTTGTCCTTTATAGGCTACGGCGACCAAACTTTT
ATCGCCTTTAAGGCGCTGTTTGCAGTTTACTTTTTCTATGCTAGCTTCAACTTGAATAGCATCTTTTCGG
GCTTTATTATCGGCAGTATTAATTTTTAGGAACCATACAATTCCAGTAATAACTAATAGGGAGATAATTA
AACTCATAATTTTCATTTTATATTATTTTGTTACAAAATCAATTACTGTTTTGGTAATAAAAGCTATCTG
TTCATCATCTAACTCGGTATGCATTGGTAATGAAATTACTTCTTTAACCAATTGATTGGTTACAGGAAAA
TCGGATTCAAGGTAGCGCTTGTCCGTATATGCTTTTTGGGCATGTAATGGAATTGGATAATAAACACCAC
AAGGGATGTTGTTTTTATTTAAATGAGCTACTAAAGCGTCCCGATCCGCATCTTTTACTTTTAATGTGTA
TTGGTGAAAAACATGACAATCACATGTATCACAAATGCCTTCACATTTGGTATGTGTCACTGGTGTTATT
ATTTGAGGAATATTTTTAAAAGCATCGTTATACTTTCTGGCGGAAGCCCTACGTGCATTATTATAAGTGT
CTAAGTTTGGTAGTTTTGCTAGTAAAACAGCAGCTTGAATAGAATCTAAACGCGAATTTACCCCAACTAC
ATCATGGTGATAACGTTGATACATCCCATGATTTACAATACCTCTTATGCTATGTGCAAGCTCATCATTG
TTAGTAAAAATAGCACCACCATCACCATAACAACCTAAGTTTTTTGAAGGGAAAAAGGATGTTGAGGCCA
CGTGACCTAAATTTCCGGTTTTCTTTTTTGTGCCATTAGCAAAGGTATAGGAAGCACCAATACCTTGGGC
ATTATCTTCGATAATAAAAAGATCATGCTTTTTTGCAATGGTGGTAATAGCTTCCATATTGGCAGCTTGT
CCAAATAAATGTACAGGAACAATAGCTTTGGTTTTAGGGGTAATCGCCTTTTCAATTGCTTTTGGATCAA
TATTAAAGGTATTTGGATCCACATCAACAAGTACGGGTGTTAATTGTAATAATGCAATAACTTCGACAGT
GGCAGCAAATGTAAAATCTGCAGTGATTACTTCGTCACCTGGTTGTAAGCCCAAGCCCATCATAGCTATT
TGTAAAGCATCGGTTCCATTTGCACAAGGAATAACATGTTTTACATTTAGGTATTTTTCTAATTCCTCCT
GAAATTTGTGTACTTGAGGACCATTGATATAAGCGGTGTTGTCAAGAACTTCTTGTATGGAATTGTTTAC
CGTATTTTTTATTCCTTCATATTGACCTTTTAGGTCAACCATTTGTATTTTTTTCATAAACGAAGTAAGC
TAACTATTGAAGCCAAATGAGTTTGATGTACTTGTATTGGGCGTAATGTCAAAAATACGAAATATAGTAG
TTTTGTTCAATTGTAATTTTTGAAAATAGCATATTTAGTTATAAACCTAAAGCCTGCTATTGTATTATTA
AGTTTATCAAATGTTTAAAGCGTTAAATACAATGACCTGGTTAAAGTAAATAAAGCAGTGATTAATTTGT
TAGTTTTTGATCCTTTTGATTTGTATAAATTGTAACTTACTTTTATTGTTATACGATTTACTGATAAGAA
TTTCGTATAAATATGTTGAATTATTTTTTGCTAGTCTAAGGCAAAAAAATCAAGCATAGCCTTTGCTACG
GTTGTTTTTTTTAACGCAAGAATTGTGAAAAAGAAACAGCATATATGCGAAATTCTTATCAGTAAATCGT
ATTAGTGTGTATAGTACTAATTAAAGTTTTACCACCATGAAAAACGAAAAACGAAGAGAATTTATAAAGC
AGCTAGGATTAGTAGCAGGTTCAACAGCCCTATTACCATCATTATTATCTTTTGATTCCATAATAAATAC
ATATAAAAAAGAGGGGTCTCAAAAAAAAATAAATGTAGCCCTTTGTGGATTGGGGAGGTATGCTAAAATT
TTAGCAAAAGGTTTAGAGCAAACCAAGCAATGTAAATTAACAGGCTTAGTAACAGGAACACCCGAAAAGG
AAATTACCTGGGGGCAAAAGTATAATATCCCTAAAAAGAACATTTATAATTACGATAATTTTGATTCAAT
AATTGATAATAAAGATATTGATTTGGTTTATGTGGTACTCCCTAATTCCATGCATAAAGAATTTACAATT
CGAGCAGCAAATGCGGGTAAGCATGTTATTGTAGAAAAACCTATGGGGTTAAATGCCTTAGAGTGTGTTG
AAATGATTGATGCTTGTAAAAAAAATGGAGTACAACTGGCGGTTGGTTACCGTCTTCATTATGAGCCACA
CCATAAAGAAATAAAAAGGATGGGGCAGGAAAAAGTTTTTGGGAATATTCGATATATAGATGCGTCTTTA
GGTTACCGAATAAAAGGTTGGAAAAAGGATGCATGGCATCTAAAAAAGGCTATGTCTGGTGGAGGACCAC
TTACAAATATTGGTATTTATTGCGTACAAAGTAATCGGTATATTTTAGGCGAAGAGCCTATTGCCGTTAC
AGCTCAATTTGGACCTGTTCAACGGCCTGATTATTTTAAAGAAGTTGAAGAATCTATTACCTGGCAACTT
GAGTTTCCAAGTGGAGCAGTGACTACATCGGCAAGCTCCTACAGTTATAATGTCGACAGATTATATGCCT
CTGGTGACGATGGTTTTTTTGAATTAGAACCAGCATTGAGCTATGGGCCATTTAAAGGTAAATCGAGTCT
AGGCACTTTCAATTTTCCAGTAATTAACCAACAACAAGTACAGTTAGATGAAATTTCAAAATGTATTTTA
AATAAGGAACCTTTACCCATGCATATTAGAGGCGAAGAAGGTCACAAAGATATGTTAGTCATTGATGCGA
TATACAAATCAGCTGCTACTGGTAAAAAGGTGGTAATTTAAACAAGGCAGTGAATGATAAATGATTTATT
AATTCAAAATATAAAAAAAAACGTATCACTTCCGGATACTGATTTAAAACGTATCTGTAATTATTTTAAA
CCCAAAACCATTCCCAAAAAAGAGTTTTTATTAACTCAAGGAAGCATTTGTAAATTTGAAGGTTTTGTAC
TTGAAGGTTGTTTTAGGATTTTTATTATTGATAAAAAAGGGCATGAAAATACATTATACTTTGCTGCCAA
GGATTGGTGGGTTATGGATATAGATAGTTTTATGAATCAGAAACCATCGGATTTGAATATACAGGCTATA
GAAGATAGCAAAGTTCTTTTGATTACTAGAGAAGACAAAACAGATCTCTATAATTCAGTTCCATCCGCCG
AAAAACTATTTCGTATTATGTCTCAAAAGTCCATAGTAGCCTGGCAACAGCGGCTTATAAGAAACCATTG
TCAAACAGCAAAAGATCGATATAATTATTATATAAGTACCTATCCCGATATTGCATCTAAGTTGACAGAT
AAGCAAATTGCTGGTTATTTGGGTATTACTCATGAGTTTTTGAGTAAAATCAAAAAGAAATCTTAAATCC
AATAAAATTTTATCAAGTTGAACTTGTTCAACTATTTTATTAGACTAGTTTATAATTTTTGCAGTATTAA
ATTAAAACAAAAATGATGAACTTACTAAGGTCTGCTAGAAGTTGTGCTATTGCTTTTATCCTAACATTAG
CGTGTAATGGTGGTTATGCACAAATTACAAATGATATTACTCATGATGAAGCTTTTAAAGTGCTTTTAGC
AGCAAAGAAAAAAGCAGAACATTCAAATGTATTAGTAAATATTGCTATAGTAGATGCCGGTACAAACTTA
AAGGCATTTATTAGAATGGATAACTCTTTTATAGGAAGTATTGATGTAGCCATAAAAAAAGCAAAAACAG
CACGCTATTTTAATATAGATACAGGGAAATTAGGCGAGTTAACACAACCTGGCGGTATTATTTATAACAT
AGAGCATTCTAATGGAGGGCTAATTACTTTTCCTGGAGGAATACCAATTAAAAATAAAAATGGTGAAATT
ATAGGTGCGATTGGAGTAAGCGGAGGTACCATAGAACAGGATAGAGCAATTGCTAGTGCAGGAATTAAAG
CAGTAATAGATTAACTAAATTTAAAAAAGGTTGAAATGAAGAAAATCTTAAAAAAAATAATTTTTGGAAC
AGTCTTGTTGGTATTACAAATTTGTAGTGCTCAGGTTTCTAATGAATTAATGCTTTACAGAAAAGATTTC
AAGGATATATCTGGCAATAATACTGTTTCTGTGACAAGTTATCAAAAGGGAGATGCTCATTTTGTATTTG
CAGGCGGAATAGGAAATATAGATGTATATAGTTTAAATAAAAATGGAGAACTCACCCCAATTAGTAACCA
TGAATTATACAAAGGAAAAGGGCCAGCAAGGGGTATGGTCGCAGATTCTATTAATGGTAACGACTTTCTA
TTTGTAGCAAATAAACATGGAAATGCGATTGAAACCTTTAAAATTTTGAATAATGGGGCTCTCGAGCGCG
TTTCTTTGGTAGCGGATACCAATAAAACTCATCTTGGTACAGCTATTACATTACAGGTAATACATATGAA
AGAATCGTCGTATCTCTTTATTGGCGGTTTAGAAGAAACACCTGGTTTGAGTAGTTTTCAAATACATGAT
GATGGGAAGCTAACCCATGTACAGTCGATGGAGGATAATGAAATTATTCATACTGATGGAGTAATAGGAA
TGTATACTCATAAGATTAATGGAAGGACTTTTTTGTATACAGGAGGATTCCAGGATAATGGAGTAAGTAG
TTTTAGGGTTTATGAAAATGGGACATTTAAAAATATTAATAATATAAGTGATAATACAAATGATAGGTAT
TTAACAGGAACTTATCCAGTAACGGGTGTTACTTTAGGCAATAATAATTATGTGATTGTTGGTCATAGGC
ATCATAAATATTATAAGAGAGCAGGCTTTATAAAAAAAACAGATTTTGTTTACCATGGAGATGCAGTGAG
TGTGTTTAAAATAAATAAAAAAGGGGCTTTAATTCCTCACTTTGTTTTAAAGGATGATGAAACCACCAAG
TTACAAGGGCAAACTAGAATTGAAGTTGTTTCAGTAGCTAATAATGAAGCTATTTTGGCGGTAGGGACAA
GAGATGATGCGAGTATACAGTTGTGTAGATTAAATAAAGAAGGGATTCTTAGTCCTATAAATTATTTAGA
GACTGGTTTTTCAATTTATTATGGTTTAAGGTCTCATAAAATAGGGAAGGAAAATTTTTTGATAGCAGGT
TCTTTTAGGTTTGATTTGAAAAAGATAGTAACCTATAAAATAGCCCCTAAAATCAATAGGGAAGGGAAAG
TTTTAAGGCATATGGTAAACCTTAAATATAAAGATGGTATTGAAGAAAGTAAAGTAAATGAAGCGGTTAA
AAACTTTATGAATTTAAAAAATGAAATCCCAGAAATAGCTAGTATAGAATGGGGTATAAATGATAGCACT
GAAGGGCATAGTAAGGGATTAACTCATTGTTTCACTTTAACTTTTGCAGATGAACATGCTAGAGAAATAT
ATTTATTTCATAAAGCACATTTACAAATGGTAAGTAAAATTAGTCCCATTATAGCGGATGTTTTGGTATT
AGATTATTGGACAAAATAATGATAGTCAATTTTTAATAGGCTTTTGTAAGGATATTAGCCACGCATATCT
AAATCACGTAATTCGTTCAATTCTTTTTGTTCAAATTTTTCACGTGCATAATCAAAGCCTTGTTGCCACC
ACTCGGTCATTAGTTTTTTGTTAAATACTAATGAGTTTTCGGTAAGCTTCGTCGGGGTATAATAAAGGTT
AAGCGTGGCATTTTTATTTTTGGCAGCAAGTTTACCAGCCGTTACATTATGTTGTTCTACTTGATCTAAT
AAATAACCGAATAGATTTACCATTAATGAAAATGGGTTTTTACCTAATATTTTATTCCTATCTAAATTCT
CGGATTCTAATATAACCGCGTCTATTTCGGTAGCACCACGTTTTATAGCTTCGCGGATAGGAACTATGGC
ACCAAAGCCCCCATCGGCATACTCGTAACCATTTTTTTTGGCAATACTCATAAAAGGGATGTAGTTACAG
GATATCCAAATCCATTCACAAAAATCTTCATAACTAAATTCGTGGATGGATTTATATTCAGTACAACTTT
TGGATAAGTTAGAAACCGTAACGACAACATCGGTTACATTTTTTCGGGCAAATTCAAATTCTTCTCGCGT
AAAGTTTTTACGGATGTTTTTACGTAAATTTTTACTTTCGCCAAAGGTGCGTTTTCGTTTAACAAATTGT
AAAACAGTGTTTAGGTAATTAATACTCACATATTCTCGGTCCCCTTTATGTTTTACCACAAAAGGATTCA
AACTAAAAATAGTATTTTGATTTACATTAGTATAAATATCATGTACTTTATCTATTTTATTAATAGATAA
ATGAGGGATTAATAAGCTACCTGTGGAGGTGCCTAAAAATAAATCATATTTGCGTTGTTGTACCTGCATA
AGGTATTGTGCAACTCCGCCTGCAAAAGCACCTTTACTCCCACCTCCCGAAATGACTAATGCTCGCATTT
GTTTTTTTATTTGTTTTATTAATGACTAAGATATAAAAATCATTTACTAATGTAAATCACTTAATCCGTC
GTTAATAATTGTTTTACCTTATTGGGAAACGTAGCAGAAAGGCGATTTATTCTTTGCGTATATTTTTCAT
TAGCATAAAGCGCTTTAAGTGTAGTGCTACAATTCTTTTTAAATCGCCAATTGGGATGTGTGGCACCTAA
GGCTAAATTTTGTAAACTTTGATCGGAATAGCTTTGGAGCAATTTTAAATATTCAAAAGCTTTACTGCGT
AATCTGTAATGATGATTTGGAGCCGTATACGAATTGAGTTCATTAAAAAATCGGGTACGATCTGTAGTGC
TAAACCCTGGAGTGTTTAAGGCAAGGACAAGCCAAAGTGTTCTTATATTTTTATCATTAAAACCAATTAA
GTTTTTTGTAGCTTGTAAATAATTCATTTTTTTAGCCTCAAAATTATTCCACAAATTATAAAGTGCGCCT
TCCACAGTGGCGTATGAATCTGCTTTTAATAGGAGTGCCATTTTGGGCTCAAATGCTTTGGGAATAGTAG
TTAATGAATTAGCTAAGGCTTGTAAAACTTGAGGTTGATTACTTTCGAATGCTTTTTCAAGTAATAAGAG
TGCTTCTTTCGAAAAATCTCCTTGTAATTGAGCAACTACTTCTTGTCCTAAATAGGGATTTACAGGAAAA
TCTAGAGCATCCGATAGTAATTGATATTTTCCAATAAGCGGTTGAGTGCGTTCACCAGCCAATTGCAAAT
ATCTTTTCATAACTTCCGATTGCGTTATAATTTTTAAAGCTTCTCCAGCAGGGAAAGTCGTATTATGTAA
CCATTTTTTTGCAAATTCAGAAGTGTCTTTTCCTGTTACTTCAAAAACAATACTTAAAAAGTCATAGGTG
GTTACATTTTTATATTGGTGTGTTGTTAAAAATTGCTGGACTACTTTTTTAAAATGAGCATCTCCTATGT
TGTTACGTAAAGCTACAATAGCCCAAGCCCCGTGTTGATAGTAAGTAAGGGAACTCCCTTTTGGAGTAAC
TAAGGCTTTTCCTTTTTGTAAATCACTTTGATGATTTAATTGCTCTGCACTTTCATACAGTTTGTAATAA
AAGTGATCTTCGCCAAATAGCTCTTTTTCGGCTAATAAGGCGAAATAAGTGGCAAAGCCTTCGTGTAACC
AATGGTGATTACTATCTGTTTCGGTAATGATATTTCCAAACCATTGATGCGCTAACTCATGAGCGCTCAC
ATTTACAAAATTTTGATCGTCAAAAGTGTTTGTGTCTACAATAAAATCATCAGAAAATAAGGTACATGCT
GTGTTTTCCATCCCGGCATATAAAAAATCACGTACAGGAACTTGCCTGTATATTTTCCAAGGATAGGGAA
TACCAATTTCAGTTTCTAAAAAATCAAAAACTTTTTTGTGGTAGTTAAAAGTTGACTCGTAATCTGTTAT
TCTATCCGAATAGATATAATTTTCTAAAGGAACTCCCGAAGCGCTTTTTTCTTCTTTTTTTAGGTATTTA
CCAATGGCAAGTGCCACCAAATAGCTACTCATAGGTTGTTGCATTTGGTAAACCCATGTAGTAGTAGTAT
TTGTGGTTGTTTTATGAATTAAACTTCCGTTAGAAATTACTTGGTAGTCTGTATTAAAATCAATTTTTAG
TGTAAAAATGATTTTATCATTCATATCATCAATACTAGGTAACCAGTTACTCGTGTATTTACCTTGTCCT
TGTGTCCATATTTGTTTATGATTTGGTGAATTGGGGTCAATATTTTTGGCATCCCAACCCCAAAAATAGA
GCGCTTTTTTTGGTGTTGTACTATAATTGAAACTAAAGGAATAAGCTGTATTGGCTTTAAAATCCCCCTT
TAACCAGATCTTATTGTCCTTGTATTCAACTTTAGCATCTTTAATGGGAGTAACTGTTTCCATTTTTTGA
GCATCCAAATAGACTTGATTAGTGTTTTTTAATGGGGTAAATAAAACATCGATTTTTCCAAATACCTTTT
GGTTTATAGTGTCGAGTTGTATATGTGCTTCAATAGTTTTAAAATCAACAAGATCTTTTTGTTGGGCCCT
ACTATAAATAATGCTTGCGCAGAAGCTAAAAATAAGAGAAGTGATTTTTATGAATTGGCTCATATACATA
ATACAGTTTACGGAGGGACAAATTACAAAAACCAATTTATAATACATGCTAAAAAATGTATCTTAGCATG
CTATGAGTGCTGATATATTACAATCACCCGTTGCCTATGTAAAAGGCGTTGGCCCAACTAGAGCCACAGT
ACTAGAAAAAGAATTAGGAATTCGAGTATGCCAGGATCTACTACATTTTTTTCCTCATCGGTACATTGAT
CGTACCCGATATTATACGATAAGTGAATTGCAGCAAAATGATGCCGAAGTTCAAATTGTAGGTATGGTTA
CACAGTTAAAAAATGTAAAACAAAAAAAAGGAGGCAGTCGTTTAGTGGCTACTTTTCAAGATAAAACGGG
AAAAATGGAACTGGTTTGGTTCCGAGGAGCTAAGTGGATTCAAGAAAGTATAAAGATAAATGTTCCTTAT
GTAATTTTTGGAAAGACAAAATATTACAATGGATTTTCCATGCCACATCCCGAAATGGAATTGTTGGATG
CCCATAAATCGAGTATGAGTTCCATTATGCAACCGATTTATTCGTCGACCGAAATGTTACAACGAAGGAA
TATTACCAACAAGGTAGTTTCTAAAATGGTGCAAAATCTGTTTTTGACTAAAGGTGTTTTTTTTGATGAA
ACGTTGCCAAAGAATATCTTGGAGCATATGAAGCTTATAGGGAAGTCTGAGGCATTATTAAATATACACT
TTCCGAAAAGTCAGGAGTTGTTAACTAAAGCGAGTTACCGATTAAAGTTTGAAGAGTTATTTTATATTCA
GTTACAATTAATTCGTAAAAATATTCTGCAAAAGCAAAAAATAAAAGGCTATGCATTTGAAAAAGTAGGG
GAATTATTTACTAACTTTTATGAAAACTATTTACCTTTTAGTTTAACGGGAGCCCAAAAACGTGTAGTTA
AAGAAATCCGTAGGGATATGGGAAGCGAGGCTCAAATGAATCGATTGTTACAAGGAGATGTAGGCTCGGG
GAAAACCATAGTGGCTTTAATGAGTATGTTGTTGGCTATTGATAATGGTTATCAGGCTACACTTATGGCA
CCAACAGCTATTTTGGCAAAACAACATTTTGATGGTATTTCCGCATTAGTGAAGGATTTGCCTATCCATG
TGAGTTTACTCATGGGAAGTACAAAAACTAAGGCCAGAAGAGAAATTCATGCAGATTTAGAAAACGGACA
AATACATATTATAATAGGAACACATGCCTTGTTAGAGGATAAAGTGAAATTTAACAATTTAGGCTTGGCT
ATCATTGATGAGCAACACCGTTTTGGCGTAGCCCAACGTGCTAAATTATGGCGAAAAAATGAATTACCAC
CTCATGTGTTGGTAATGACAGCAACACCTATACCTAGAACTTTAGCAATGAGTTTATATGGGGATTTAGA
TGTTTCGGTAATTGATGAGTTACCTCCAGGACGTAAGTCAATAAAAACAATGCATAAATATGATGGACAA
CGTTTAAATGTATTCCATTTTGTAAAACAAGAAATTGCTAAAGGAAGGCAAATATATATTGTATATCCAC
TAATTCAAGAATCCGAGGCAATGGATTACAAGGATTTAATGGATGGGTTTGAAAGTATTTCACGTGATTT
TCCTAAGCCAGAGTATCAAATTTCCATTGTACACGGGCAAATGAAACCTGCAGATAAAGATCATGAGATG
GAACGCTTTGTTAAAGGAGAAACTCAAATTATGATAGCCACTACCGTAATCGAAGTGGGTGTAAATGTAC
CAAACGCCAGTGTAATGATTATTGAGAGTGCAGAGCGTTTTGGCTTGTCACAATTGCATCAATTACGGGG
TCGGGTAGGGCGTGGAGCCGAACAAAGTTATTGTATACTAATGTCTGGTTTTAAACTGTCCGAAGATAGT
AAAACACGTTTGCAAACCATGGTGCAGACTAATGACGGTTTTGAAATTGCTGAGGTGGATTTAAAATTGC
GTGGCCCGGGGGATATTATGGGAACACAACAAAGTGGTGTATTAAACCTAAAAATTGCCGATATTGTAAA
GGATAATCAAATTTTGCAGGTAGCTAGGGCTTATGCACAGCAAATATTAAAGGAAGATCCAAACTTAGTA
TTACCAAAGAATAGTATGATTAAGCAAGCCTATGCTCAGTTAATACAACACAAGAATATCTGGAATTATA
TTAGTTAGCCTTATTAATAAAGGGATATAATTAGATTGTTTGCTTTGTTTTTTTTGAAGTAAAAGGATAA
AATACTAATTTTTAAATCACATGTTATGGCGGCATTTATCAAATTATACGAAGAAAATCCGAATCCTAAG
CAAATAGCAGAAGCAGTTAAAGTGCTAAAAAATGGAGGATTAATAATTTATCCAACAGATACCGTTTATG
GACTAGGCTGTGATATTACCAGTGTAAAAGCTTTAAATCGTATTGCTAAAATAAAAGGGATTAAGCTTGA
AAAAGCCAATTGGTCTTTTATTTGTAAAGATTTGAGTAACCTGTCCGATTATGTGCGCCAGATAGATTCA
TCTACATTCAAACTATTAAAAAGATGCTTGCCTGGACCTTTTACATTTATCTTACCCGGAAACAATCAAT
TACCATCAGTGTTTAAAAAAAAGAAAACAGTAGGGATACGTGTCCCCGATAATAAAATATGCCATGACTT
AGTAGAGGCACTTGGTAATCCTATAGTATCCACATCAATACATGATGAAGATGAGATTTTGGAATACACA
ACAGATCCTGAGTTAATATTAGAAAAATGGGGAAATTTAGTAGATTTAGTTATCGATGGAGGTTATGGTG
ATAATATACCATCAAGCATTGTCGATGTAACTGATAATATCCCCGTAATTGTAAGAGAGGGAAAGGGTGA
TACAAGCTTAATTTAGAATCTATTATTGTTTACTTTTCTTTTTTGAATATATGTTAATTTTTTTTGTCAC
TCATTGAATTATAAGTAGTTTTTTTACGTGTTAATTTAATGTTAAATTGATTTATTTTAACCTTGTGAAA
ATGTAAAGGGGTAAAATAGCATCAATATTGGTAAATTCTATATATGCTTTTTGGGTAGTTATCATAGTAT
TTTTGGAGTGTAGATTAATCGTATTAATCGATAAAAATTTTACTTATGAAAAAACTATTGAAATTAGGAT
TGTTAAGTGTAGCACTTGCATCATCCGTTATAGCAAATGCCTCAAATAAAGTTAAAGTTGAAGTTTTAGC
TTCAAATGAGTTGAGTATCACTATGTCGGAGGTGGTTGAAGGAGAAGTATTATCAATAACAAATAAAAAA
GGAAAGTTAGTATTTTCTGAAATATTAAGCGCAACTAGCTCTTACACTAAAACTTTAGATTTTTCAAAGT
TAACTCAAGGCGTATATTATGTAAAAGCAGAAACCGAAAGTGCGGTGAAGGTAACTCCATTTATTATAGT
TCCAGATCAAGTTAAAATTATAAAAGGAGCAACTAAAACGTATAATGCACCAGTTTTTAAAGTTGAAAAT
GGTATTGCTGAGGTGAGTATTGATAATAAAGATTTACATGATGTGTCTATTACTGTATATGCTAAAAATA
GTAGTATTCCATTAGAAGAAGTTAGATTGAATACGCCAAAAATAACAAAGACATATAACTTTGAGTCATT
ACCAGTTTCTGAATATAAAATTGTTATATATCAAGGAGATTATAGTTATGTAAAAACAGTGAAACGCTAG
TTTACAAATTTCATAAAGTAAAAAAAAGCCTTGTACAACCCCAATGTACAAGGCTTTTTTATGCGTTAGT
ATTACCTAATTCGGATTTCGTTTTAGGGTTGTTTGTTGTATTCTTCTTCTGTGTGTTACGTGTCATGATA
AAAAACTAATTACGGAGGTAGGTATAAAAGACGCTACCTAACTATTAAAAGGGAGTGAATCTTTAGTTCA
CCATAGCATATATCATAAGTTTATAAACATAATTTTATGTTTAAAAAAGGGGGGGGCTTAATTCTAAATC
TAATTGTCACATTTATAATACATTCAGTAGTGACCTGTGATAATAACTTAAGTTTGTTAGTTTTTTGAGA
TGTTAAAATGATTGTTTAATCCACTTAATTAGTGTTTTTGGTTAAAATAGCATCAATATAGGTAAATTCT
ATGTCTGTTATGAGGTGGATGTCGGTAGTACATTTGCAGTGTAAAATTAATCGAGTGAATCGATAAAAAT
TTCACCTTATGAAAAAAATATTGAAATTAGGATTGTTAAGTGTAGCACTTTTAACAACTGTGGTAGTAAA
TGCATCAAATAAAGTGAAGGTTGAAGTTTTGGCTTCAAATGAGTTAAGCATCACCATGTCTGAAGTAATC
GAAGGAGAGGTGCTTTCGGTTTCTGATAAAAAAGGAGAAGTTGTATTTTCTGAAATATTGAGCGCATCAA
GTTCTTATACAAAAACCTTAGACTTTTCAAAATTAACTCAGGGAGTATATTATGTTAAGGCAGAAACTGC
TAAGGCTATAAAAGTAACTCCATTTATTATAGTGCCAGATCAGGTTAAAATTGTAAAGGGAGCAACTAAA
ACATATAATACACCAGTTTTTGAAACTGAAAATGATATAATCAAGTTAGATATAGATAATAAAGATCAGC
ATGAGGTATCGATAACAGTATATGCTAAAAATAGCAGCATACCATTGGAAGAAGTGAGGTTAAATGCTCC
AAAAATCACAAAAAATTATAATTTTAAATCATTACCAGTTTCGGAATATAAAATTATAGTTTATCAAGGA
GATTATAGTTATGTAAAAACGATAAAACGTTAGTTTTTAAATTTCGTAAAGTTAAAAGCCTTGTACTCCC
CCAAAGTACAAGGCTTTTTTTTGTCTTATCAGTTAGTTTTATGATATGGTAAAATTCATTTCTTTTCGGT
AATCAGTTGGTGTTTTACCAGTGTATTTTTTAAAGACTTTGTTAAAGTGTGAAAAGTTATTGAAACCACA
TTCAAAACAAATTCCTTGAATGCTCTCTTGTTTTTCGGTAAGTAATTTTGTGGCGTGCACTAGTCGGTAT
TCATTAACAAATTGAGTAAATGTTTTGCCAGTTACTTTTTTGAAATTTCGGCAAAAGGCAGGAGGTGTCA
TATTTACAAAATCTGAAATTTCTTCAATACTAATTTGCTTTTTGAAATTTTTTTGAACATAATTAAATGT
ATTATTAATACGACTATTGTCTTGCGCTTGAGCTTTTAAAACAAAGCCTTCAGCATTTAATATTTCAAAT
TCTTTGGATGCTTCAAGTTTGTGGAGTATAAGTAAGGAGTCTAATATGCGTTCAAAAGGAGATTTTGAGT
ACATGTTTTCAATAATGGCACCCACCTCTTTTTTTGTTTCTCCAAAAAAAACAAGGCCTTGTTTGGCTCT
ATCTAGTAAAGCATTTATGGGGTTCATTTCAGATACATTAAAAAAATCCTTGCCTAAATATTCTGGCAAC
ATTTGAATTACTGTTTCATTTCTGGTTTTGGAAAATCCATCGGTAAAACCACAATGCGGTAAGTTGGCGC
CGATACAAATTAAATCACCATTTTGATAGTAAGATACGTGACTTCCAATTTGTCGTTTGCCAGAGCCTTC
ATTCACATATACAATTTCTATTTCTGGATGGTAATGCCATATAGGTTGCTTGTTTTTGTTTTCAATATTA
AATCTCTTGTATATCAAAGAGTTGCCAATATCGGGAGCAAGATGCTCAAAACTGGGTTTATTATAATTAA
TTTTTTGTTCCGTCATTATAGTGAGCTTAATAGAATGTTAAATTGACAATAGTTGAATGTTATTTTTAAT
ATAGGGTTAATATAGCATAAATATAGGTAAATTGTGATGATATATCATACTTGTATTCGATTGTATATTT
GTAGCGTACATATTTAATAATCAATTAAATAAACACACTCATGAAAAAACTATTTAAAGGAGGATTGCTT
AGTGTAGCACTTTTAGCAGCCGTAGTAGTTAATGCAGCCGAAAAAATGAACGTAAAAGTTTTAGGTTCAA
AGGCACTGAACGTTTCTTTATCTGGAGTAGCAAAAGGGGAGTCTTTGTCTATTGTTGATAAAAGTGGAAT
TACGTTGTTTTCAGAAACATTGAGTCAGGCAGACGTATTTGAAAAAACTTTTGATTTAACCTATTTGCCA
GAAGGAGTGTATTTTTTAGAGTCAAATGAGGAAAAAAGAATAAATGTATCACCTATTCTTATAGCAAATA
ATAAAGTTTCATTAATTGCGGGTGGATCAAAAGTGTATAACGAACCTAGGGTTGTTGTCAATGGTTCCAT
TGCAAAGGTGGTTTTGGATAATTCTTCAAAAACAGATGTAGTGATTACTGTGAGAGATGCTGATGATTCA
GAATTGTTAAGATCTGAGGTGTTAACCGCAGAAAATATATATAAAAAGTTTGATTTTTCTGCCTTACCTA
AAGGAGAGACTTATACTATTACAGTTAAGGAAGATGATTATTACTTTATAAAAGAAATTAATTTATAGTT
AGTTGTTGTTAATACATAGAATTAGTTGTTAAAATAGCCTTCTTTTTTGAGGGCTATTTTTTTTGTTGAA
AATGAATACCATAAATTATAATTATTATGATTTAATTTTGTGATGAAAATAGGATTAAATCCTATTTTTG
TCAAAAATAGCAATACATGGCAGGAAACAGTTTTGGAAAAGTATTTAAGTTGACCACTTTTGGTGAATCA
CACGGGGTAGCTATTGGAGGTGTAATTGATGGTTGTCCAGCAGGCGTTACTATAGATTTTGATGCTATTC
AAGCAGAATTAGATCGAAGAAAACCAGGGCAATCAGCCATTGTAACACAACGAAAGGAACCGGATACTGT
TGAGTTTTTATCAGGTATTTTTGAAGGTGTAACTACAGGGACCTCAATAGGTTTTGTGATTCGAAATGCG
AATCAAAAATCAAAAGATTATTCACATATAAAAGATTCTTTTCGTCCGTCGCATGCAGATTATACCTATT
ATAAAAAATATGGAGATGTTCGCGATTATCGAGGAGGAGGACGTTCTTCAGCACGAGAAACAGCTTCACG
TGTAGTAGCAGGTGCAGTTGCAAAGCAGGTGTTAAAGGGAGTGTCTTTTAATGCCTATGTTACTGGAGTA
GGACATTTAAAATTAACTACGCCTTATAATGAATTGGATCTTTCGGCAACCGAGTCTAATATTGTGCGTT
GTCCTGACCAAAATATGGCTAGTGAAATGGAAAGCTACATTAAGCAAATTAGAAAAGAAGGGGATACCGT
AGGAGGTGTGGTGAGTTGTGTAATTAGTGGTGTTCCTGTTGGTTTAGGAGAGCCTGTATTTGATCGCTTA
CATGCCGAATTAGGTAAAGCAATGTTGTCTATAAATGCGGTTAAAGGTTTTCAGTACGGTAGTGGTTTTG
AAGGATCTGCTTTAAAAGGAAGTCAGCATAATGATCTATTTAATGCAGATGGTACTACAAAAACAAATTT
ATCCGGAGGTATACAAGGTGGAATATCTAATGGAATGGATATTTACTTTGATGTAGCGTTTAAACCAGTG
GCTACAATTATGCAGGATCAACATACGATAGATAAAGAAGGGAATATAGTTGAAATGCAGGGAAAAGGAA
GACATGATCCTTGTGTTGTGCCACGTGCTGTGCCTATAGTTGAGGCTATGGCAGCTCTAGTGGTTGTAGA
TTATATGTTGCAAAATAGAGCAAGTCAAGTCTAACATATTATGTTTCAAAAAAGACATAAAAAAAACTCG
TAAAATTTATTTACGAGTTTTTTTTATGTCTTGTTTTGTTTTTAAGAACTTAAAGCTTCACTTAGTGCCG
CTTTTTTGTGTCGACTAACAGGAATTTGTTCTTGGTCAATTTCTATATTTCGGTTATTGTAGCGTTCTAC
TTTCTTCAAATTTACAATATAGGACTTGTGTACCCTTAGGAAACGTTCGCTTGGCAATTGGGACTCAAAT
GACTTCATAGTGGCTAAAACAACCACAGGGTCACTGTTATCCATAATTAATTTAACATAATCACCTAAAG
CTTCTACATATTTCAAATTATTTAAAAATATTTTTCGCTTCTTTAAATTGCTTTTTACAAAAATATAATC
TTCATTTTCTGCCGACTTACTTGTAGCAGCCATTTTTGTTTGACTTAAAGCTTTTTCAACTGCAGCATTA
AAACGATCTCTTTTTAGTGGTTTACGCAAATAGTCTATAGCATCATAATCAAATGCCTTAAATGCATATT
TTGTTTTTCCAGTAACAAATATGGTCTTTGGTTTATTCTCTAAATCATCCAATAAATCAAAACCAGTTAG
AATTGGCATTTCAATATCTAAAAACAATAAGTCAACAGGAATATCCAATAATCCATTTTTTGTTTCAATG
GCGTTGTTCCACTCTGCTACTAGTTCTAAAGAGGAATGTTCCTCTATAAGTTTAACTATAGCAAGGCGTT
GCAACTTTGAATCGTCAACAATGGCACATTTCAGAATGGAGTTATCTTGCATATCTATCTAATTAGTTAT
ACAATACTAAATAATAAAATCCAATATCGCAAGAAAAAACGTGTTTTGTCGGAAAAAAGTGAGTTTTGTC
GATGTATAATAATCGATGAAAAGCACTTGTATATTTGACTAAAAAGCTTACTTTTGCAGTCTTAAAATTT
AACAAATAAAATTTTTTTTATGAATCATTATGAAACTGTTTTCATCTTGAATCCCGTTTTATCTGAAGAA
CAGATAAAGGAGACAGTTAAGAAGTATGAGGATCTTCTTACTGAAAATGGAGCAAAGATGGTAGCTAAAG
AAGACTGGGGTCTTAAAAAATTAGCTTATCCTATTCAGCACAAAAAAAGTGGTTTTTACCATTTATTTGA
GTACACTGTGTCAGGTGAAGTTATAAACAAACTTGAAATTCTATTTAGAAGAGACGAGAGAATAATGCGT
TACCTAACTGTAAGCTTAGATAAGCATGCAATTTCTTGGGCAGAAAGAAGAAGAGTTAAACTTAAACAAA
AAGCTTAGTTATGGCATCTATAGAACAACAAGCTAAAGGAAAAAAAGATGGAGAGATCAGGTATCTTACT
CCATTAAACATTGATACTAATAAAGAGAAGAAGTACTGTCGTTTCCAAAAATCTGGAATCAAGTATGTTG
ATTATAAAGATCCAGACTGGTTATTAGGTTTTTTAAATGAACAAGGTAAAATTTTACCAAGACGTTTAAC
AGGAACTTCTTTAAAGTACCAACGTAAGGTAAGTGTTGCAGTAAAAAGAGCTAGACATTTAGCTTTATTG
CCATATGTAGCTGACTTAATGAAATAATCGACCAAAACAATGGAACTTATATTAAAAAAAGACGTTGAGA
ATCTAGGATTCGCAGACGATATAGTAGAAGTTAAAAATGGTTACGGTCGTAACTTTTTAATTCCTCAAGG
ATATGGAGTACTTGCTACTGTTTCTGCTAAAAAAGTATTAGCAGAAAATTTAAAGCAACGTGCATATAAA
GAGCAGAAGTTAGTTGATGATGCGCAAGCATTAGCTAATAAACTTAATGGTCTTGAAATTAAAATTTCTT
CTAAATCAGGAGCTGGTGGTAAATTATTTGGATCTATCACTAATGCCGATGTTGCTGATGCTTTAGCTAA
AGAAGGAATTTCTATTGAAAAGAAATTTATCAGCGTTCCAGGTGGTTCAATTAAGCGTTTAGGATCTTAT
GAAGCTCCTGTGCGTTTTCACCGTAACGTAATTGCAAATGCTGCTTTTGAAGTTGTTGCTGAAAAAGCAT
AAGTATTTGAAAAAATAAGAAATAAGGCTATCTTGAAAAAGATGGCCTTTTTTTATGTCAATCAAAATAG
AGAAAACAAGTAAAATGAAATACGCTCGTTTATCAAAAGAACAATTAGAAGCTTTACATCAAGAGTTTAT
TAATTTTTTAGCAACACAATCTATAACAGGTGACGAGTGGGCTGAAATTAAAGCAAATAAACCCGAAGTT
GCAGAAGAGGAAATTGATGTTTTTAGTGATATGATTTGGGAAGGTGTTTTGAATAAAGTGGAATTTTTAG
AACATTTTTCAAAAGATCAAATTCATTTGTTTTTCCTTACGGAAGAAAAAATGCATTTAATAGCTATTAA
AGTAAAAAATAAGGCTATTGATTTATTAACCGATGAAGGTTATAAGTGGTTGCAGCAAAATTTAATGGAT
GATAGTGTGGCATTTTTTAATGCAACAAAGGAGTATACCGAAGATAAAAATGTAGATAAATTCAAAATTA
TCGAGCAAGGAGCTAATATAACCAAAGGAGATTTGTATGCTTACTTTGCAAAGTTATTAGATAACAAAAA
GGATTAATGGAGTTGTAGTCTGTATCTTATGATAGCTTTATTGCGGCTATTTAAACCCGAATTATGCATT
AAAAAATCTATTACGTCTGCGATCTACTTCAAATACTATCGTAAACTGTATTTTTTAATTTAACCATAAC
GGTGCTATGCTGAAATTAAGAAAACACTAGTATTTATTGTATATCACAGCCTCATGACAAAGTTTCAATG
CATAATTCGGGTTAAACAAACAAAAGCCCTTTTTTCAATGAAATAAGGGCTTTTTGTTTTAAAGGTATCT
TGTTTGTTGTTTAGCTTTTCATAGTTACAATACGCTGTGGCAACGGAGCGTCGTAGTTTGCTTCTCCAAG
GGCTTCTACAATTTTTTGACGTGTATCCCAATATACATCCCAATAGTCATCAGATGTAGAGTAAGGTAGT
GCTAATAATTCAACGCCGTTCGGACCTAGATTATTTACAGCTACTCTAGGAGCAGGATCCTTCATTACTT
TGTCATCGGCTTTTAGTACATTCATTACTACTTCTTTTGCTTTTTTTATGTCTGTACCATACTGAATTGC
AAAAGGCATATCAACTCTTAAATGTCCAATTGTGGTTAGGTTAGTAATAGCTGCTGCCGTGATAGATCCA
TTTGGTATAATTTCAGTTTTGTTTTGAAAAGTTTCTAATATGGTAACAAAAACAGAAATTTCCTTTACAA
AACCTAGTTTTCCGTTAGTTTCAATTAAGTCGCCTACTTTAAAGGGTCTAAAAATAAGAAGCATAACACC
TGCGGCCATATGCCCTAATGATCCGTTAAAGGCACCACCAATGGCTAAACCTACAGCTGCAAGTAAAGCA
GCAAAAGTAGCAGTCGGTATCCCTACAATTCCAGCAATGGAAATAAATAATAGTACTTTGAGTAAAAAAC
CAACAAGTGTAAGTAGAAAAGGTTTTAAAGTGCTATCAATTTTACTGGTATCAAAAGCTTTGCGAACGGC
TTTTAGAATAACTTTTATAATCCATAGTCCAATAATAAGTGCTACTATACCACCTACTATTTTAAGGCCA
TATTGTGCAACGCCTTCTTGAAGTGAATTAAATAATCCGCTCAGGGAATTCATAACATCGCTGCTGGTTT
TTGTGACATTTTGGGTAATGCTCTCTTGCATAGTAATAGTTTTAATTTAAAATTTAAGTTCTATTAAATT
TCATAAAACTAATTGTAAATCAATATGTTTTGGTGTAAATAATTAAAAATATTAGATGAAAGTGTAGTTA
AATTCGTTAAAAATCCAAGAATAAACTTTTGATCTCGTCATTTGGGATCATGCAGCTTTCTTTTTTTCCG
AACCATTTATACCTGTTTTTGGCAATAAAATCATAAATGGGATCTCTCATTTTTTCTGGAAAAAACAGAA
ATATCCTTAGCAATGGGTATAGGCCAGATAGTTCTTTTGATATTTCTAATGCAGCTGTAGATTTAAAGTA
ATAAGCTTTTTTAGGGTCAATAAGAATTATGGAATCTATGATTTTTGGGTCAATATTTCGCTCAGCTAAT
AATTCTTTACCCAATTCACTTTGTAATGAGGCATATCGAAAATTTCGTTTTTTATCATGTTTAATCATAA
ATTGTATGGCGCCACTGCACAGGTTGCAAACGCCATCAAAAAGAATGATTTTTATGTCTTTAGGGAGGTT
ATTGTAGTCCAAGTTCTTTTCTTAAAGGGGTGAATTTATTGGAATTTTGATTCCAGTAAGGTAATAATTT
TGTCGTAATTCTTTTAGCAGTTGTGGGTAAGTGAGGTGAGATTTCTTCACTCCAGCTTTCAATAATATAC
GGGAATTGTTGTTGGAATGTAATTTTTAAGCTCCGTTTTAGTTCTGGATATGTTAAAGAGAATGTGTTTA
AATTGTTGTTTTTTTGGATAGATGCTATGGCTTTATAGCTTTGCGTTTTTTTGTGGTTTAATCTTAAAAA
TTCAAAGGAAGGAATGCAGTTTATTTCGCCTTTAGGTAATAGTTTGTCACCATGTATTCGAATTAGATTC
CATAACTCGTTTTCAAGGATGCTTTTTTGTAATGATAATTTTTGATCTCCTTCCGATGCAAAGTATGATT
TTATATCTATTTCAAAATTCTTTTTGTTGTTAAGCTGCATAAAAGTTTGGCCACACCATTCTTGAATACT
AGCAGTGGTTTTAAGTGCGTGTTTTTTTTCTCCCTTTAAAGGGGAAAAAGAACTTTGCATAATACTATAA
GGGTATATGCCTGTAGTAAACTTTTTAACACTGTTAAGTTTGAGTACAGGGATGTTTTTTGGAGCTGAAA
TGTCAGCCTTTACTTGTTTTATTGGTAAAAAATCTTCGGTAACATAAATAAGTGTGGCAGTTCCATTACG
TAATTCGCCATACCTGTTTTGAGATAATTCATAGGTGGAAATCTCGGCTTCTCCTTGGTACCAATAACTT
TTAAAATCGCTAGTTAGCTCAATTGGATTTGGTCTGTTTTTGGAGCTTTCCTGACAATTTACTAGGTGAA
TACTTAGTAAAAGACTTATGGCTATTGGCGTAAGTGATTTTTTCATAAGCAGTAAATCAGGGTTAGGAAT
TCGCAAAATTATTTTTTTTTTAAATTACAAAAGCATGTTAGTAAATTACGACTAGTTTAAGGTTTTGTCA
ATGCAATTAACGTTTCGTAAACAATATGCGTGGGTAAACCAACTACATTAAAGTAGCTTCCTTTAATTTT
ATCAATACCAATAAGTCCAATCCATTCTTGGATCCCATAGGCGCCAGCTTTATCAATCGGATTGTAGTTG
GTTACATAATAATCAATTTCTTCAATAGTTAATTCTTTAAAGTGAACCTTGGTGGTGAAATGTTTAGTTA
TTTGTTTGTTTTTAGTGGTAAAACTAACAGAGGAAATGACATCATGCCAGTCATTGCTTAAGCTGGCTAT
CATTAGTTTAGCGTGTTCTGCGGATTGTGGCTTGCCAAGTGCATGGTGATTGTGCCAAACAATAGTATCG
CTAGTAATTAAAATATCGTTATGTTGTAAGCGTTGTTTAAAAGCTGCGGCTTTTAGTTCGGATAAATAAT
TGGTAATTTCTTCAGCTTTTAAATGATCTGGATAAACTTCGTCAACAGGTTGTAGTTGGATCTCAAAATC
AATTTCGAGGTCTTTTAAAAATTGTTGTCGTCTGGGAGATCCAGAGGCAAGAATGATTTGATGATTTTTT
AGTTTTTCTTGAAGCATTTTGAGTCGAATTAAAAGGGTTACCTGTGGTGATAGGGTTCATTTTTTAAAAT
AGTAAAACCGCGGTATAGTTGTTCGATAATAAATAAACGTACCATTTGATGCGAAAAAGTCATTTTTGAA
AGAGAAATTTTTCCATTGGCTCTTTTGTAGATAGTCTCGCTAAATCCATAAGGGCCACCTATAACAAAAA
ATAAATTTTTGATGCCACTATTCATGTGTTTTTGAAGGTAATTGGAAAAATCCACTGAATTGAATTGTTT
ACCATTTTCGTCCAAAAGGATAAGTGTATCAGATGTGTTTATTTTTTTTAAAATAAGTTCACCTTCCTTT
TCTTTTTGTTGAGTTTCGCTTAAGTTTTTAACTTTTTTTAAATCAGGTATGATTTCAAAATTGAACTTTA
TATAAAAACTGAGGCGTTTTTTATAGTCTTCAATTAATTGGGTTAATTGAAGACTGTCGGTTTTTCCAAT
AGCTAATAATGTAATTGTCATTGAAACAAATTCGGATTACTTTGTACATTAGCAAAAATAACGATACCAA
ATGATAAGTAAGGAGCAATTTAACCATGAAATAGAATTAATCATTGCTAATGCCATTCGTGAAGACGTTG
GTGATGGAGATCATAGTTCATTAGCATGTATACCAAAAGACACTCAAGGAAAGGCAAAACTATTGGTGAA
AGACGAAGGGATTTTAGCAGGAGTGGCGTTTGCTAAACAAGTTTGTGCTTATGTAGATCCTAATCTTGAA
ATTGAAGTGTTAATACCAGATGGTAGTGCTGTTAAGTACGGAGATATTGCTTTTTATATTTCTGGAAGTT
CATTAGCTATTTTAAAAGCTGAGCGATTAGTGTTAAATGCTATGCAGCGAATGAGTGCTATAGCGACTAA
AACTAAGTTTTTTGTTGATTTATTAGCGGGTACAGGAACAAAAATTTTAGATACCAGAAAAACCACGCCG
GGAATACGTGCGCTAGAAAAATGGGCAGTAACCATTGGTGGGGGTGAAAATCATCGTTTTGCATTATATG
ATATGATCATGCTTAAGGATAATCATATTGATTTTGCAGGAGGTATTACACAGGCTATTAATCAAACAAA
AAGCTATTTAAAGGAAACCGGCCGTGATTTAAAAATAATAGTAGAAGCACGCGATTTAAATGAAATTAAA
GAAATTTTAAAATCCGATGGGGTATATCGTATTTTAATTGATAACTTTAATTACGAAGATACGCGTGAAG
CAGTTCGATTAATTGGGGATACCTGTTTAACAGAATCTAGTGGAGGAATTGATGAGCATACCATTCGAAA
ATATGCTGAATGTGGTGTCAATTATATCAGTAGTGGAGCGTTAACGCATTCGGTATATAATTTAGATTTA
AGTTTAAAAGCAGTATGATTTGTCATTTAAATTAACAAAAATAGGATTAAAAATACCAGGGGTACTTTTG
TTAACTAAAGTGCTTAAAAAAATTGTAATACCGGGTTTTGAAGGACTTTCAATTTACGATTTAGTAAAAA
TGTACGTAAATGGAATAGTTGAAGGGGCATTTAGTACACGTGCGTCTGCTATTTCATTTAGTGTTTTTAC
GGCTATTTTTCCTTTTTTATTATTTTTATTAAACTTAATATCGGTAATACCAATTGATGGTTTTCAGGAG
GAATTTATTGTTTTTATAAATAGTTTATTGCCGCCGCGAACTTCAGATTTTTTTGATAGTATAATTTATG
ATATAGCCAATAAGCCTAGACCAGGTTTATTGTCTTCTACATTTGTGCTTTCGATGGTGTTTATGACAAA
TGGGATTAATGCTGTTTTTTCGGGATTTCAAAACTCATTTCATACCAAAATAAGTCGTAACTTTTTAAAA
CAATATGGTGTAGCGTTTTGGGTGGCAATAATTGTGGCATTGTTCTTGATATCTACGGTGTATATCATTC
TGTATTTTACATATTTAGTTACAGCTTATGAGCAATTTTTAATAGGTGATACTATATTTTGGTTAAAATT
TGGAAGAGTAGGAATTTTCATTTTAATGATTTTTACAACTATGGCAACATTATTTTATTTTGGAACAAAA
GAAGGGAGAATTACTCGTTTTTTTTCGCCTGGAGCAGTATTAACAACAGTTTTAATAATTGTGACTACAT
ATTTGTTCGGATTTTATATCGATAATTTTTCTCGTTATAACGAGTTGTATGGTTCAATTGGTGCCTTATT
AATATTGATGTTTTATATTTGGATTAATGCAAATTTAGTTTTGTTAGGATATGAGCTTAATGCCAGTTTA
AGAAATTTAAAAATGCAAACAGTTAATAAATAATAATTAAGAAATTATGAAGAAAGTATTACTAGCATTA
GTCGCTTTAATGATGTTGAACTCAGCAGTAGCGCAAACTGTAATAGGTGATGCAACATTGCCTAATAACA
AAACTTATGAATCTCATGAGCTTATTTTGAATGGAGCTGGATTACGTGAAAAATTATGGTTTGATTTGTA
TGCCGCTGGTTTATTTTTGAAGGAGAAAAATACAGATGCGGATGCAGTCGTAGCAGCAGACCAACCAATG
GCAATACATTTAGTTATCTTATCTGGAATGTTGTCAAAAAAGAAAATGATTGGTGCGTTTAGAGATGGAT
TTGAAAATACAAATGATAAAGCTACTGTTCAAAAGCTTCAATCTAAAATAGATAAATATGTCTCATTCAT
CTCTGAAGAAATTAGTGTGAGTGATCGGTATGATATCATTTATACCACAGAAAAAGGAAACGAATTATAC
AAAAATGGAAAACTACTAGGAGCTATTGAAGGTCTTGAATTTAAAAAAGCATTATTTAATATATGGCTTT
CAAAAGAACCTGTAGATGATGATTTAAAAGATAGTATGTTAGGAAATTAAAAAATAGTATCTTTGCAAAC
TTTAAAACCCAAATTTAAAACCCTAAATATGAAACAATTACTTATAACCCTTGCGTTGCTTTGCTCGGTT
GTAGCTACTGGATATGCTCAAATCCCTGTAGGAAGAACAGTTATGGAATATGAAGTTGAGTATGATGATA
CCACACTTAAAATGAATGGAGCGGGAACATGTTCAATGCTTTTTATTGAATTATACTCTGGTGGTCTTTA
TTTACAGGAAAAAAGTAGCGATCCAATTGCTATAGCATATGATGATGAAACAATGGCTATTCGAATTAAA
ATCACATCAAAATTGATTAAGCGTGAAACAATGTTGAGTGCCATCGAAGAAGGTTTTGAGAAAGCTACCG
AAGGTAAAACAGGTCCTTTAAAAGATAGAATAGCAAAAGTTAGAGAGTATTATGCGAAGCCGATAAGTAA
AGGAGATTTGTTAGAGCTTGTGTATGTCAAGGGTAAGGGAGTTTTCTGTTACTTAAACTCTAAAGAGCTT
GGTGTTATCGAGGGACAAGATTTTAAATTCGCTTTATTTAAAATATGGTTAGGTGAAAATCCAGCTAGTG
AAAGTTTAAAGAAAGGGATGTTAGGAGATTTTTAGAAAACAACTCATTTTATAATATTAAAACCTTAATT
GTGATTATTTGAGCAATTAAGGTTTTTTTTATATGTAAAATTAACTATTTAGTTTATTGTAGTTTAAATA
CAATAGCTTATATTTGCACTCAGAAATTAATCCCTACTAACCCGATAGGAATTAAATATTTTACGACAAA
CTAGGTATGATAACAGAAAAAGTAGCAGGAGCAAATACTACATATGCGCAAGATGCGAGTTCGGAAAAAC
CAATTCGGAGTGTTGTGAAAGCAGTCAGTTGGCGTGTGGTAGGTACACTGGATACTTTAGTGGTGTCCTA
TTTAGTACTCGGTGAAGGAAGGTTAGGGGAGGCTTCAGCAATTGCAGGAGTGGATTTTGTAACTAAAATG
ATTTTATACTTTGCTCACGAAAGAGTTTGGAATAAGGTAAAATGGGGAAAGTAGTTTGATATTGCTTTTT
TAGGATAGTAGTAAAAATAAATTTTGCTGAAAGTGAATAACTGACGGCTGAAAGCTGAAAATATGAGTTT
TACACAAGAAGAAATAGTAAAATATAACGAGGAACTTAAAGGGAAAACGCCTTTGGAAATCGTACAGTGG
GCAGTAAGTAAGGCGAAAAAACCTGTGGTAACAACAAATTTTAGACCTTACGAAGCTTCGATATTGGAAG
TATGCGTTGCGGCAAAAGCTGATATCCCTGTTATTTGGTGTGATTCTGGTTACAATACGCCAAATACGTA
TCGCCATGCCGAAGCTGTAATTGCGCAATTGAATCTAAATGTGGATTTGTATGTGCCTCAACAAACAGTA
GCACACAGGGATGTGGTTATGGGAGTACCTGGGGTTGATGATCCTAAGCATGCTGAATTTACGAAGCGGG
TGAAATTAGAGCCTTTTGGTAGAGCAATGGAAGCACATAAACCAGATGTTTGGTTTACAAATTTAAGAAA
AGGACAAACCACATTGCGTGACTCGTTGGATATATTAAGTTTGGGAGCTAATGGCGTATTAAAAGTAAGT
CCTTTTTATAATTACTCTGATGCCGAATTGGATGTCTATTTATCAGAAAAAGGATTGCCAAATGAACATA
AGTATTTCGATCCAACTAAAGTCTTAGGGAATAGGGAGTGTGGATTACATACGAGTAATTAAAATGTGAT
ATTTGTTCTGTCGAATCGTTTTAGTTTTTATGGTATTACTAGCTAAAATGAATGATGAAAATAAAATTGA
TAATCCCCTTAATGAGCCGTATTTTTGCAAATTCAAAAAGGGAGATAAAATAAATAAGAAATTATTGATA
GCTGAAAGCCATAGGTGGACAGCTGAAAGCTGAAAAAAAATGAGTAAAGAACTTTCAATAAATCCATTAG
AAACAGAAGCGATACATATATTTCGCGAAGTAGTTTCTCAGTTCGAAAAGCCAGTATTGTTATTTTCGGG
AGGAAAAGATTCTATTACATTGGTGCGTTTGGCGCAAAAAGCCTTCTGGCCAGCAAAAATACCTTTTCCA
TTGTTGCACGTGGATACAGGTCATAATTTCCCTGAAACTATCGAATTTAGAGATCGTTTAGCTAAGGAGT
TGGGTGTGGAGCTTATTGTGCGTAATGTGCAAGATGCTATTGATGCAGGTAAAGTGAAGGAAGAAACGGG
GAAGTACGCAAGTCGTAATTCATTACAAACAGTAACACTTTTAGATGCTTTAGAAGAATTTAAATTCGAT
GCCGCTATTGGTGGAGCGCGTCGTGATGAAGAAAAGGCACGTGCTAAAGAGCGTATTTTTTCGGTACGTG
ATGATTTTGGACAGTGGGATGAAAAAAACCAACGTCCAGAATTGTTTGATATGTTGAACGGAAAAATTGA
TTTAGGTCAGAACGTTCGCGTATTTCCAATTAGTAACTGGACAGAATTGGATGTATGGAGTTATATAGAG
CAAGAAGAAATTGAAATTCCTTCTATTTATTTTGCGCACAAACGTAAAACTTTTGTTCGTGATGGCATGA
TATGGTCTGCCGAAGATGATGTAGTGTATAGAGAAGAAGATGAAATTGTAGAAGAGCGATTAGTGCGTTT
TCGTACTGTAGGTGATATGTCATGTACCGCAGCGGTACTTTCAGATGCTGTAAGTATCGAAAAAGTAGTA
GGTGAGATTAGAGAAAGTACAATTTCAGAACGTGGTGCGCGTATTGATGATAAACGATCCGAAGCTGCAA
TGGAAACACGTAAGCAACAAGGGTACTTTTAATAGTTGTGAGTTAGCAGTTGTGGGTTGAGTGTCTTTTC
AATTGCTGTAAAATAAGTTATAAACAGATAAAATAGGAGTTTTAGTTTAGTGGTCAATATAAATTAAGTC
TGACAACTGACAACTAAAAACTACCAACCAAAATAGGATGGAAGTATTAAAAATAGCAACAGCAGGAAGT
GTCGATGACGGTAAAAGTACCTTAATCGGTCGTATCCTTTATGATACAAAATCATTAACTACAGATAAAT
TAGAAGCTATTGAAACACGTAGTAAAGCTAATGGCTTTGACTATTTGGATTTTTCATTGGCAACCGATGG
TCTAGTAGCAGAGCGTGAGCAAGGGATTACTATTGATGTAGCACATATTTACTTTTCAACAGCAAAAAAG
AGTTACATTATTGCAGATACTCCAGGTCATATTGAGTATACACGAAATATGGTTACAGGGGCATCAACAT
CGCAAGCATCTATTATATTAGTTGATGCACGTAATGGTGTTATTGAGCAGACATATCGTCACTTTTTTAT
CAATAATTTATTGAGAATAAAAGATATTGTAGTTGCTGTAAATAAAATGGATTTAGTAGATTTTTCGGAA
GAAAAATTTAATGCTATCAAAGCTGAGTTCGAAAAAATGATAGCTCAAAGTGATTACAAGGATCAAAACA
TCACTTTTGTACCGATTAGCGCTTTAAAAGGAGATAATGTTGTTTCTACATCAGAAAATACACCTTGGTA
CAAAGGAGAGTCTATTCTGGATCATTTGGAAAAGTTAGAAGCTCAAGATGTATTTGAAAAAGGACAAGCG
CGTTTTCCAGTACAAACGGTTATTCGTCCTAAGAAAGATGAATTTCATGATTTTAGAGGATATGCAGGGA
AACTTTATGGAGGTGATTTAGCTGTTGGTGATCAAGTAACAGTATTACCATCATTAACAAAATCGAAAAT
TAAAGAGATTTATTTCTTTGATAAAAAATTTGACAAAGCAGGTAGAGGAAGTTCAATTAATGTAACTTTA
GAAGACAATATTAATGTATCTCGTGGGGATATGATTGTGAAAACCGGTGAAGAGCCAGGAGTTCACAAAA
CATTAAAAGCTAAAGTATGTTGGATGGATAGTAAAAACCTAGTTGGAGGTACTAAATATTTATTACAACA
TGGAGTAAATAGAGTGCAAGCTATGGTTACTGGTATTGATAATGTATTAGCTCCGGATTTTTCAGGAGAG
GATGCCTCGGCAGATGCATTAGCATTAAATCAAATAGGTGAAGTAAACATTAAGTTAGCAAAGCCTGTTT
TTTATGATAAGTACGCAGAAAATAAAACCAATGGATCATTCATATTAATTGATCCACAAACAAACCACAC
GGCAGGAGTAGGGTTTATACAGTAGTCATCAGCCTTTGGCTGAAGTACTAAGTAGTGAGTACAAAGTATT
AAGTTTTAAAGTGTTTGATAAAGTTGTAACATCGAACGGACAACTAACAACAGACAACTAACAACCAAAT
TAAGATGCAAAGTTTTAGAACCGAAATAGAGAATCCAATTGTTGAAAAGGACATTATCGAATTAGCCGAT
AAAATCCAGATGTTTCACAATGGAAAAATTGATGAAGAAAAGTTTCGTAGTTTACGTTTAGCACGTGGAG
TATATGGGCAACGTCAGGAAGGCGTTCAAATGATTCGTATTAAATTGCCTTATGGTAAAGTACGATCAAA
TCAATTACGTCGTATTTGTGCCGTGTCCGATGAGTATTCTCGTGGACGTTTACATATAACTACGCGTCAA
GATATTCAAATTCACTATGTGGATTTAAATCGTACACCAGAACTTTGGGCTGAGCTAGAAAAAGACGAAG
TTACTTTGCGTGAAGCTTGTGGAAATGTGGTACGTAACGTTACGGCATCGGAAACAGCAGGTTTTGATGT
GAATGAGCCGTTTGATGTACAGCCTTATGCCCATGCTATATTTGAAGAATTTTTACGTAATCCTATCTGT
CAAGAAATGGGACGTAAGTTCAAAGTATCTTTCTCTTCAACAGATGAAGATACAGGATTGTCTTATTTAC
ATGATATCGGTTTTATAGCAAAAATAGAAAATGGAGTACGTGGGTTTAAAGTAATGGTTGCTGGAGGATT
AGGTTCTCAGCCACATCTTGCGGAAACCTTATATGAGTTTTTAGCAGCGGAAGAAATTATTCCTGCAATG
AACGCTATTTTACGTGTGTTTGACCGTTTTGGAGAACGTAAGAGTAGAGCTAAAGCCCGAATGAAATTCT
TAATGGCAAAAATTGGTTTGGATGCCTTTAAAGAATTAGTAGAAGAGCAACGTATTGCGGTTCCGTATAC
CTCTGTAGCTATTGATGCAGATGCGTATCCACAGCCTGTAATTGCTGAAGTTTCTGAAATTCCTTCAGTG
GAAATTAAGGATCAAAAAGCATTTACACAATGGAAAGCAACTAACTTGATTCCGCAAAAGCAAGCAGGTT
ATATAGCTATTGGAGTAAAAGTATTGTTAGGAGATTTTTATACAGACAAAGCACGTTTATTAGCTGACTT
GGTAGATAAATATGCTGCAGGTGAAATTCGTTTGACTTTACGTCAAAACATTGTGATTCCTCATGTTAAG
GAAGAATTAATTGAGGTTGTTTATGCTGAATTAGAAAAACTAGGTTTTGTTGATGCTGGATATAATAAAG
CAGTAGATATTACAGCTTGTCCAGGTACAGATACCTGTAACTTAGGTATAGCTAGTAGTACGGGTATTGC
CGAAGAATTAGAAAAAGTAATAGCGTCCGAATTTCCACAGTATTTGAACAATGAAGATGTGGTAATTAAG
ATTAGTGGATGTATGAATGCTTGTGGTCAACACAACATGGCAAACATTGGTTTCCAAGGAATGACCATTC
GTACAAAAGATAAAAAAGTAGCACCTGCATTACAAGTATTACTTGGAGGAGGTAACTTTGGAAATGGTGA
AGCTCGTTTTGCCGATAAGGTAGTAAAAATACCAAGTAGACGTGGACCGGAAGCTTTACGTAGAATCTTA
AATGATTTTGATGCTAATGGGAATGGTAAAAAGTTTGAGGAGTATTATGCTGAAAAAGGGGAACGTTATT
TTTATGATTTCCTAACTGAATTGTCAGAAGCAGATAGTCTTCCAGCTGAATACTTTATTGATTGGGGAAC
TAATGAAGAGTATGTAAAAGCAATTGGTGTAGGTGAATGTGCTGGTGTAGTAATTGATTTAATTGAAACA
TTATTCTTAGAAAGTGAAGAAAAAATAGCTAATGCTAAAATTTCTTTTGATAATGGAGTATATAGCGATG
CTATTTATCATGCTTACAGTTCTCAAATTAATTCTGCAAAAGCAATTTTGTTAGCCGAAAATAAAAAGAC
AAATACACAGGCAGATATAGTAGCTGGGTTTGATAAAGAATTTGTGGAAACAGGTGTAATCAAATTAGAA
GGTACATTTGCCGATAGTGTGTATGCGATTAATAAAAATGCGCCAACAAAAGATTTTGCAACGGATTATA
TCGCTGATGCAGAAGCATTTTTAGTAGCAGTACGTAAATTTAGAGCAGCCTCACAAAACGCATAAGTATT
GAGTAACTATAACGAAAATACAAGTAAAGGGAAGTTAACCGTAGTTGGAGCAGGTCCAGGTGACGTGGAA
TTGATTACGTTAAAAGCCATCAAAGCATTAAAATCGGCAGATGCAGTATTATATGATGCTTTGGTAAACC
CGGAGTTATTGGATTACTGTACTAATGCAGACCTTTTATACGTAGGTAAACGTAAGGGGTGCTACGCTTT
TCAACAAGAACAAATTAATGAGTTAATAGTTCAGTATGGGAAAAGTCATGGACATGTAGTACGTTTAAAA
GGAGGAGACCCATTTATTTTTGGACGTGGCGCCGAGGAAATGGAATATGCAGCAAAGCAAGGAATGGAAG
TGGCTATGGTACCAGGATTATCATCGTCAGTTTCGGTACCAGCAATGCAAAATATTCCAGTTACTAAACG
CGGAAGTGCAGAAAGTTTTTGGGTAATCACAGCGACAACCAAGGAGCATAAGTTATCCAAAGATGTGTTA
ACAGCAGCTAAGAGTAATGCTACGGTAGTGATTTTAATGGGAATGCATAAATTAGGTCAAATTACCGAAG
TTTTTGCTAACGAAGGAAAATCAGAAACACCAGTAGCCATTATTCAAAATGGTACACGAGATACAGAAAA
AGTTGTAGTAGCAACAATAGCAACTATTGAAAAGGAAGTGAAAAAACAGGAATTGTCATCGCCAGCAATC
ATAGTTATTGGTGAAGTGGTAAATCATAGGACATCGCTTTTGGAAATGCAACAAAAGTTAAATGAAGTAT
AATGTGAGCTATTGGCTATCAGCAATAGGCTTTTAGCTTTTAATTTGTAAAAAGAAAGCCAATTGCCATG
GGCTAAAGGCTAACAGCAAAAAGATGGAAAGAAATAATTTATATCCCGTTTTTCTAAAAGTAAAAAACCT
TAATGTACTTATAGTAGGTGGAGGTAATGTTGCGGAAGAAAAACTACATTTCTTGACCAAGTCAAGTCCC
GATGCTAAGGTGTTATTAGTAGCTCCAATGTTTAGAGAAGGGACAATTGCTTTAGCAAATAAGTTTTGTG
CAACTATGGTTACCGATGTGTATCATGAAAAGTATTTGGAAGGTAGGCATATTGTAATTGCAACTACAGA
AAAACCAGAAGTAAATGTACAGGTTTGGAAGGATTGTAGAGCACAAGCTAAGTTAGTAAATGTAGCAGAT
AACCCTCCATATTGTGATTTTTACATGGGAGGCATTGTTACAAAAGGAAATGTAAAAGTGGCTATTTCGA
CAAACGGAAAGTCACCAACAACGGCCAAACGTTTACGTCAATTTTTTGAGGAAGTAATTCCTGAAAATGT
AGATGATTTGGTACAGAATTTGAACGAGTACAGAAAAACCATAAAAGGTGATTTTGAAGAGAAAGTAGAA
ACTCTTAATGAATTCACTAAAGGATTAATAGCAAAAAAAGAAAAGTAATGATAAAAACTGATATTCTTAT
TATCGGAGCAGGGCCAACAGGATTGTTTTGTGTTTTTGAAGCAGGTTTATTAAAATTAAAAACGCACCTT
ATTGATGCTTTACCACAACCAGGTGGACAGTGTTCAGAAATATATCCAAAAAAACCTATTTATGATATTC
CTGGCTTTCCAGAAGTATTGGCAGGGGATTTGGTAGATAACCTAATGGAGCAGATTAAGCCTTTTGAGCC
TGGATTTACTTTAGGAGATCGTGCCGAAACTATTGAAACTTTAGATGATGGTACGTTTGTAGTTACTACA
AAGCGTGGTGTAAAACACAATGCTCCTGTAGTTGCTATTGCAGGTGGGTTAGGTTCTTTTGAGCCACGTA
AACCACCTATCCCAGGAATTGAAGGATTTGAAGATAAAGGCGTTTCTTATATTATACGTGATCCAGAGGT
ATACCGTGATAAAAAAGTAGTTATTGCTGGAGGTGGAGATTCTGCTTTAGACTGGTCTATATTTTTAGCT
GATGTTGCAGCTGAGGTAACTTTAGTACACCGTAGAAAAGAATTTCGTGGAGCTTTAGATTCTGTTGAAA
AAGTAGAAGAGCTTTCAAAAGCAGGAAAGATTAATTTGATTACTGATGCCGAAGTAAAAGAACTTTTTGG
TGAAGGAGAATTATCTGGTGTGGGGATAAAGCACAAAGAAAAGGGAGATATTAAATTAGAGGTAGATAAT
TTTATACCACTATTTGGATTATCTCCAAAATTAGGACCAATAGGTAACTGGGGGTTAGAGATAGAGAAGA
ATGCTATTAAAGTGGATAATTCATACGATTATCAAACTAATATTCCTGGAATTTATGCAATTGGAGATGT
AAATACGTATAAAGGAAAATTAAAATTAATTCTTTCTGGTTTTCACGAAGCTGCAATTATGTGTCAGAGT
GCTTATCAAAGAATATTTCCAGATAAAAAATATGTAATGAAGTATACCACTGTTGGTGGAGTTACAGGTT
TTGATGGAAGTAAGAAAGAAGCGAAAAAAGAAGTAGTAAAAGCTATTGGATAATTTTTGTTGTCAGTTTG
TAGTTGTCAGTTGTTAGTTTAATAATTGGGAAACTTCACAAACTTGACTTTAATTAAAATATAAATATTT
AGTTGTTTTCATTTTAGGTGTATAAGACCTAACAACTAACAACTAACAACTAACAACTAGTATGTCAGAC
GTTACAATAAAAATCACAGACCGTGAAGGTAAAGTACACGAAGTACAAGCACCTACCGATATGGCAATGA
ACTTAATGGAGGTTTGTAAAGCTTATGAATTACCTGTTGAGGGTACGTGTGGAGGAATGGCTATGTGTGC
ATCTTGTCAATGTTATGTAACTTCCGATACTCCGTTACCAGAAATGGGTTATGATGAGGATATGATGCTA
GCAGAAGCTTTTCATGTAGAAGATAATTCACGTTTAGGATGTCAAATTCCAATTACTCCTGAATTGGATG
GGTTAGAGGTAACTTTAGCACCCGAATAAATTACATGAATAATAATAATTGTAAAACCGCCTTTTAGGGC
GGTTTTTTTATATGATATGTTTTAAAATAGTGTCAAAGGCATAATGAAGAGCCTTGATGTTACTTAAATG
TTAATAAAACTAATTTTTTATGGTTAAATTGCATATTCAATAGACTTTCGCTGGAAGTAGTATAACTTCT
TCTCTAAGAATTGAAAAATACATGAAACAAAAAAAAATTGCCATAGTAGGAAGTGGTCTTGTAGGCTCAT
TATTAGCTATTTATTTAAGGAAAAGAAATTATCAGATTACTGTTTTTGATCGTAGACCCGATATACGAAA
GATAAAGTTTAGTGGGCGTTCTATTAATTTAGCGATGTCTGTTCGCGGTTGGAATGCTTTGGAGGCTATA
GGGATTAAAGAAGAGGTTGAAGGATTAGGAATACCCATGTATCATCGATATATCCATGTGAATACCAAAG
ATGATTATACGCAAAAATATGGAAAAGATGGAGAGGCAATTTACTCTATATCTCGTGGAGTATTGAATCG
TAAAATGATTGATTTAGCGGAAAAGGAAGGTGTAGTATTTAAATTTGAAGAAAAAGTATGGGATGTAAAT
TTGCCCGAAGCTAAATTGTATACAGGTGAAACTGAAAAAGGAAAGTGGGAAGAACATGAATTTGATTTAA
TTTTTGGATGTGATGGTGCTTTTTCACGTATACGTCATAAAATGCAGCGTCGAAGTAGATTTAATTATTC
GCAAGATTTTTTAAATACAGGCTATAAAGAATTATCGATTCCTGCAGATGCTAATGGAAAACATGTTATA
GATAAAAATGCGTTACATATTTGGCCTAGAGGTAAATTTATGCTTATCGCTTTACCAAATTTAGATGGAA
GTTTTACTTGTACACTATTTATGCCTCATGAAGGCGAAAATTCATTTGAAAGTTTAACTACCCCACAAGA
AGTTCGAGTATTTTGGCAAACCTATTTTCCAGATACGTTACAAATTATGCCAACATTGTTAGAGGATTAT
ATGAGTAATCCAACAAGTGCCTTGGTAACTATGAAATGTTACCCTTGGACCTATTGGAACAAAGTAGCTT
TGGTGGGTGATTCTGCTCATGCTGTTGTGCCGTTTTATGGTCAAGGAATGAATGCAGGTTTTGAAGATGT
ATTTGAGTTGGATCAGATTATTGAAAGATTAGGAGATACAGATTGGCAAAACATTTTTGAGACCTATCAG
GAACAACGTAAACCTAATGCAGATGCTATTGCGGAGCTTTCGTATCGTAATTTTATGGAAATGAGTCAAA
AAACAGCTGATCCAAACTTTATACTACGTAAAAAAATAGAAAAGAAATTTTCGGAACACTATCCTGAGTT
ATGGCAGCCTTTATATTCGCGTGTGACCTTTTCAAATCGCCCTTATTCTGAAGCGATTAGTTATGGTGAA
GTACAAGCAGAAATAATGGATCAGGTGATGCAAATGGAAAACATCAAACAAGATTGGGATACTGATGTTG
TTATGGAGTTTATTAAAGAGAAATCCTCAAAAAGCATGATTTAAAAAATGATTTTTTTTAAATAGATAAA
GCTCATATCATTATGGAAACTCATTTTGTAAGTATTGGTTCATCATTATACAAGGAAGCTTGTCAACTGA
GAAAAGAATTGTTTTTTAAAGACTTGGAAAATGCAGAACTTTTGTTAAATGATAACTATGAAAAAAATAG
TATGCATTTAGTAATAGAAAGTAAAGGTGCTGTCATTGGTACTGGAAGACTTACAATAACCGATAATAAT
ACTATTGGAATCATTTCTCAGATGGCTATTGATCCAGATTTTCAACGACTAGGCTTGGGGAAATTTATTT
TACAATCTTTGTTAAAAAGAGGCAGGGAATTAAATGTAAATAGGATAACGCTAAATGCAAGACTGACGGC
TATAACGTTTTATGCTAAAAATGAGTTTATTCCTATAGGGGAGGTTTTTGCATCGACAAAAACAGGAGTA
CTCCATCAACAGATGGAATTACAGTTAGGTTAATTTCTGATTTAAAAAAAAAGTTACCTAAGAATAAAAA
GTAAATCAACTATTAGGGGTTAATTTCTTTTGTGTATTCATAAACAAAAGCATCTACAATATTACCTTTT
GTAAAAACCTTGGTAGTTGTTCTGATGAATAAGCTCTCTTCTGGTTTTTTTGGAAAAAAACCTTCGTAAA
AATCAAGTTCAGAAAGTACGAAAGTGTTATTTGATGTGATTTTTAATAATTCACCATAAGTTTTGTAAGT
CTTATTACTATCAAGCTTTATTCCTGGGAATTCTCCTAAATGATATTTTTTAGCATAAATATAACCTTTA
GCTATTTTTGTCGAATTTTTTTTGAGCAATTGAGCAAAGGGATTTTTGTGTTTGTTTAAGAGTGTACCGT
AAACAAACAAGAAAATTTCGTTATTCATTTTTTAACAATTCAGGGAATTTAGCTTTAAAACGATTTAAAC
GAGGAATTGAAACTCTAACAATATATGGATATTCAGGATTGCGCTTTTCATAATCCTGATGATATGCTTC
GGCTTTATAAAATTTTTCAAAAGGAATAATTTCTGTTCTTACTTTTTTTGAAATGGTATTCTGCACTTCT
TTTCTGGCTTCCACAGCAATTAGTCGTTCATTTTCATTTTGAAAGAAAATAATAGAACGATAAGCAGATC
CAAAGTCAGGTGCTTGACCATATGTTGTTGGATTTTGTGAGCCGTAATAAACTTTTACAAGTGTTTTGAA
GTTAATGATTTTAGGGTCATATTGTACTTCTATAGTTTCAGCATGTCCAGAATTCCCAGAACCAACTTGT
TTGTACGTTGGGTTATCAGTAATACCTCCAGAATAGCCCGAAACAACTTCTTGTACTCCTTTTACACTTT
CAAAAATAGCTTCAACACACCAAAAACACCCACTAGCAAAATAGGCGTTTTGCAAACCGTCATTACGTTG
AGTTTGTATGGGTTCCGAGTTAATTTTAGAAATAGGATTTTTTGGATTATTAATACAGGCATTAATGCCC
AAAATAAAAAGGGATAAAATAACTAATGATTTCATGACTGTAGGTTTTATATAAGTAATAGTCTACATTG
GGGAGTAGACCTTTCTATTAAAGATACAAAAAAGCCCTCAACTATAAAAATAGTGAGGGCTACTTGTTGT
TAAAAGAAGGTTTTATCCGTTCATAGATATTAGAAACTCTTCGTTGTTTTTTGTTTGCTTTACACGTTGG
TTTATGGATTCCATAGCTTCTACAGGATTCATATCAGCTAAAAACTTACGTAATACCCACATGCGTTGCA
TAGTAGTGTCATCAAGTAAAATGTCATCTCTACGAGTGCTACTTGAAACAAGATCAATAGCAGGGAAAAT
ACGGCGGTTAGATATTTTTCGATCTAACTGTAATTCCATATTACCAGTACCTTTAAATTCTTCAAAAATA
ACTTCGTCCATTTTTGAACCAGTTTCTGTTAAGGCTGTAGCAATAATTGTAAGTGATCCTCCACCTTCAA
TATTACGGGCAGCTCCAAAGAAACGTTTAGGCTTGTGTAGGGCATTAGCATCTACACCACCACTTAGAAT
TTTACCACTAGCAGGTTGAACCGTATTATAGGCACGAGCTAAACGCGTAATAGAGTCAAGTAAAATAACT
ACATCATGACCACATTCAACCAAACGCTTTGCTTTTTCTAAAACAATGTTTGCTACTTTCACATGTTCAT
GAGCTTCCTTGTCAAAGGTTGAGGCTATAACTTCACCTTGAACATTACGTTGCATATCTGTTACCTCTTC
AGGGCGTTCATCAATAAGTAATATCATCTGATAAACTTCAGGATGGTTGGCTGCAATAGCATTAGCAACA
TCCTTTAGTAGCATAGTTTTACCAGTTTTTGGTTGTGCTACAATCATTCCACGTTGCCCTTTTCCTATAG
GAGAAAACAAATCCATAATTCGAGTTGAAATGGTACTTTGTCTATCTGCAATATTAAATTTTTCTTGAGG
GAAAAGTGGTGTCAAGTGTTCAAATGATACACGATCACGAACCACTTGGGGACTGAGTCCATTAATTTGG
TTTACTTTAATTAAAGGAAAGTATTTTTCACCTTCTTTGGGTGGGCGTACTTGACCAAGTACGGTATCAC
CAGTTTTTAAACCAAATAATCTTATTTGAGATTGTGATACATAAATATCATCGGGTGATGATAAGTAGTT
GTAGTCACTGGAACGTAAAAAACCATAGCCGTCCTGCATAATGTCTAAAACACCTTCGCTCTCTATTATG
GCGTCAAATTCAAAGTCAGGCTCCTTGTAACGATTTCTAGGGTCTCTGTTTCCTTTATTGTCTCTAGTAT
TTCCGTTATTATTTTTGTGATTTTTGTTTTTGTGATTGTTGTTAGCGTTGTTGCCACGATCGTTTTTTTC
AAAACGAGGTTTGTTGGGCTCTCTTTTTTCATTTTTTACAACTTCTTTTACAGGAGCAGCATCTTTTTCA
GGTGCTTTTCGCTTTGGTTTAGCTAATTCAGGAGTGTTGTTGTTTTCCTTTTTAGGAACAACGCGCTCTT
TACGCTCCCTTTTAGGTTTGCTAGGAGCAGGAGTTGTTGTTTCTTTGGCTGTTTTAGTTGGAGCTTCTGG
TTTGCTCTCATTAACTTTGGTTTCAGTAGGTTCCTCCTTTAGAACAGAAGCTACTTTGGCTACTTTAGTT
GGGTCATCAGCTTGATGATCCAAAATTTGATATACTAAATCCAGTTTTTTTAAAGTACGAAATTTAGGAA
CTTTTAATGCCTTAGCCATTTCCTGTAGCTCAGGTAACTTTTTTGATTTTAAATCAGAAATTTCTAACAT
GTAATTTGTTAATTATCTTTTTATTTATAGAGAATAAATACTAGAAAGTATGTATTGAGTCTGAAGATTG
TTAAATAGTTTTGAAACTATTCGTTATTGCAAGTATACAACAATATTTTTATTAGAAAAACTCTTTATCA
AATTACTTGTTAGTTAATTGCTTAAGTTTTTTTAGTTAAATTGAGATTGACAAGAATAGAGATTGTTAGG
TGACTCATATTTCTTTTTTTGAGTTTATTTGTTGATTTTTAAAAAGAAACAGCTATTTTTGTAATACAGA
AGAAAAAAAGTATGATTCAACGTATTCAAAGCGTTTATTTATTATTAGCAGCATTAGTATCCGGAGTTTT
GTCTTATTTTTTTCCAACTGGTTTTGATAAAGTAGGGGAAATAAGTGCTCCATTTTATTATGAAATGTTG
TTGATTTCAGCTTTATTATCGTTCATTATTATTTTTGTTTTTAAAAATAGAAAGCTTCAATTTGTTTTGG
GGCGATTAAATATACTATTAAATGTTATTTTACTAGGCGTTTTCGTGTATTTGACACTAACTGTATCTGG
AGAGGTTTTTGCTTCTGAGAAGGGTATTGGGCGGTTCATACCTGTGCTATCTATCGTTTTAATTGTGTTA
GCCAACAAGGCTATTAAAAAGGATGAGCAGCTCGTAAAATCTGTGGACAGATTACGATAAACACTTAACT
AGTATTTTGTGCGAAAAAAAGCCAGCGTCTGCCAACGCTGGCTTTTTTATTTTCAAAATTATTTCACATC
AAAATTGATTATTTTCTGTGAGATCCATCACAATAGGGTGGATTGTTGGTGAGTTTACATGTGCATAATG
AAGCTTCTTTTGCTTCAGTTACTTCGAATGCTAAAGAGGGTGTAGCATTGTGTTTTCTGTGAGATCCATC
GCAAAAAGGTTGATTTTCACTATGGCTACATGTGCACCATGCATATTTTTTACCAGGTTCTAGGCTTACT
TTAATGGGTGTTTTTTTATCAGACATAGTATATTTTTTTAATTCTAAATTACAATATACTTCTACTTGAG
TTAAGATTGATTTTAAATAATAGCGCATTTTAAGTGTGTTTTTAGAAGACTTTGCTTTGTTAACTATGTA
TGGGGTGTTATTTGTTAATAAATTGTAAATAATTAGCTGAATTTTGACTGTAATACTTGGTTTAATTCAC
TATTTTGCTTGTTAGAATTGAAATAAAAAAAATTAAATTTTTATATATATGGCTGACGGAGAAAAGCTGA
TTCCTATTAATATTGAAGAGGAAATGAAATCGGCATACATCGATTATTCGATGTCTGTAATTGTTTCTAG
GGCGTTACCCGATGTACGTGATGGACTAAAGCCAGTACACCGTAGGGTGTTATTTGGAATGCATGAGCTG
GGTGTTAGGGCTTCAAGTGCTCATAAAAAATCTGCAAGAATTGTTGGAGAGGTACTAGGTAAGTATCACC
CACATGGTGATACATCTGTATATGATGCAATGGTACGTATGGCTCAGGAATGGAGTATGCGTTATATGCT
AGTTGATGGACAAGGAAATTTTGGATCTGTTGATGGAGATAGTCCTGCAGCAATGCGATATACCGAAGCA
AGAATGCGAAAGATATCGGAAGATATGCTTGCTGATATTGATAAAGAAACTGTTGATCATACATTAAATT
TTGATGATACGTTAAAAGAACCTACAGTGCTTCCAACACGAGTGCCCGGTTTGTTAATTAACGGAGCATC
TGGAATTGCGGTGGGTATGGCGACTAATATGCCTCCACATAATTTAGGAGAAGTTATTGATGGTACCGTG
GCGTACATTGATAATAATGATATTGAAGTTGAAGGTTTAATGGAGTATATAAAAGCTCCAGATTTCCCTA
CCGGAGGAATAATATATGGCTATGATGGAGTGCGTGAAGCATTTAAAACTGGTCGAGGTCGTATTGTGAT
GCGAGCTAAAGCTACTATTGAAGAGGTTAGAGGTAAAGAATGTATTATTGTTAGTGAGATTCCTTATCAG
GTAAATAAAGCCGAAATGATTAAAAAAACGGCTGAGCTCATTAATGATAAAAAAATAGATGGAATTTCTT
CGATTCGTGATGAATCCGATAGAAAAGGAATGCGTATTGTTTATGTGTTAAAGCGTGACGCTATTCCAAA
TATTGTATTAAATATGCTTTACAAGCATACGCAATTGCAAACTTCATTTAGTGTAAATAATATAGCATTA
GTAAATGGACGACCTCAGTTACTTAATGTGAAAGATATGATTCACTATTTTGTGGAACATCGACATGAAG
TTGTGGTAAGAAGAACTACTTATGAATTAAGAAAGGCAGAGGAAAGAGCTCATATTTTAGAAGGTTTAAT
CATTGCTTCGGATAATATTGATGAGGTTATAGCATTAATTAGAGCATCAAATAATGCGGATGAGGCTCGT
GCAAAATTGATTGAACGTTTTAAGTTAACTGAGATACAAGCTAAAGCAATAGTTGAAATGCGTTTGCGTC
AGTTGACTGGACTGGAACAAGATAAATTACGTGCTGAGTATGATGAGTTAATGAAGACAATTGAAGATCT
GAAAGATATTTTAGATAAGAAAGAGCGTCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTGGACGTCGTTCTCAAATTGAATATGCGGGAGGAGATTTTAGTATTGAGGATATGATAC
CTAATGAAAAGGTGGTAATTACCATTTCTCATGCCGGTTATATAAAACGAACTTCGCTTACTGAATACAA
AACACAAAATAGAGGTGGAGTAGGTCAAAAAGGAAGTACAACACGTAATGAGGACTTTTTAGAGCATCTA
TTTGTTGGGACAAACCACCAATACATGTTGTTTTTTACTCAAAAAGGAAAATGTTTTTGGATGCGTGTGT
TTGAAATTCCAGAAGGAGCTAAGGCAACAAAAGGAAGAGCTATTCAGAATTTGATTAATATTGAGCAAGA
TGATAAAGTGAAAGCTTTTATTTGTACTCAAGATTTAAAGGATGAAGAGTATATTAATAATCATTACGTG
ATTATGGCAACAAAAAAGGGTCAAGTTAAAAAGACCTCTTTAGAGCAGTATTCTCGTCCAAGAGTTAATG
GAATTAATGCCATAACTATTAAAGAAGAAGATGAGCTTTTAGAAGCTAAATTGACAAATGGTGAAAGTCA
AATTATGCTAGCTTTAAAATCGGGTAAATCAATTCGATTTGAAGAGGCCAAAACGCGTCCAATGGGTCGA
GGAGCTTCTGGAGTTAGAGGAATTAGATTGGCGCATGAAAAAGATGAAGTGATAGGGATGGTTGCGGTGA
ATGACCCGGAAAGTAATATCCTAGTTGTTTCTGAAAATGGATATGGAAAACGTTCAAGCCTAGAAGACTA
TCGTATAACCAACCGAGGAGGTAAGGGAGTTAAAACTATTTCGGTTACTGAGAAAACTGGAGAGTTAGTG
GCAATTAAAAATGTTACTGATGCCGATGATTTAATGATTATTAATAAATCGGGTATTGCAATTCGACTTT
CGGTTGAAGAATTAAGAGTTATGGGGCGTGCTACTCAAGGGGTGCGTTTAATTAACTTAAAAGGAAAAGA
TTCGATTGCAGCGGTAGCTAAGGTAATGAATGATGATGAGGATATAGATGATGCGGAATTAGTAGCGGGT
GCTAATGCGGACGTAATTGAAAGTAATGATGTAGTTGCTGACGCTGATCAGGAAGCTGATAATGATAATG
CTTCTCAATCTGAGGAGTAATATTAAAAATAAGCTTAGGATTAAAAATAGGTTAAGTATTTATTTACTTG
ACCTATTTTTTTTGCTTTAACTCTTTGGGATAGGAGTGTTTAGGTATACTAGATATTAGTATTCTCTTGA
TCTTTATAGTATTTGTTGTGTTTGAATTAAATAATGTAATTTATAATATGATCATTAAAAAAATTAAATA
GGCTGTGTGCTTTGTATAATGAAGGAAGGGGTGTTGAGATAAGGTTAAAATTTATCTGCGTTGCCTTGCG
AAATTTGAGTTTGAATATAAGTTAACGGTGGTTTTTTTTGATGTTTTAACTTTAGCTAAGCTTTGGGTGT
AAAAAAAAAAGACTGCCTTTTCAAGCAGTCTTTTTTATTTTTATTGATGTGTAAGCTTATTTCAATTTGA
AAGTTACTTTTCTTCTTAATTGTAAAGATTCTTTTGATGTTCCAGATGCCGTTTCACCATTTCCTGTGTG
TGATAATCTTTCAGCAGCAATTCCAGATTCAATTAATATGTCATAGACTTTCTTTGCTCTTCTCGCTGAT
AGGCTTGAATTAAAAGAATCACTACCTCTTTGGTCAGCAAAACCAATTAACTCGGCTTTTGCCTCTGGGT
GTTCTTTCATGTATTCAATTAAGTAATTGATTGCGTCAAGAGAGTAAATACTAGGTGTAGCACTCGCAGT
ATTAAAGTAAACATTAACATAGCCTTCACCTAATAGTTTTTTAATAGCTTCGTCATAAGAAACTTCAGGA
GCGGTAGTTGCAGTAGGAGTGTCATTTGCGTATTTTCGGTCCAAAGCAGTTTCAAATTCGTCAGGAATAC
CGTTTCTGTTGTTGTCAATAGTAACACCCTTAGTGTTTACTGTTACACCAGAAGTAGTGTTAGGTTCTCT
GTCTAAATAATCAGCTACACCATCTTGATCAGTATCAATCATGTCGGCTTCAATGTTAGCTATTTTTGTA
CTAAGCTCTTCAAGTTGTTTAGAACTAGCTCCATCTTCAATAGTCCAATCTGCGTGATTTTCATTTTTAC
CTAAATTAATAGCAAAACCAGCTGTAGCAGTAAGCATTGATCCAAAACCAGAAACGTTTTGGGCTCCATC
CCAATTGAAATTTTGTCCTAAATGCCTTAAGTAGCTTAAATCAACTTGAAAAGATACTCTTTTTGATAGT
TTTAATTGAGGGGTCAATCCTAAAATAAAATTAACAGCAAGCTCGTCACCAGTATTACCCAAAGTATTAT
AATCAAATGAGGATAAACCTCCACCTCCATGGAATAATAATCCAATATTTTTAAATGCAGTGGTTCTAAA
TCCCATGATATTGCCAAGGTTTATTACTCCTTGTATTGATCCTCGGTAGTATTTAGTTTCAAATTCAATA
GAATTATCGTCATTGTTAATATCTTGATAACCAAAATCTGCTTTAATTCCAAATTTAGTATTAAGGCTGT
AGCGTACTCCAAAATTACCTGCTACAAATTCGGGTACTGGGGAAAAGTGCCCTGGAGAAGCTAAATTAAA
TGTTTTAAGTGCCCCGGCATCAAGTTCAATAGACCATTTGTTGTAAGTGTTTTCTTGCGAATGTAAAGCA
CCTATAGTTAAAGTTGTTATGATTATAAGTAGTGTTTTTTTCATGGTTAAGCAGTAGTAAATTAGTATAT
ATTTACAACCAAAAGTATGAAAAAGTACATTAAAAATAATGTTTTTTGTTAAATGTAGGTGTTTTTATTT
GTTAATTTATTAATTTATAAGGTTTTGACATTTTTTTTGTAGGAAGATTTTTAGCATTTAAAATGTTAAA
ATTCTATATTTTTGTTTAGTTTTTTATTAACTACACTTTTAGCTAAGGTGTATTCTGTTTAATATATCAA
ATTAACATGGTATTTTGCTTAGATGAAAAAAAGAACTTTAATTAAAAAAATAGTTTATTAGTTGTATAAT
TATAAAAAATGCGTATTTTTGCCATCCGAAAACGAAAAGATTTTTAGCAATGAAACAAGGTATTCACCCA
GAGAATTATAGATTAGTAGCTTTTAAGGACATGTCTAATGATGATGTTTTTATTACTAAATCAGCAGCAA
ATACAAAAGAAACTATTGAAATCGATGGAGTTGAGTATCCAGTAATAAAATTGGAGATTTCAAGGACATC
TCATCCGTTCTATACAGGTAAGTCTAAACTTATCGATACAGCAGGACGTATTGATAAATTTAAAAACAAA
TACGCAAAATTTAAAAAATAATTTTGTAGTTTTCTTATAGCAAAAGCCTTCTTTTAGAAGGCTTTTTTTG
TTTGTCCTAATTAAAATAATAAATGTTCAGGTATTTAGTTGTTTCAGCATATTTACATTAGTATTTTCGT
AAGTATAAATACTAGCAAAATGAACTATATTTTATTTGATGGACCGCAAAGGCAAGCTTTATTACCTTTT
ACCTATACAAGACCTGTTGCCGATATCCGTATTGGAATATTAACCATACGAGAAAAATGGGAACGCTATT
TAGGAAGCACTACTTCAACAGTTACCGAAGATTATTTAGCTGAAAAATGGCCAATGGTTGAGCTGGAATC
AAATACATTTATTTGTGGAGGCATTCTACCTACCAAAAAATTGGTAAAAGCAATAAAAGCTTTACAATTG
AAAGAGGTTTTGTATTCAGAAAATGAAGAATTGATTGCTTTTTGTGTGCCCGAAGGGGAGGATCCTGATT
TGGATTCTTATAAAGCAATTCAATTTAATGATGCTTTTGCTGAAGTAAAAAATACATGGGATATTTTTAG
TTTAAATGAACAAGCAATTGAAGCAGATTTTGAGTTATTAACTGTTGACGAAACAAGCCAAAAATTATCT
GAAACGAATAAAGTAATAGGTGATGGTAGGGTTTTTATAGAAGAAGGGGCTTCGGTCGAATGTGCTATTT
TTAATACTACAAAAGGATCCATTTATATAGGTAAAGAAGCTACGGTTATGGAAGGGGCAATAATAAGAGG
ACCTTTCGCATTATGTGAGTATGCAACAATAAAAATGGGAGCTAAAATTTATGAAGGAACCACAGTTGGA
CCTCACAGTAAAGTAGGAGGGGAAGTAGGTAACTCTGTGATTTTTGGGTATTCAAACAAAGGGCACGATG
GATATTTAGGGAATTCTGTTCTAGGTGAATGGTGTAATTTAGGTGCAGATACAAATACTTCAAATTTAAA
AAATAATTACGCGGAGGTGCGTTTATGGAGTTATGAAACGAGCGGCTTTGCTAAAACAGGTTTGCAATTT
TGTGGATTAATGATGGGGGACCATTCAAAAAGTGGTATTAATACCATGTTTAATACAGGTACAGTTATAG
GAGTTAGTGCTAATATTTTTGGAGGAGGGTTTCCTCGTAATTTTATTCCGAGTTTTAGCTGGGGCGGAAG
CGCCGGTTTTGTAACTTATAAAACAAATAAAGCTTTTGAAGTGGCCGAAAAAGTAATGCAGCGTAGAAAA
ATTGATTTTACAGCGCAAGAGCAAGCTGTTTTGGAACATGTTTTTGAAGAAACTGTTCGTTGGCGAAAAG
AGTAATAGTTGCTGGAATTAATATTGATCAACAAATAAAAAAGAGCTTTTTTCATTAAGATAAAAGCTCT
TTTTTTATTTTTTTTAAATTATGAGACAACCATTGTTGAAAAAAAAGCGTCTTTATAAATAGAAGACTAA
ATGAAATCACTTTTGAAAGTAATAGCACTCTATAAAAATGAAGAAGCACTGCTAAAAGGGCTGTTAAAAA
ACAACCGAAGTGCGCAGCGTAAGCTTTACGAATTGCATGCACCAAAAATGTTAAGTGTTTGTCGGTATTA
TATAAAAGATTTGCATCATGCAGAAGAAGTGATGTTAAATGGTTTTTTTAAAGTATTTCAAAATGTGAAC
AAATTTAAGAATGAAGGTAGTTTTGAAGGTTGGATTCGAAAAATTATGGTAAGAGAGGCTATTTCTTATT
TAAGAAGTCAAAAGAAAATTGAATTCATAACAGAAACTATAGTATTAGAGAGTGAATATGAAAATAATAT
TCATTCAACTATTGAGGTAGATCAAATACAACATTGTATTGATTTGCTTCCCGAAGGGTATAAAATAGTA
TTTGTGATGTATGCTATTGAAGGTTATAAACATAGTGAAATTTCAAAAATGCTAAAAATCACAGAAGGGA
CATCGAAATCGCAATTATTTAAAGCGAGAAAGTTATTGCAAAAAAAGGTTAATGAATTAAATAGGACTGG
CTATGCTACAAAATGAGTTTGAAAAAGTGAATAAAGAAATGTTAGAAGCTAGGTCAATACAACCTTCAGT
AGATGCTTGGGATAGATTATCAAAACGTTTAGATGATGATCAACAAAATAAACACAAGCAGTATAAACGT
AAGTATTGGTGGTTGGGTATTGCAGCCAGTTTGATAGGGGCGTTATTTATTACACAACAATTTTTGTATA
GTGATTTTATAACTAGATCAACAGATGTTGATATTGTGGTTACTGAAAATAAAGACATAGATCATTTAAA
TAGAAAGAAAATACTTAAAACAACAACCTTAGTCACGGAAAAACAAGAATTCAATATTGATTCAAATAAA
AGTGTTAAGCATAAGACTGCGTTGGTAAATAGAGAGGAAAAGAGTTCAAAAAAGGAGGCTAAAAAGCTTG
TGGTGCTAAATGTTGTACCAAAAGAAAAAGTGATGATGCCTTCTCAAGTAGCACACTTGGAAAAAAAAGA
TACGGTGTTAAAGGGAGTAACATTTCAAGATCAAAAAATAAAAGAGCTATTAGTAGAGGTTGATGCTTTA
GAGGAAACAGAGGTAGTATTGTCTAATGAAATTATAGAAGATTTGTTGTTAAAAGCACAAATAGAAATTG
ATATAGAAAATTCGCAGATAGAAAATAAAGAAACAGTCAACGCTAGTTCATTACTAAAAAGTGTTGAGAA
TGATTTAGATATGTCTTTTAGAAATAAAGTGCTAAAAGCATTAAAAGAAAATTATTCCAAAGTTAAAACG
GGTATAGTGCAACGTAGAGATGATTAGCTAGATCAGATAGCGTTACGCGAAAGGATGTTTTTTATTCCAG
TTAAATTTTTAAATAATTACTAATAGTTGACTCAGTATAATTACTTGAGGGTGATAACTATTGTCTTTAA
GCAAACAGAAAAAATAATAATTAATTCAAAAAAAAAGAATCATGAATGTAATTACAAAATATATGGTATT
GGTATTGGGGTTTGTTATGAATATCCAAGTAGCCAATGCTCAGGATACTATTCAAAAGGATGTAAATCAA
TTTAAAATCAAAAAGTTAGAAACTTTAAAAGCTGATATTAAAAAACAAGAGCGCGAATTTTTAAAGCAAG
AGGTGGCGGCTATTGATGAATTGTATAGCAAAAAGGAAATAACTAAAGAACAAGCAGCGTCACAAAAAAT
GGAAGCAGCAAAAAAGCGAGCGTTAAATATTGATAATCGAATAGCTATTATTAATAATAAAATTTTGATT
TTAAACCGGAATCAAAAGGATGCTAATTACAAAGGAGTGATAATAGGTGATTCTTTAAAAGAAGTATTTA
ATAGCATCGATTGTGAATCTGATGTTCCGGATGAAAAGGAATATGATAAGCGTATTAAAAGTGGTTTGGT
CTTGGCCTTTGGTTTTAATAATGCACTTTTTGATGGAATGGATTTGGAGGACTCTCCATATAAATTTGCA
GGATCACGTTTTTTTGAAATTGGATGGGCATGGAATGCCAGAGTTTTTGAACATACTAATTTTATGAGGC
TTCGTTATGGGTTATCAATGCAAATAAATAGATTAAAGCCAGATGATAATAAGTTTTTTGTACAGGAAGG
GAATAAAACAATGTTGGCAAATTTCCCAAGTAATCTTAAAAAGTCTAAGTTAACCATGACAAATTTGGTA
TTGCCTTTGCATTTTGAATTTGGACCTTCGAAAAAAGAAGAAAAAGAGACTTATACAAAGTATTCAACAA
AGCATAAGTTTAAAATTGGTGTTGGAGGTTATGGAGGACTAAATATAGGAACTAAGCAAAAGCTAAAATT
TAAAGAAGATGGCGAACGTGTAAAAGAAAAGCAAAAAAGAGATTTTAATAGAACTAAATTGATTTATGGC
GTGAGTAGTTATATTGGTTTTGGGGCAAGTACACTGTATGTAAAATATGACTTATCTCCAATTTTTAAAA
ATCAAGATGTTGATCAAAATAATATATCAATAGGTATTCGTTTTGATGTAGATTAAAAAGGTACAGATAA
AATATTATACGAAATTCTTATCAGTAAATCGTATTAGTAGAAAGCTATCATTTATACATGATATTAATTA
TATAAAAAATAAAGAGCTATCTTAAAAAAAGAAGCTCTTTATTTTTTATATATCCCACCTAAATTTAGAT
TAATTTAAGGTAGGAGTTGTGTTGAAATTTAGCGAGAAATTTCAATTAAATGTTCCTCACTTGTACCATT
GTTAAAGTTAATTTTTAATAGATATATTCCTTGAGGGTAGCTAATTGTACTAAATTGTAGCCCATTAGGA
GTCTCTAGTTGATTGGTAGTAAAACTAGCGATTAATATGGCAGAATTACTATCAAAAAAATCAATGCTCT
GAATACTATTGATATCTTGTGTTTGAATATTTATTAAGTCACTAGTCGGATTAGGGAATATTATAATATC
ACTATTTGTGGTGGTAGCATTCGTTGTAACTATAGGTTGAGTAGGAGGATTAGTATCAATTATTGCTAAA
GTAAATTCGGTACTGGCTGTTAATCCATTAAAGTCTATTGCTTCAATAGCAATGCTTAGTATGGAGCCTT
GTGAATTTACTGGAGGAATTCCAGATACTGTTCCTGTAGCTTCATTAAATGTTAACCAATTTGGTAGTGC
TGTTCCGTTGCTTAAATTTACAATATAAGTTAGTTTATTTCCGGGGTATCCCTTATCAAAAGAATCAGTA
ACATTTAATTCAAAATTTTGAGCAATAGTTGCCGTTTGATTAGTTATCGCGGTTGCAGTAGGCACGGCTT
GTGGTCTTATATTTTTAAAGTAAAAAATATTATCATTCCAATCACAATTAGCAGAACCTGCGCCACATCC
ATTTTGTACAAAATCTTGCAGTACAATATATTCATTAGGAATAAGCTCACCTTTATTATTTATCACACGA
TAAACACGTGCGCCAAGTAGGTCAGGTCTTCTGCCATCAATATTATTTCCACCTGTAGTTAGGTAATTGG
AAATTGCAATTCTAAAAGGTTCACTAATAGTAGTCGCGGTATCAAAACTGATATTGTCACCTCTATTATT
TCGGGGTAATAAAGTTTGGAACCATGTGCGCGAATGAAAAAAGTTAATATCACCAACCGTATCGGTATTG
TCGAGTGCAACAAATCGAGCACCATTTCCACCTGGACCATGCATTGCCGAAATTTGAAATCCAATCACAG
GTTGAGTAGGATCGGCCTGAACAAAAGCTTCAGAAAAAATCATATCACCTTCATAGCCCATGTCAATATT
TGTGGCAATAGGAAAATTTGAAGAAGGTCTAAAAGATCTAAAATTTGGAGGTGTAATGGTACCATTGTCA
TTTACGATACTTAACATGGATGTTTGTAAGCCAAAAGCATCAAATACCTGCTGTGCATTAATTTCTCGAC
CACCTTCTTGACCCTGTTGGTGTGATCCATTAAGTGTGGCTTTAACTTCTGGTGTGGTAATAGCATCAGA
TGTTACGGTCATTTCATTTATAAAAAAGCTTTTACCATCACTGCCATCTCCATCAAAAATAATAGGTAAA
TCAGCAAAACTACCTGCTTCAATACTAAAAGGTAGACTAATAGGATTCCCTGTAGTATCTAAAATAGAAA
AGCTAAAAACTGATGGACCGGAAATTTTAATGTCCGAAACAACTAAAGCTTCAGTACCTACATTGTTTAA
TCGTAGGGTGTTTGAATCTTGAACGTCGGTATTTGGTCTAATGTCTCTTATTTTATGAAATGTAAGGTAG
TCCTCAGCAGGGAATCCGATATTGGTTGTTGGGATTTTAGTTAAATTTTCTAAACTAAGTATTCCATTTG
AAGTAGGAAGTATGGTTGCAGGAGTAGCATTATCCAGAATAAAAACATAGTCTTGATAATCGCCATTGTT
CAAATCTTCAAAAGCAATTAAAAAACTGTTTTCAATAATACTTCCATTTCTATCTTTATTAGGATAAATA
CGAGTTCGATGTGCAACATCTATATTTAAAGGATCTTGCGTATAACTTATTCTATTAAAGAAAAGGGATT
CGACAAATATTCCAAAGACTTCATTTTGAGGGTCAAATTCTTTAATTCCAGATTTAGAAGGAGGAAATAA
TCTTTGCGCATTTTGTAAACCAGTTTCCAAGGTGTCAATTACATTAAATTGTTGTGTTGTTTGTTGGTTA
GTGTACCATCCATAAGGTAATTCCTCGGCAGGGGAATACCTAGCTACAGGAGTCAAGGTTACAGGAGCAT
CTGAGGCTTTTACCCATAATTCTGTTTCAACTTCGTCACCAATAGGATCAGGATTTACACCATTAGCTAA
TGTTGTCCATCCTACATCAATACCAACACCAATGGTGTTAACAACACTTTGTAGCGTAGGTTCTTCTCCG
CCTTCAAAGCCTCTCTTTTTAAGTGCGTACAGGTTAATTCTGGTATTTGGATTGGCAGGATTATTACTTT
CAATAGTTAAAATAGCATCCTGAAAACCTAGATCTTGTTGGTTTAAGTCAGGTGCGTAAATAATATCCAA
TTCATAAGTTTCGCCAGGATTAATACTTACTGCAGTTGCTGTTGGGCTGAAGCTAAATTGATTTGAAAAA
TTTCCAGAAAGACTAATGGTATTAATTTCTAAAGTACTTTGTCCTGTGTTGCTAACACTAATGGTATTGG
TTTCGGTCATTGGACCATCGGTATTAACGGTAGTTTCAAAAAACAATTCATCCGATGATACGGCTATGTT
ATTTGGACCAGATAAAGCCCTTAATAAAGTCAATCGAGGTGTTCCTCCTCCAGCTCTGTCATATTCGGAA
ACATATAAATTTCCTGTAGTAACATCTTCAACAACATCTAATGGGTCATCAAAACCTTGTAAACCGGGTA
TGGCATTGTAAGCGTCAATAACATCTCCACTGGCGCTATTGACATCTAACCCAAGTAGGTCATCTTGACC
GCTAAATCGAGATACAAACAAAAGACCTTGCAGGCGACCTCCAAAAGCATTGCTTTTATATTCAATTACT
CCGTTGGGTGATTTGTTAAAACCAAAATCATAAGCAGGTTCTTGATAATTAGGATCGGGAAGTACTGTAG
AGGGATATTTGGGTACATCTATATATGGATTATCTTCTTGTCCTGGTAAATTACTATAAGCTAGTCCTCC
GTGGTTTAATACGAATTCACCTCGGTAAGGGTTTGGATGACCGTGATATGAACCTCCTTGTGTTTTAAAT
AACCAATCTTTTTGTGTGTTTCCTCCTTGAAGGGCTGGTACATCTGGTATACTTGTTAGTCCATCAATTC
TTCTAGCTAATGTATAATCCGCGGTGGAGGGAGCGTTAGGGGAATTAGTATTGTTTCCCGCTGTTCCATT
TGTTGGGACGTATAACCAGCCATTAGAGTGCCATATTAAGTCGTAAGCATTTCGTACCCCACTAGCAAAA
ATGGTAACAGGAGAGTTTGTGGCATATGGATTATATGTATTGTTACTCATTAAAATGTTATCACTTGGGG
CATTATTAATAACCGAAATATCATCGGTGGTGTATACACTTAAGGGTAAGTTTGTGGGTAATTTATCTAG
TTCTACTTTAAGAATAGCTGCCGCTAAAAGTCTTTCGGGGCGAAATGCCCAAGCAGGGTCAATTTCACCA
CCTGCACTATTACTCCCTTGGCTTATGTATAAATCATTTGATTCATCAAAAGCCAGACTATTGGTTAAAT
GATCTTTTGCTGATCTGGGAAGGTGAATAAGGATATCTTCAACAACTTCTAAGTTTGGACCACTTAAACG
GCTAAGTACTCCATCCCATTCTGGTGCATTAGATAAAGCAGATTTACTATGAGTAATATAAGCGATAGGG
TTGGTTGGTGTTGAGGTCGGATCAAAAGTGAGTCCAATAATTAGCCTAGTGTCATTATCACGTATGCCAT
CAATAGGGTGAGGAGCACCGTTTAATTCAGGAGAAAGTATTTCTAAATTAGAAAGTGATCCATCGGTTTC
AATGGTCCAACGATGTATTTTTCCATCAGAAGCAAAATTTCCTATGGTACTAGCATAAAGTTTTCCATCT
GGGCCAATGATTAAGCTTGAAAAGCGTTCATTTTCTGTACCATCTCCTAGATCAGTTCCAAATACTTTTT
GGAAAGCTACACCTGTTAAATCACGAGAGTTGGAGCCTTGAGTGCTTCGCATGCCTGTAGTAAAGGTAGA
TTCGAAAGGGAAAAATGATAAACGATCATTTAAATTCCCAATTAAATTAGCTTCAACATTTGATGTGATT
CGGTATATATATGTAGTATTTTCTTTAAGAGGAGTAAGTGGAGTAAGGTTAATAAAATCACCTCCACCCG
TATCGTTAGAGTTTGATGGGATTAAAACTTCTCCAGTAGGGGTAACTTCAAATAGATTTACGTTTCCATC
AATGGTATTTTCATCCAGTTCATATCCGTTTGGAGTTATTAAACTTACTCCAATTTGGAAATTTTCTAGG
GCTACATCAGTGGTGTTATTTGCAGGATTTACATCAGTAAAAAATGGACGTACACTATTTGCAATTTGTT
CAATTTCAATTGAATTTATTTTAGTGTTGAACCCGCCACTAGCATCAATAGTTAGTCTTCCATCGGTAAT
ATTAGTTGTTAGGGTTGCTGTCGTAAAACGATTGCCAGTAGTGGCGTTTCCAGTAGGAGTGAAATCATTA
ATGGTATTTATGCCTTCTATATTAATTGTGTGTAATGGTGTTGTGGCAGGACTATCAACTAATGGATCAC
CTACAGATACTATTATGTTGTAAAGTCCTTCGGGAAGTTCTAGTTCCCATATACCCTCAGTTGTATTACC
GTTGTTGCCCCCGGTGTCACCATATTGCATGTGTAGCAATGTGTTTTGTAATTCACTTACTCCATTTGTG
TTTCTGTTGCGTGTATTTCTAGATAAATCTAAAGGCGAAGTACCATCTGTAGTTAGCCAACCGTAGCTAA
AGTTGTTTCCTCTATCTTCAAAAGGAAGTCCTGTATCTTTAAGATAATCAATAATATCAGGGCTTCCGTT
AGTGGTGAAGTTAATTTTTAAATTAATAAGTTCTTCTTCTATAGTAGGGATAATTGAAAAGTCTTCAAAT
GTATAAGTGACTTCGGTGTTCTCATTTTCATTTCTTTTTGAAACATAAATACCGGCAAAGCTTAAGTTTT
GGTAGTTGGTGTTTCCGTCTCGAATTTCTTGAGGTAACTCAATAGTTCCTATTGAAACTTCTGTAGTGTC
GTTTAATTTGTAAAAAGCGGTAATACTATTGGTGTTAACATCAATATGTAACCTTAGTTGAACTTTACTT
GTATTTAAATTAGGGACATTTAGGTTTATTCTTTCAGCATTTGGAGCCAAAGCGTTAAGTTCGGTGAGTA
CTTCAAGATTGTTGCCATTTCGGATTACAAATTTGATAAAGTTATCTTCATTAAGACCTAACCATATTCC
TGCTTGTTCAAAATTGTTTGAAGTGTCTGAATAGGGTTGATTAATAGTGGTAATAATATCAAAATTGGTT
AGTTCGCTAAAATCGATACCAGTTCCTAAGGCGTTTATTTGTGAGTTTGTGTTTCGGCTAGTAGTGTTGT
CCTGATAGGCTATTCCTTTTGTAGCTGTGATAATTAATTGGTTGTTTTCTAAAAGTAATTTAGAAGGCTC
GTACCCTGGTATTTCATTAGAAAAAATAGGTTGGTCGCTAGCAAGTCTAGCAGATGGAGCGTCGACCATG
GTAAATCCAGTATTTGAAATACCACCTTGGCTACCATCAAAAGTTAATTGAAGTGGTAGTTTAGCTTTTA
ATTGGTTGCAATCTAAGGTGCTAATTGGGTTGCAAGGAATAATGCCTACAGTTAATGCTAGGTTTATTAT
AGCAGGTTTGTAGCCTTTTGTTGTGGCTATTATTGTAGCTGTTTCTTGTGTGCCATCTGCTAAATTTGAA
GTGTTAATTTCAAAAGTATAGTTGCCTACTATTCCTGTTTTTTGAATAGTAAGCCATCCATTAGTTATTG
AGGTGTCTGCAGGAACTTCCAGCAGGTTTTCTATTGATAGCGTGAGTGTTGCAGGATCGGAAGAGGCTGT
TAATTCTTCAATTAACGTAACTGTTGTGTTTTCGGGAGTAATGGTTGATACATTAGTGTTGGTGAAGTTT
AAACTATTTAGATCAGCAGTGTTCGTTGATGTATCAATGTTGATGTAGTTGATTTTTGTATTAAACCCGC
CCAAAGCATTAACAGTTAATAAGCCATCAGTAACTTCGATAGTTAATGTTTCTTCTCTAGTTTCTCTTGG
AGTAGGTATAAAACCAGGTACAATGCTAATACCTTCAATGGTTAATGCATGGCGACTATCTATGGAATTA
CTTACATCTCCAACTCCAATAGTGATATCATATATTCCGTTAGGAATTTCAATTTCCCAGTATATTTCAT
TTCCTCGAGGTTGTGATTCCCAAGTTGAAATGTGATTTCCTTGCAAATGGACGAGTGTACCAGTTAATTT
TTCGATGTCTGTAGCGTTATCGTAAGCTATACCAAGTCTGTTTCTTCCAATTCCATTGTTGTTTCCTGGA
ACATCTGCCGAAGCATCAAAAGGGGTATCGTCACTTTTTAATTTCCAACCATAATTATAGTTGCTGTTAT
CAATGGTGATCTGAGATGTTCCAAAAGCTTTACCGTGATCAGCTATATATCCAGTAGGTGGAGTGGTGAT
GTTTGGGTTGTTTTGGAAGTTGATTCGTGCCTCATAAGTTTGGGCGTAACTACTCAGTGTCACTAAAAAT
AGTAACACTAGATAAAGTGTTTTTGTTTTCATAAAGGTGGTTCTATTTATTTGTTGTACAGTTTAATACA
CTTATAAATATACTTTGAATGAATTGTAAGTTTGATGTTGGGTTAGCTGATTTTTTAACAATTTTATTGG
CTGTGCTAAACTGTTAATTTGGTTTTTAAGGCTTTTATCAGAATTAGTATTGAGCTGATAAATTTTAGTA
AAAAATCTTTAAATGAATATAAAAAAAGGATGTATCAAGTATTTTAAGAATTAAACTAAATAACATGTAG
TCAATTTCTTATGATGTAATGTTTAATAGAGAAGATGTGTTTTGTCTTTTTGAAAACCTTACAACTATTT
TAATTTTTTTTTCAACATTTTTATAAAGCTTAATGTTTGTTAAATTTGAGTTTTTGGGTGATTTTTCTTC
GCAAACAGGAGAGTTTGTGTCGTTAATGATTGTCTTTTTTTAGTTGAATGGGCTAGTTCAATTTTTTGAG
CTTGGTTTGTTTTTTGTCTAAATTGTTAAAAATATAATAATTAGATCTGATAAAGAGGGGGTTACTTGAT
TGGTTTTTAATAGGATTTTTAATTATAATAAGTAATTTGTTTTTTTCTTACAATTTGAGTTTTGTGTCAT
TAAACAGCCTATTTTTTGAGATTGATATTTTTTGTATTACTCAATTTCATTTAAAAAAGTAGCTATGCTA
TTAATTGGATGGAAAATTTTGCCTTTTACGGAGGCTAAAGGGAGTTTAAGGGTGTCTGTTCTGTAACCTT
TTTTTTCGAGTAATTTCCAAGTATATTTATAAAATCGTTCTCGTAAATCAATATCAATTTCTCGATATTT
AATGTGTTTGTTATTGAGTTGCTTTTTTAAATTGTCACATTTGCTGCAGGAGCTATTTGTAAAAACAACA
ATTTCTTGTTTCATTAATTCGGCAACATCTGCTTCGCTTTCCTCTTTTCCTTTTAGTTGAATGTTTTCAA
GTGTTTTGTTAGCTACAAAAGTATAGGTATATCTTGAAGGAACATCAACTAGTGGAATTAATGTAATTAA
AAGTGTTTTGGAATTGGGAGGCAGTTGTTTAATAACGGGTCTATCTCCGCTTCTGCGATAGCCATTAGCA
TGTACTTTAAAAAACACACTTCTTGGTTTATTGGTAGTGTTCTTTGCAAAAATTAATGTGCGTTTTTTTC
CGACTTCTTCAATAATATTAACTCCATTTTTTTGGCTGTACGTGTTTAAAAAGAATAGGATTGAAATGGT
TAAAAATAGGTTTTTAATCATAGTTTATATATTTGATTATCAATAAATTTACTATTTTTAAAACTGTTAT
TGAAATTGCTTTTAATTATTTTTTTATCATAGTTTCTTAGTAATGATCACGATTAGGCTTTGATTAGGTT
TATTAGTAACTTTACTTTTTAAATTTATTTATGGAATTAAAGTTGAGTCGCCCCATTTGTTTTTTTGATT
TAGAAACTACGGGTGTTAATATATCTAAAGATAGAATTGTAGAAATATCAATTCTTAAAGTTTTCCCTAA
CGGAAATAAAGAAAGTAAAACCTGGTTAGTGAATCCAGAAATGCCAATACCGACGGAAACTACGGCTGTT
CATGGTGTGACTAATGAAAAAGTAGCAAACGAGCCTACTTTTAAGCAACTAGCAAAAGTAATAAGTGATA
TGATTAAGGGTTGTGATTTAGGGGGGTATAATTCAAATAAATTTGATATTCCACTATTAGCAGAAGAAAT
GCTTAGAGCTGATATGGATTTTGATATGTCAAATAACGTGGCTGTTGATGTGCAAAATATTTTTCATAAA
ATGGAACAGCGTACACTTGTTGCTGCGTATAAATTTTATTGTGATAAGGATTTAACAAATGCGCATAGCG
CCGAAGCCGATACTACGGCAACCTATGAGGTACTTTGTTCTCAATTAGATAAATATCCAGATTTGGAAAA
TGATATGGAGTTTTTATCTGAATTTAGTACACGAAGAAAAACAGCAGATTTTGCTGGTTTTATAGCCTTT
AATGAAAAAGAACAAGAGGTGTTTACCTTTGGAAAGCATAAAGGGAAATTAGTTGAGGAAGTGTTGGATA
AAGAGCCTGGTTATTTTGGATGGATCCAAAATGCAGATTTTCCATTGTATACAAAAAAGATTTTAACAGC
CATTCGTTTACGTAAGTTTAATGCTTAATTGTTTATGAAAATAATTTGTATAGGTCGTAATTATGCGGCA
CATATTGAGGAGTTGAAAAATGAAAAGCCAAGTGATCCTGTAGTTTTTTTAAAGCCAGATACTTCGGTAT
TGTTAAAAAAACAACCATTTTTTATGCCCGATTTTAGTAATGATGTGCATCATGAAATCGAATTTATAAT
TAAAATAAATAGAATAGGAAAGCATATAAATCCAAAGTTTGCACATAAATATTATGATGAGGTTAGTGTT
GGAATAGATTTTACGGCACGAGATGTTCAAAATGAACTTAGAGCTAAAGGTTTACCATGGGAATGTTCCA
AAGCTTTTGATGGGGCTACAGTGCTTGGTAAATGGGTTTCGAAATCAAAATTCCCGGATATATCGAATGT
AAATTTTAAACTTTACAAAAACGATGTAGTTGTTCAGGATGGATTTACTAAATTAATGTTATATTCGGTG
GATGAGTTGATTGCCTATGTTTCAAAATATTTTACATTAAAAATAGGAGATATAATTTTCACAGGAACCC
CAGCAGGGGTTAGTCCGGTGGCAGTAAATGATCAATTAAAGGGTTATTTGGAAGAAGAAGAAATGTTTCA
CATAAAAGTTAAATAGATGAGTATATCGTATGACCTGGAAAAGGTTAAAGAATTGGCAGGTGGGGATGAA
AGTTTTGTGGAAATTTTATTGCAAACTTTTTTAGAGGAGATACCAGAGGATTTAAAAAATATGTCCGATG
CTGTGGCTGTTAATGATGCTAAAGTAGCTTATCAATATGCGCATAAAATGAAACCTAATTTTCAATTGTT
TGGCATTGATGTTATTGATCATATAAAACGTATTGAATCTTGGGCTAATGAAGAAATAACTTTTGATGAA
GCTAAGGTGGCATTACTTGTTGTGGAAGAAAAAGCCGAAAAAGCGATTGTTTCGCTTAGGGAATTACTTA
ATAAGTAACATCAAATGCTAGCAGAAATTATAACGATTGGTGATGAAATACTCATTGGTCAAATTGTGGA
TACCAATTCCGTTTTTATTGCGACTGAACTCAATAAAATAGGAGTAGATGTACATCAGATTAGTTCCATA
CGGGATGATCGTGAGCATATTTTAAAAGCACTCGCCGAAGCACAATCACGAGTAGATTTAGTTTTGGTTA
CCGGAGGATTAGGCCCAACTAAGGATGATATTACAAAACATACTTTTTGTGAGTTTTTTAATGATACTTT
AATTGAAAATAAAGATGTTCTTGAGCATGTTAAAGGTTTATTTGATAAGTATATTAAATCTCCGATTTCG
GAAGTAAATAAAAAGCAAGCCTTGGTTCCAAGTAAAGCAGAAGTGCTTACTAATGAATTTGGAACAGCTC
CTGGAATGTGGTTGGTTGATAAAAATACTGTTTTTGTATCCATGCCGGGAGTACCTTTTGAAATGAAGGC
GATCGTAAAAGATCAATTGATACCCCGTTTGCAAGAACGATTTAATCGTCCTTACATACTCCATAAAACA
ATATTAACTTATGGTATGGGGGAGAGTAGGGTTGCGGAACGGATAGAAGATTTTGAAAATAACCTACCTA
CTTATATTAAATTGGCTTATTTGCCAAGCTTAGGTCGTGTACGATTACGTTTAAGTGCCCGTGGAGACAA
TGAGAAACAATTGAAACTAGGAATAGCTAAAGCTGTTGAGCAATTAAAAGATTTAATTGGAGATATTATC
GTTGGTTTTGATGAGAATGAAAGTTTAGAACATGTTATAGCTAATTTGCTTACTACTCATAATTTTACAT
TAGCTTTGGCAGAAAGTTGTACGGGAGGTAAGATCGCTAGAGGTTTTACTAAAATAGGAGGAGCTTCAGC
GTATTTTAAAGGAGGTTTAGTGCCTTATGATACGGCTTTAAAAACAACTATTTTAGGTGTACCCAAAGCT
TTAATTGAAGCGCATTCGGTAGTGAGTACCCAAGTGGCAGCATCAATGGCCGAGCAATCGTTAAAACTGT
TTCAATCAGATTTTGCGATAGCTACCACAGGTAATGCTGGGCCAACCAAAGGAGATAGTGATGCCGAAGT
GGGGACAGTTTGTATTGCAATTGCCTCGCCGAAAGGCGTAGTTTCTGAACAATTTGTGTTTAGTAACCAC
CGAGAGCGTACCATAGGTAAGGCAGTTAATAAGTCATTAGAGTTACTTCAGGAGCAAATTTTAGCAGTTT
TAGGTACTGCAGAATAGTGCTGTTTTTTAAGTAATGTTATCTAAAAAGTAATTAAATAAAAAAAAACTAA
TTTATTTTAAAAAACAGTTTGTTTGAAAGGTAAAAAATTCGTTAATTTGCACCCTGTTTTGAAATAATAC
AAAAGATACAACCATGTCAAGAGTTTGTGAGCTTACCGGAAAGAAAGCAATGGTGGGAAACAATGTTTCT
CACGCAATGAATAAAACTAAACGTAGATTTAATGCAAATTTAATCAAAAAGCGTTTCTTTATTCCTGAAG
AGAATAGTTGGGTAACACTTAAGGTGTCAACTGCAGCGTTAAAAACAATTAACAAGATCGGAATCTCGGC
TGCTATTAAGGAGTCTGTAGAGAAAGGTATTTATAAAAAATAATTCCTTAATAGGGTTAAATAAAGCACC
ATGGCAAAAAAAGGAAACAGAATTCAAGTAATTTTGGAATGTACGGAGCATAAAGCAACCGGGCAACCAG
GAACGTCAAGATATATAACAACAAAGAACAAAAAAAATACGCCAGATAGAATTGAAATCAAAAAATTCAA
TCCTATTTTAAAGCGCATGACTGTTCATAAAGAGATTAAATAATTAAGTTATGGCAAAGAAATCAGTAGC
AACATTACAGACAGGTTCAAAGAGATTAACTAAAGCCATCAAAATGGTGAAATCTCCTAAGTCAGGATCA
TATACTTTTGTAGAATCTATCATGGCGCCAGACGCAACGAAAGATTTTTTCAACAAGAAATAGTATTTTC
AAAATAGATAAAAAGCCATTCTTCATTTGCAGAATGGCTTTTTTTGGTTATGGCTAAGTTGTTATCTTTG
TTATATAACCACTCAAACTATACAGCATATAAATTATGGGGTTTTTTAAGAAAATTTTTTCAAAAGATAA
AAAAGAGAGTCTTGATAAAGGACTGGAAAAATCTAAAACTAGCTTTTTTTCTAAACTAGGTAAAGCAGTA
GCCGGAAAATCAAAAGTAGATGATGAGGTTTTAGATAATTTAGAAGAAGTTTTGGTGAGTAGTGATGTAG
GGATTAAAACTACAGTGAAAATAATTGATCGCATTGAAGCGCGTGTAGCTAAGGATAAATATTTAGGAAC
TGCAGAATTGGATCAAATTCTTAGAGAAGAAATTGCAGGACTTTTATCTGAAACTAATTTAGGCGAAGCG
GAAGAATTTGTTATTCCTAAGGATAAAAAACCTTATGTGTTAATGGTGGTTGGTGTAAACGGAGCAGGTA
AAACAACTACTATAGGAAAGTTGGCGAACCAATTTAAAAAACAAGGTTTGAGCGTTGTTTTAGGTGCAGC
AGATACGTTTAGAGCAGCTGCTATTGATCAGCTACAAGTATGGGCAGATAGAGTGGATGTGCCTATTGTA
AAGCAGAGTATGGGGAGTGATCCCGCATCGGTAGCTTTTGATTCGTTAAAATCGGGTGTAGCACAAAATG
CTGATGTAATTATTATTGATACAGCAGGACGTCTGCATAACAAGATTAATTTGATGAATGAGCTTACGAA
AGTAAAAAATGTAATGAAAAAAGTAATTCCCGATGCTCCACATGATGTTTTGTTAGTTTTAGATGGTTCC
ACAGGGCAGAATGCTTTTGAACAAGCGAAGCAGTTTACAGCAGCTACCGAGGTGAGTAGTCTGGCAATTA
CAAAACTGGATGGTACCGCTAAAGGTGGTGTGGTGATCGGAATTAGTGATCAATTCCAAATTCCCGTAAA
ATATATTGGAGTAGGTGAAGGGATTGATGATCTACAGGTATTTAATAAATTTGAATTCGTAGATTCATTT
TTTAAATAGGAGAAGAAATATTGATAAGAGTTCCGCTTGGATCTTTTATGAAGCATATAGAAAGAATGGA
TCATAAAAAAAAAGACCATAACTTTTATAAGTTTGGTCTTTTTTTTTCTATGATTGTGATGTGTCGCTTC
TTAGAATTTATCAGTAATTACAGATCCTTCATTGGATGTAGTACCATCTTTTGTAGCTTCACCAGGGGCG
GTATGGTTTTCAATGGTCCAAGTTTTAAATCCTCGGATGTATTGATAATCATAATTCATGTATTTGTGAG
TAACCCCCCATTGTAGAATTTCTACGGGTCCTTTTTCACTATCTAAGGTTCTGTTTAATCCAATAGCATG
TGGCGCACCTTTAATAACAGATTTAATATCAAAGTTAATTCCATCGGGTGACCATTGTACGGTGTTTTTT
TCAGGGCCATCGGTAGTGATTAATGCGGCAACACCATTGTTATATGGCCATACGCAAATTTCATGTCCAC
TATTTGAAATGGGATTATATTCAGATTTAATATAAGGTCCTTTTGGATTATCGGCAATGGCTACGCCATG
GCGAATTTGACGTCCACCAAATGTAATTTCTTCACCCATTTGTTCTCCTTTGTAGTATAAGTAAAACTTC
CCATTAAATGGAATAATACAAGGGTCGTGTACCTTATGGCTGTCAAAATCACCTTTTTTCTCTACTCTAA
ATCTATTTTGTTCTGTTCCTTCCCAAACTCCATTGTCGGCAGGACTTAAAATAGGCTCTTCACTTTTAGT
CCACGGTCCATTAGGTGAATTGGACCAAGCTAAACCAATTTGATTTTTTACACGAACCGTGTAAGGTGAT
TTTACGGTTTGGTAACTTAAGTAGTAAACCCCTTCGTGTACCATAATTTCAACAGTAAAAACAGATCGGT
CATCATAAGCTCCTTTAGGACCTCTTTCAACCGCAGGACCTTGTTCTTTCCATGTAATACCATCTTCCGA
AGTAGCGTACCAAATATCACAACGATCCCAAGGAAATACTTTATCATTTTCGATATCACCACCAAATCCT
TGGCTAGGACCAGTACTACGGGTGTACCATACATAATATAATCCGTCAACCTTTATTAAGGCACTAGGAT
CTCTTCGAACAACACCTTCCTCGTAAGCAAGGTCTCCTTTTAAATCATAAACTTCATATTCAAAAAACCA
ATCTTTACCAAGGTCTCTTGGCCATTTTAAAGCTCGCTTAGTAGCAGCACTTAACTTATCTGGATTGGTA
ATCCCAAATTTGTCAATTATTTCATCCGTTAATTGATATTCTTCTCTAAGATTAGTCTCTTTTTGTGTGC
TCATTTTCTTTACTTTACTTATTATCACGCCACATAAGTAGCTATAGCAATATTAGCAAAAATTTTAATT
TTGGTCTAAGATTTTGATTAATTAACTTTTATTAATATTTCGTTAGATTTAAGTGTATTTGACGTAGCGT
TGATTGTAGCTTCGGTGATAGTTTCGGTGGATTGTACAATTAGTAAAGCTCTTCCTTTACTTGTTGTGAG
GCTGTTGGAATTAAAATCTTGGTTGTTTTGTTTGTCACCATTATCAACACCTAAAACACGAAGTGATGCA
GGTACATTAAATGTGATTTTTTGTTCTTCAGTTTTAACAGGATTACCATCCTTATCTACTAATTGAGCTA
CAATGTGCGATACATCGTAGTTGTTGTTAGTAAGCTGTGAATTGTCAACGCTTAATTTAATTTTAGTAGG
CGCTCCAGCGGTAGTTATATTTTCTGTGATTGTTTTTCCATCTTTTATCCCGACTAATTTAATAGTACCA
GCATTAAATGGAACGGCCCATTTGTATATGTGGTCATCATTGTCTATTAAGAATTTTTTACCAAATGATT
TTCCGTTTAAAAATAGTTCTATTTCGGTACAGTTAGAATAAGATTCAACGGCAATCATTTTTCCATTTTC
GTAATTCCAATGTCTATTAATAGGGTGCCATTGCCACAAAGCATGTTTCCAAGCTTCGGGGTCTTTTGCA
ATGATTTTACCTTTGTTGTCTAATTTGTATAAGGATTTTTCAATGTGTTGTGTAGTCACAAACATATTTG
GCTTATTGTTCCATAAAGAGCGCATCATACCAAACGAGCCACCTTCAAAACCTGCAATGTCTAATAAGCC
CGAAGGTTGTACTACAGTAGGCCAAGGTTCTCTAATTTCACCTTGATAATCTATTCCAGTCCATAGGAAA
GTACCCGAAATATGAGGGCGTTCCATTATGGATTTCCATTCATGCCATTGTGCTAAGTTTTCGGTACCCA
TAATTGGTTTGTTAGGGTAGTTTTTATGACCATAATCATACAATACCCTTCGGTAACTGTAACCTACAAC
ATCAAGGGCATCAGCATAACCCGACAAATGACTTGCCGAGGGTAGGATGCAGTTCGCCGTTACTGGACGT
GTTTTGTCCAATTCTTTTGTCCATTTAGATAATTTTTGGGCAGTAGTGGCAATATCATACTTTCCTTTAG
GAAGTGTTTCTAATTGTTTTTTAATTTCTTCGGGAGCGTAAGGAGGTTCGGACCAAAAATAATTTCCATC
CCAATTCATGTTATTAAAAAATCCAGTCGCAGCAGCATTTCTAGGGTAGGTCCATTCGATTTCATTCCCA
ATACTCCATTGGAAAATCGATGGATGATTGCGATGACTTAGAATAGTGTTTTTTAAATCCTTTTCAGCCC
ATTCTTGAAAAAAGCGTGGATAGCCTTCCGTTTCTGGGAGTGCTTTCTTTTCTTTTTGATTAAAACGTTT
GTCTTTAGGATAATCCCATTCATCAAAAAATTCATCTTGTACCAAAAATCCCATTTCGTCACATAAGTCT
AAAAATTCGTTAGAGGCTGGATTATGCGAAATTCGAATGGCATTTACGCCTCCTTCCTTTAATTTTAAAA
GCCTGCGTTTCCAAACTCCTTTGGGTACAGCCGCTCCCACAAGACCACCATCATGGTGCAGACAGACTCC
TTTTATTTTGTGGTTTTCTCCGTTAAGGAAAAATCCAGTATTTGAGTCAAAACGAATACTTCTTACTCCA
AAACTAGATTGATCACGGTCTATTATTTTGTCATTTTGAGTAATTGTGGTTTCAATTTTGTACAAGTTGG
GATGCTTAATATCCCATAATTTAGGAGACGTAATGTTTAAAATATGAGTGGCTTCAATAGTTGTATTAGT
TTCAACTGTTTGTTCGCTTGCGCTAGAAGTTATAATATTGTCCGTAGTAGGGTCAATGATTACTGTTTTG
AGTGTAAAATTTTGAGTTGCTTGAGTGTTGTTTTTAAGTGTTGTTTTAATAGAAACGTCAGCACTCTCTT
TACTTACTTTAGGTGTTGTAATAAAAGTTCCCCAAACAGGAATATGTAATTTATTCGTAGTTATTAAGGA
AACATTACGGTAAATACCTGCTCCAGAATACCAACGACTATCGGCATAAGTGCGATGATCAACTTTAACA
GCTAGGATATTTTGAGTAGCATCGGTTTTTAATTTGTTCGATATATCAAAATAAAATGGAGAATACCCAT
AGGGATGAATGCCTAATGATTTTCCATTTAAAAAAACTTCAGAATTATTATACACTCCATCAAATAAAAT
GTACACTTTTTTATCTTTTGAAGGAGAAGCAAATGATTTTCGGTACCAACCAATGCCTTCCCCTTTTCGA
TAGCCCGATCCCATGTATAATTGATTGGATGCGTTTGTAGTATCAATGGATTCTTCAATAACCCAATCAT
GAGGTAATAGCACGGCATTCCATTTGGAGTCGTCAAAGTTTTCGCTACTTGCATCTGTAGTGCCTTTGTC
TAAATAAAATTTCCAACCAAAATTAAAATCAGTGATTTTTGGAGTAACTGTGTCTTGGGACTTTGGTTGG
TTGCACGATATAAAAAAAAGTGCCAGTGATGAAATAAGGAAAAATAGCTTCATTTTCGTTCAATATTCTA
TGAGTGAAATTTTATTAATTATATCGTTGTAGTAGTTGTTTGCTATGAAATCATACCTGATCAAAAGTAC
TTATTTTACCAGTGAAAAGCTATCTCCCTATTTGTAAATCTACATATGTGGTACATTATAGCACAAATAG
ATTGGCTTTAGGTATAAATGGGTAAAAGTGATAATTTTTTACTATGGTTTTGTTTTGTTATAAGAGTTGC
TCTTTTAAATTTTTTACGGTTTCAACAGGATTGCTAGCTCCAAAAATATAGCTCCCCGCGACCAATACGT
TTGCACCAGCATCAATAAGTTGATTGGCATTTTTATTGGAAACACCTCCGTCGATTTCAATAAGTAAATC
GGTTTGTTGTTCGGTTGCCATTTGACGTAATGCTGTAATTTTTGAATAGGTGTTTTCAATAAACGATTGT
CCACCAAAACCAGGATTTACACTCATTAAACAAACCAGATCAGTTTCGGTAAGTACGTTTTTTAATAATT
CAATATTAGTGTGCGGATTAAGGGCAATTCCTGCTTTTACTCCATATGATTTAATTAATTGAAGTGTACG
GTGTAAATGCGTACAAGCTTCGTAATGCACGGTAATGATTTCGGCGCCTAATTCAACAAAAGTTTTAATA
TAACGATCGGGATCAACAATCATTAAATGTACATCTAATGGTTTAGTGGCGTGTTTTTGAATAGCTTTTA
AAACAGGCATTCCAAATGAAATATTAGGTACAAAAACACCATCCATAATATCAATATGAAACCAATCGGC
TTGACTGTTATTAATCATTTCAATATCGCGTTGTAAGTTTGCAAAGTCAGCTGCAAGTACGGAAGGTGCA
ATTTTTGTAATTCCCATAGTTTTTATAGTTAATAGCGTTGGTTTAAGTTAAATTAAGAAAGAATATAGTG
TTTTGTACTATATTTTTAATTTTATAGTTGATCAATACGCCAGACTTTCAAAAGTATTAAATTCTTCGCT
TAAGCGAAAAAAAAGACTGTCTACAATTGCAGACAGTCTAATTAAATATAAATTTTTAAGGAATTTATCC
TAAATAAGTTTTCAAAATTTTACTTCTTGAAGTGTGCTTTAAGCGACGAATTGCTTTTTCCTTAATTTGA
CGAACACGCTCACGAGTAAGGTCAAAAGTTTCTCCAATTTCCTCTAATGTCATTGGGTGTTGATTTCCAA
GGCCGAAATATAAACGAATCACATCAGCTTCACGTGGAGTTAATGTTTCCAAAGCACGTTCAATTTCCGT
GCGTAATGATTCGTGCATTAATTCACGGTCAGGATTTGGTGATTCTCCAGAACGTAAAACATCGTATAGG
TTAGAATCCTCACCTTCAACTAAAGGAGCATCCATGGATACGTGACGACCAGAGTTTTTCATAGACTCTT
TTACATCACTAATAGTCATATCTAGCTCGTTTGCAATTTCCTCAGCACTTGGAGGGCGTTCATGAGACTG
CTCTAAAAAAGCATATGTTTTATTGATCTTGTTAATAGAACCAATTTTGTTCAATGGTAAACGTACAATA
CGTGATTGTTCTGCTAAGGCTTGCAAAATAGATTGACGAATCCACCATACAGCATAAGAGATAAATTTAA
AACCACGAGTTTCATCAAAACGTTTAGCAGCTTTAATAAGTCCAAGATTACCTTCGTTAATTAAATCAGG
TAACGTAAGTCCTTGATTTTGATATTGCTTGGCAACCGATACTACGAAACGTAAGTTAGCTTTAGTCAAC
TTGTCCAAAGCACGTTCATCACCTGCTTTAATTCGTTGTGCTAATTCCACTTCTTCATCAGCAGTAATTA
GATCTACCTTTCCAATTTCTTGTAAATACTTATCTAATGATGCTGTTTCTCTATTGGTAACCTGCTTGGT
AATCTTTAGTTGTCTCATCTACGCACTTGTGTTTAAATGGTTATGTACAGTCTATTACGTAAATTGAGAG
ATTAATGTTACAAAAAAATTAAATTTTTTTTAAGTTTTTGATAATCTTAGTAGTTAGTAGCTGTTTTATG
TTGGTTTATGGAATTAGATTTGAGATAATTAGGTAGTGATATATAGTTTTTTCTATAAAGTAATATTCCG
CTTGAACGCACAACCTAAATCAACTATAGAATCAGTTTTTTGAATTCCTTTTATATGATCTAATTTATTG
TATAAAATTTCGCGCATGTGCTCATGAGATTTTGCATTGATGCGTACAAAAAGTGTAAAAGATCCCGTCA
CAAAGTAACATTCAGTTATTTCAGGAATTTCCTTTAGTTTTTTTATAATCTTTTCACTGTCATGATCTTT
TTTTAGGGTAAGCCCTGTAAACGCCCCCCAATCATAACCCGCCTTTTTTTCATTAATTATAGGGCCAATG
CCTGTCAATATCCCGTTTTCGATCATTTTATTGACACGTTGGTTGACCATTGTGTTAGAAATATCTAGTT
TTTGAGCAATTGCAGAGTAGGCTTTTCTTCCGTCCAACTCTAATTCTTTTATGATGCTTCTGTCGTAGTT
GTCAAGTTCAAAATTTTCCATGCTGAAAACTAAGAATTTTAAAATTAGCGATGAAATTTTTTTCAAATTA
ATATAAATTTAATTAATTGTTAAATTTACTTTTTCAAGTGTCTTAAAAATTATTTTAAATCATAAATTGC
TTAATAAATTTAAAATTTAACTTTTAAGGTATTTTTATGATTAAAATTAACTTTTTATTAGGATTGTTGT
TATTGTCCACATTTGGAATGCTTGGCCAAATTGAAGTTACAGGGTCGGTTACAGACAATATAGGGAATTT
TCTTCCCAATGCTGATATTATAGAAAAAGGAACAACCAATGGTACGACAACTGATTTTAATGGGAACTTT
AAGTTGGAAGTTAATAAAGGAGCTACAATTGTAATTAGTTATGTTGGATTTGAATCACAAGAAATCGAAA
TAACAACACAAACTTCTTTTCAAATAACACTGAATCCAGATAATTCACTAAAAGAAATTGTTTTAGTGGG
GAGTAGGAGTCCCAAGCGTACTGTGGTTGATAGTCCTGTTGCCGTTGATATTATTGATATAGCCGAGGTG
ACTTCTAAAACTGGGAAAGTTGAAATTACGGAATTATTGCAATTTGCAGCGCCTTCCTTTAATGCTCAAA
AGCAATCTGGAGCAGATGGTGCAGATCATATAACACCAGCAACACTAAGGGGGTTAGGACCAGATCAAAC
ATTGGTCTTAATTAATGGTAAACGTAGGCATCAATCTTCATTAGTTAATTTATTTGGAACCCGAGGTCGG
GGTAACACGGGGACAGATTTAAACGCTATTCCTGCTTCTTCAATAAAAAGAATTGAAGTTTTACGAGATG
GGGCATCTGCTCAATATGGATCTGATGCTATTGCTGGGGTAATTAATATTGTATTAAAAACAAGTGTAAA
TAAGTTAACAGGCGAAGTTTTTTATGGAGCTAGTGATGTAAATGATAACGGAGGCTTTGGTATACCAGCT
AAAGAAGGATTAGATGGAAATACGTATAAAGCAACAGCAAACTATGGGGTAGCTTTAAATGAAAAAGGAG
GCTATGTTAATGTAACTGGTGAGTTTTTAAAAAAGGAAAAAACATTTAGACCTGGTGCCGATTTTAGATC
AAAATTTGGAGAAGCAAGTATTGATGCTTTTCATGGTTTTTTTAATTCGGAAATTCCCATAAATGACCTG
TCAACATTTTATGCTTTTGGAGGAGCAAGTATAAAAGATACAGATGCTTTTGCGTTTGATCGAGGTGCTA
ATGATAATAGAAATGTAACAACAATTTATCCAAATGGATTTACACCTCGAATTAGTTCTATAATTAGAGA
TCGTTCTATATCTGCAGGAATTAAGTCTAAATTTAGAGACTGGGATGTAGATTTTAATACTACTTATGGT
ATTAATGAGTTTCATTATTTTATCAAAGGAAGTTTAAATGCGTCATTATTGGAAGCTTCACCAACAGAAT
TTGATGCGGGAGGACATAGTTTAAGTCAAAATACAACAGGAATAGATTTGACCAGAAATTTTGATGTATT
ATCTGGGCTTAATATTGCCTTTGGCGGTGAATATAGAATTGAAAACTTTAACATTTTTACAGGCGAAGAG
GCATCATACACCCAATATGATTTAAAAGGGGTTCCTTTATCATCTGCCACCCCAGTTGAAGATAGACCAA
CCGCAGCACAAAGTAGACCAGGCGGTTCGCAAGGTTTTCCGGGTTATAGCCCAGCAAATGAAGTAGATCA
ATTTAGAACAAATCTTTCTGCTTATATTGATGGAGAACTTGATGTAAATGACAATTTTTTAATTGCTTTG
GCAGGAAGGTTTGAACATTACAGTGATTTTGGGTCAACATTTACCGGAAAATTATCTTCAAGATTAAAGC
TAATTCCAAATTTAAATATGCGAGGCTCTTTAAGTACTGGTTTTAGAGCACCTTCGTTAGTTCAATTATT
TTATAATTTAAAGTTTAGTGATTTTGAAGCAGGCGAGTTAACCGAAACACTACTTTCTCAAAATGCTAGT
CCTGTAACCCAATCATTTGGAATTGGTAAATTAAAGGAGGAAAAAGCTAAAAGTGCCAGTGTTGGTTTTA
GTTATTCTGGAAATGGTTTTTCTGCTTCTATAGATGGTTACTACACTAAAGTAGATGATCGTATTGTATT
AACAGGTAGTTTTAATGAGTCCAGTGGGTTAAATCCGAATTTAGGAGTAGCTGCAGCACGCTTTTTTGCA
AATGGGGTGGATACCGAAGTCTTAGGTTTGGATTTCGTATTTACCTATACTACCCGCTTTGATGAACATA
AATTAGGGGCTAACCTTATAGGGAATTTAAACAAGCTTAACATAACAGAAATTAATACCGGTGATATATC
TGAAGCGAATATTGATACATTTTTTGGTGAAGGGGAGCAAGCATTTTTAAAATTTTCGTCTCCAGAATAT
AAAATTAGCTTAGGTGTTGATTACGCATACTCTAAATACAGTGCCAATATAGTAACCACATTTTTTGGTA
ATGTAGGACCTTTTGTAAGTAATGATGATTCAAGCTTAAAAAATACTTACGGCAGTACATCAACTACAGA
TATAAGTGTTGCTTATAGCATTACAGACAATATAAAGATTACTATAGGATCTAATAATGTGTTTAATCAA
TATCCAGATGAACAAGATCCCAATGGAACCGAAAGCTTTGGAATTTATGATGCCGTGCAACAAGGATTCG
GTGGCGCATTTTACTATACACGTTTAAGTTATAGTTTTTAGTTTTTTTTAGTAAAAAAATATAAAGAAGG
CAATTCTGTATTTGTAAATTGGAATAGTCAAACTCGTTTTAAATACCATAAACAAATGAATTTAGAAAAA
ACGTTTATAGACCAAGAGGAAATGTATGGTGCACATAACTATCATCCACTTCCAGTGGTGCTCAAAAAAG
GAGAAGGAGTTTATGTTTATGATGTTGATGATAAAAGATATTATGATTTTCTTTCTGCTTATTCTGCAGT
AAATCAGGGGCATTGTCATCCTAAAATAATAGAAGCACTTACTAGTCAGGCGAATAAGTTAACCTTAACT
TCTCGAGCTTTTTTTAATGATCAACTAGGGCCTTTTGAGGAGTTTATATCAAAAATGTTTGGTTATGATA
AAGTCTTATTAATGAATTCCGGAGCCGAAGCAGTCGAAACTGCTATGAAGCTGGCGAGGAAATGGGGGTA
TCAGAAAAAAGGAGTAGCGCAAAATAAGGCAACATTAGTATTTGTAACCGGTAATTTTCACGGGAGAACA
TTGTCAATTATTTCTGCTTCGCAGGATCCAGTAAGTAAAAATGGTTTTGGACCTTATATGGAAGGGATTA
GCATAGTTCCCTACAATGATATTGAGGCTTTGGAAGTCTGTTTGAGTACAAATAAAAATATAGTGGGATT
TATAGTGGAACCTATCCAAGGAGAAGCAGGTGTGATTTTACCAGATGCTACTTATTTAAAAAGAGTAAGA
GCACTTTGTACGGAGTATAATGTATTGTATATAGCAGATGAAATTCAAACAGGAATAGCAAGAACAGGAA
ACTTGTTGGCTTCATGTGGTGATTGCAAATGTACCGATAGGTGTAATCTTACAAAAGAAATTAAACCAGA
TATTGTAATTTTAGGAAAAGCCTTGTCAGGTGGAGTGTATCCAGTTTCGGCAGTTTTAGCAAATAATGAA
GTAATGCTTTGTATACAACCTGGGGAACACGGTTCCACATACGGAGGGAATCCTTTAGCTTGTGTAGTTT
CAAGAGCTGCTTTGGATGTGATTATTGAAGAAAAACTGACAATACAAGCAAAAGAAAAAGGAGCTTATTT
ACGTGATAAATTAGAGATGTTAAAAGATAAATACCCGTTAATTATTTCGGTAAGAGGTAAAGGCTTGTTA
AATGCTATTGAAATAGATTCTTCGGAGCAGTCAGAATTGGCTTGGCAAATCTGTTTAGAATTTCGAGACA
ATGGTTTATTGGCCAAGCCGACTCACGGGAATAAAATTCGATTGGCACCTCCATTGATTATTACATACGA
TCAAATAGATGAGTGTGTGTGTATTATTAATAAATCATTACAAAAATTTTCTTGTCATGAATAAGGGAAA
TAGCATGGTACAGGATAAAGTAAACACAGAAGGAACAAAGGTTTTTTCTCAACGGCCTGCATTAACTTCT
AACGTAATGATGGTGCGACCTGCTAATTTTGGATTTAATGATGAAACAGCTGAAAATAATGCATTTCAGA
TAAATAATACCGAGATTTCCACAGCAGAAATAGCTGCAAAAGCGGTTCAGGAATTTGATCGTTTTGTAAC
TATGCTCAAAAAGAATGATGTAAATGTAGAAGTAATTCAGGATCCACAATTTCCTGTAAATCCAGATGCT
GTATTTCCTAACAATTGGATAAGCTTTCATCATCCCGATTTTGTGGTTACTTATCCAATGTTTGCATTAA
AACGAAGAAATGAACGGAGAAAAGAAATTATTGATGATTTAAAATTAGCATATAGCATAAAGGCGCAATT
TGAATTTGAACATTTCGAGAAAGAAAAAATGTTTCTAGAAGGAACAGGAAGTATTGTTTTTGATCGCACT
CATAAAATAGCCTATGCTTGTAAATCTATTCGAACAAATGAATATCTATTCAATAAATTTTGTGAAGATT
TACATTTTACTCCCATACTTTTTGATGCAGTAGATAAAAAAGGACAGCCAATTTATCATACAAATGTGAT
GATGACTGTTGGAGTAGATTTTGTAATCATTTGCATGGAAAGTATTGCTTCTGTTGTTGACCGTAAAAAG
CTAGAAGCATTATTTAAAGAAACAGGAAAAGCCATAATACCCATATCCATTCCGCAAATGGAACAGTTTG
CGGGAAATATGATACAGCTTAAAAATAAAAATGAAGAATCTTTATTGGTTATGTCTTCTAAAGCATTTAA
TTCATTGACCCAAGTGCAACTAATTGAAATGGAAAATTATGCTAAAATTATACATGCTGATCTGGATGTA
ATTGAAACTTATGGAGGAGGAGGAGCGCGTTGTATGATCGCTGAAATTTTTTTAAAACCCTTACATGGGA
AATAGACAATTTATACTAATATCCAATTAATGGAAGAAACAAAAATACTTATAGATTCTCAACCAAAATA
TAGTGTGCAAGCCGAATTCAATAGGGCGCAAGCAGTAATAATGCATGAACCCTCTAGTGAATTATATTAT
GGTGTATTGCATCCACATGCGGCTCTTTTTGATTCTTATTTTAATGCAGCCAAAGCGGCTAAAGAACACA
AGCAATTTCAGCAATTACTAAAAAACAGAGGTATTGAAGTTTTTACTGTTAAAGAAGCTTTATTGAAAAA
TGTAGTAGATGAGTTAGGTGAACCTATTGAAGGTAAAGAGTTGGAGGAATTTAGAGATTTTGCCCGTTCA
TGCGTGCGTTTAAACACACCAAGTTTAACAGGTTTAAGTTATGATGAAATTGTAGAACAACATATTTATT
TAGACAAGGTGTTTAAAAAAATGCATCCTGTTGACTTAGTGCGTACTATTTTGTTACAACCTAATTTAAT
TTTAAAAAGAACACTTACAAATACATTTGTTACAGCGGATTATAATGCAAATCCAGTAATGAACTTATAT
TTTTCCCGAGATCAAATTATTACTACAGGTAAAGGAGTTGTATTGACCAATTTGAATTCGCCTCAGCGAG
AAATAGAAACACGTATTTTATGTATGTGTTTAAAAAAAATAGGAATTAAACCGCTATTAGACCTTTCTAA
AGTAAATAAAAGTGCTCATATCGAAGGGGGAGATTTTTTTATGTTAAATAACATAGCCTTAATAGGTGAA
GGGATGAGAAGTAATCGATTGGCTATTGAAATTTTAATGAAAGCCGATGTGATTGGGACAGAGCAAGTAG
CTCTGATAAAGGATAACTATCACTATCAACCTCAAATGCATTTGGATACTTATTTTAATATTATTGATAA
GGATTTGGTAGCTATTTCGCATAATCGTTATAACGCTGGACCAGGTACTAAACAAGAGTTATTAGTTGAT
ATTTATGTAAAAGGTGCAGCTTCATATCAATTGACGGAAGTATCCATTCCTTTTAAAAAGTATTTAGAAG
ATTATTTAAAAGTAGAGGTGATTGTAATTTCTGACGAAGATCAAAAAAATTATGGCTTAAATTTTTTATG
TATTAGTCCAAGGAATATTATAGCTGTAAAAGGGCAGTCTGAAGATTATAAAAATAAAATGGCACTTCAT
AATGTAGCTGTCGAGTGGGTCGATTTTGAAAATTTAAAACAAGGTTGGGGTGCGGCACATTGTACCACCC
AAGTTATTAATCGTAAAATATGATGTATGAGTAATGCTTTTTATACCATTCCAGAACCAAGTAATGAATT
AGTAAAATCATATGCTAAAGGATCATTAGAGCGAAAATTATTATTTGAGGCTTACGATGAAATGTATAAA
AGGCGAATTGTGGTTCCTCTGTACATTAATGGGGAAGCAATTTTTACTGAAAATAAAGAGGCAATTAGGC
CGCCACACGATTTTAATCATGTGGTAGGAGATTATGTTAAAGCTAGTCCTAGTCATGTTAAAAGTGCCAT
TGATTCATGTTTAAAAGCAAAGGCGGATTGGGAGCAAATGCCTTGGCAGGATAGAGCGGCAATTTTTTTA
AAAGCTGCAGCTTTAATTTCGGGACCCTATCGGTATAAAATAAATGCCGCTACCATGATTGGTCAGTCTA
AAAATGTATATCAAGCAGAAATTGATAGCGCTTGTGAATTAATCGATTTCTTTAATTTTAATGCTAAGTT
TTTAGAAGAAATATATAGTTCGCAACCCATTTCTTCTGTTGGAATATGGAATAGAACCGAATACCGCCCT
TTGGAAGGTTTTGTATATGCCATTACCCCATTTAATTTTACCGCAATTGCGGGAAATTTGCCAGCGGCAC
CCGTTTTAATGGGAAATGTTTGTGTTTGGAAGCCTTCGGAAAGCCAAATGTATTCGGCTAACATTATTAT
GGAAGTTTTAATAGAAGCTGGTTTACCAAAAGGAGTAATTAATATGGTATCTGGTGACCCGGTTATGATA
TCAGACAGTGTACTTAATCATAAAGAATTTAGTGGGCTTCATTTTACAGGTTCTACAAAAGTGTTTAAAA
CCTTATGGAAGCAAATAGCACTTAATTTAGATCATTATAAGACGTATCCAAAAATTGTAGGGGAAACAGG
AGGGAAGGATTTTGTCTGGGCGCACCCATCGGCGGATGCAGCTATAGTTGGAACAGCTCTTATCCGAGGC
GCATTTGAATATCAAGGGCAAAAATGTTCAGCAGCTTCTAGGGCGTATATTCCAAAGTCAATGTGGGCCG
AATTGAAAGTTTTTTTAGAAGCTGAACTTAAAACGATAAGGGTAGGTTCTCCACGTAAGGTTTCAAATTT
TATAAATGCAGTAATTCATGAAGCTTCATTTAAAAAATTAGTAGAAATTATTGAATTTGTAAAAGCCTCA
AATGATGCATCCATACTTTTTGGAGGGGGCTATGATAATAATATTGGCTACTTTGTTGATCCAACAATTA
TAGTTGCTAAAAATCCCAATTTTAGAACAATGACGGAAGAGCTATTTGGACCTATTTTAAGTATTTATGT
GTATGAAGACACACAATGGGAAAAAGTTTTAAAAACAGTAGATCAAACCTCGGAATATGCATTAACAGGA
GCCATTTTTGCCCAAGAGCGTTCTGTGATCACAAAAGCAACAGCTATACTCCGTAATTCGGCAGGTAATT
TTTATATTAATGACAAGCCTACTGGAGCTGTAGTGGGGCAACAGCCATTTGGTGGAGCCAGAGGCTCAGG
AACTAATGATAAGGCAGGTTCTATTTATAATTTATTACGTTGGGTTTCTCCGCGTACTATAAAAGAAAAT
TTTGTACCTCCTACAAATTATAGCTATCCATTTTTGGAAGAATAATATTAAGTAAAAGTGTTTTATCATG
TTTTAAATTAACTATTATGGTATTTGATATTAAAGAAATTATTACCGCAACCATGATTCTATTTGCGGTT
ATAGACATTGTAGGTAGCATTCCCATTATTATTGATTTACGTAAAAAAGTAGGGCATATTCAGAGTGGAA
AAGCGACTATAGTTTCAGCAATATTAATGGTCACATTTTTATTTGTAGGAAAGCAAATGTTGGAACTTAT
AGGAATTGATGTAAATTCCTTTGCCGTTGCGGGGTCATTTATTATTTTTTTTATAGCCTTGGAAATGATT
TTAGGTGTTCAATTGTACAAAGCCGAAAGTTTACAAACTGCGGCCATAGTCCCTTTGGCTTTTCCTTTAA
TAGCTGGGGCCGGTACGCTAACATCAATTTTATCACTCCGATCAGAGTACCAACCTGTAAATATTATAAT
AGCCATATTGATTAACTGTTTGGTGGTTTACATAGTATTAAAATCTTCAGTCAAAATTGAAAAAGTACTT
GGAAATCAAGGGATAGATGTAGTAAGGAAAATTTTTGGTGTTATTTTATTGGCTATAGCAGTAAAGTTAT
TTACAACCAATATTAAAGGTTTGTTAGCCTAAATTATTATTTTATGAAATTAATTTTATTTTGTTATGTG
TCAATGTTATTATCATTATCGGCATGTAAAAAAGAAGTGCCACAAATAGCAGAAGCTGATACAGAATTTA
TTTCCAGATCACACCTTTCAAACGAAGAAGAAATTTCTAAAGTGCCAATACTTAATTTTGGAACATTTCA
CATGGGCAATACCAATGATGCTCGTAAAACCGAATTTGATGAAAAAAATGAAGAAAATAAAAGAAAAGTT
CATAAAATAGCCAACGCACTTGCCAAATTTAAACCAACGGTTATAATAGTAGAGAGATTACCTAAATATG
ATAAAAAATTGCTTGCTAGCTATAATGAGTACATAAAAAATCCTAAGGAGTCTTTTAAAAATCCTAGCGA
AATTGAACTTTTAGCATTCGAAGTTGGGAGACTGAGTAATACAAAAAGAATGTATGGGATTGATCACCAT
ATGGATTATAATTACATGATAGGTGACGAAATTAAGAATCAAATAGATGCTACTATGTATAATCAATTTG
ACATAAACCCACTACTGTATTACCCCAAAATTAATGTAGATGAGGATAAATTAAGTCTGCTTGATAAATT
AAAATTAACGAATCAAGATGATTACTTAGATTTTCTTATTGAAGCAAATGCAGATATACTTACTCATGCT
GGGACAGATGCTAATTTTGAAGGAGCAGATGAAGCAGCAAAATATTACAAAAGAAATTTAAGAATGTATT
CAAATTTAAATAGAATCAAATTAGAACCTACAGATCGCGTTTTTATGATTATGGGGGCATCTCACACAGC
TTTTTTTAGAGATTTTATTAAAAGAAGTCCTAAATATAAAATGGTAGATACATTTGATTATTTAAAATGA
ATAATTTAGTTATCACTTAAAAACCGCATTAGGAAAAACAACAGGACTCTCAATACCTTCCATACTTACA
CTAGAAACACCAAAAAAATAATTGTCAATAACAATTCCTTTTAAAGTAAATTGATCAACATTCCCAACAT
AGCGAGAATAATCCCAAGTTGGGGAAGTAGTGCTACGCCAATAAATTTTATAGCCTTTGATATTGCTATC
GCTTATTTTTTTCCATTTCAATTTTACCGAAGATTCTACGATACCACCTATTTTTACTTCGGTAGGTGGG
GGAGAAGCCCAAGCTAATTGCGCTAAGTTTATAGCATTAACAGCAGTTAATTTTGCTGCATAACCAAAAT
TTACATGTTCTACAGTATCTCCATAATCAATACCATTTTCGGTACGAATATCTTGATGTTGTTGGGTGTA
ATTTTCATGTGCTTCCATAATTCGAATACCTGCATAACCTAAATCATTAAAAGGTTTGTGATGACCACCA
CGACCAAAACGATCTAAACGATAAATGAGCATTGGATTCATTTCGGGCATATAGGTTTGTACGCTTTTAT
GTACATAACGTGCTAATTGGCGAGATATCCCATCGACTTCTCCTCCATAATAACGTCTACGCTTTATTTG
ATCCTCGGTATCAGTAATATTTGTAGGTTCCGAAAAAATTCGAAATGATCTGTTGTCAATAACTCCATCT
ACTCCTTTTATATTTCCGATCATATCGTTATTGAGTACGCCTATAATGTCCCAAGCTTGTTCTTTGGCAT
ATTTAGCTAAACCTGCTCCTCCAAATAAGCCTTGTTCTTCGCCTGAAAGACCAACATAAATAATGCTATT
TTCAAAAGTGTATTTTGATAATACTCTAGCTGCTTCAATAGTACCTGCCATTCCACTAGCATTGTCATTA
GCACCAGGAGCATCTGTTGTGAAATCCATAGTGTCGCTTGCGCGAGAATCAATATCACCACTCATTATTA
CATATCGGTTTGGATATTTTGAACCTTTTTGAATAGCGAGTACATTTACCACCCAAGCATCTTTAGGGAC
TCTTTTGCTCATACTTTTTGTTACAAAATCTTTTTGATAAGAAACTTCCAAACAATGGTTACAGTTTTTT
GAAATTTGTTCAAATTCAGCCTTAATCCAACGCCTAGCCGCTCCAATGCCTCGAGTTTCAGAAAGGGTGT
CGCTAAATGTATTTCGAGTACCAAAACCAGCGAGTTTACGAATGTCTTTTTCTATTTGTTTGGCAGAAAC
ATTTTCTATAATATCATAAATTTTGGATTCGATTTGTGCGAATGAAAATTTGATTAAAAATAAAAACGAA
ACTAAAAGTAGGCCTTTCTTCATAGCAATATTTTTTTCTAAAATAAATAAAAACTAAGGATCTATGAGTA
ACCTTAACAAAGCGCTAACGAATGTATTTTTTAGATGCTTGTATGTATAAAAAAACACCTCAACAAATTA
AATTTGTTGAGGCGTTTTAATAGTAATTTATTCAAAAGAATAAGCCCACTGGTGGGTTAATCTCTTTTTT
CACGAGGTTTACGATCACGATTGTCTCTTCCTCTGTTATCTCTGCCTTTTCCTTTATCGTCTCTTGGTGG
ACGTGCTACATAACCTTCTGGTTTAGGTAGTAACGCCTTTCTTGAAACTTTTTCTTTACGAGTTCTTGAA
TCTATACCAAAATATTTAACATCAAGCTCATCACCAAGGTTTAATACATCGGTAACGTTTTCAACACGTT
CCCATGCAAATTCAGATACGTGCAAAAGAACTTCGTTACCAGGAGCTTCTTTGTATTCAACAACGGCACC
AAAATCAAGTATTTTAATTACTTTAACTTCATACACACTACCAACTTGAGGTTTGAATAACATGGCTTCA
ATTCGTGCTAAAACAGCATCAATACCTTCGGCACCTGTTCCTAAAATTTCAACAATTCCTTCCTCCGTAA
CAGGGTCTTCGTTAATTACAATAGTGGTATCTGTAGTTTTTTGTAATTCTTGAATGTTTTTACCTCCAGG
ACCAATTAGAGCTCCAATAAATTCATTAGGAATTACACGTGTAACCATTTTAGGGGCATGATCTTTCACG
TCTCCTGCAGGTGTAGCAATGGTATCTGTAAGTTTACTTAAAATATGTAAACGACCATCACGAGCTTGCT
TTAATGCATTTACCAAAATTTCATAGCTTAAGCCTTTAACTTTGATATCCATTTGACAAGCGGTAATACC
ATCTTCTGTACCTGTAACTTTAAAATCCATATCACCTAAATGATCTTCATCTCCTAAAATATCAGATAAT
ACAGCATAGCGATCACCATCAGAAATTAATCCCATTGCAATACCCGATACTGGTTTTTTAATTTGTACAC
CAGCATCCATTAGTGCCATTGTACCGGCACATACCGTTGCCATAGATGAAGAACCATTTGATTCTAAAAT
TTCAGAAACTACACGAACAGTGTAAGGACAATCTTCGGGTACCATACCTTTTAATGCACGTTGTGCTAAG
TTTCCGTGTCCAACTTCACGACGAGAAGTACCTCTTAACGGTCTTGCTTCTCCAGTAGAGAATGGAGGGA
AATTATAATGTAAATAGAAACGTTCTTCTCCTTCATGCGAAGCGTTATCTATAATATTTGCATCACGAGA
AGTTCCTAGGGTAACTGTAGCTAATGCTTGAGTTTCTCCACGCGTAAAAATTGCAGAACCATGTGTGGTT
GGTAAGTAGTCAACCTCACACCATATTGGTCGTATATCGGTTGTTTTACGTCCATCTAAACGAATTCCTT
CTTCTAGCGTAAGATTACGAACGGCCTCTTTTTGTGTTTTATTAAAATATTTAGAAATTAAATCACCTTT
TTCAGCTAATTCTTCTTCAGAATATTGCGCTTGTAATTCTTCTTTAATTTCTCCAAAAGCAGCTCCTCTA
TCATGTTTAGCAGATGCTTGTTTGGCAATCGCATAACATTTATCATAAGCAAAATCATTAACTACTTTTG
CTAATTCTTCGTCAGTATCTTCTGGTGTGTATTCACGCGTTTCTTTTTTACCAAAAGCTTCGGCTAAACG
TACTTGCGCAGCACATTGTACTTTTATGGCTTCATGAGCTACTTTGATAGCTTCAATCATTTCTTCTTCA
GAAATTTCATCCATTTCACCCTCTACCATCATTACAGAATCGGCTGATGCACCAATAACCATATCAATAT
CAGACTCTGCTAACTGAGCAAAAGTTGGATTTACTATGAATTCGCCATTTATTCTACTTACTCTTACTTC
AGATATAGGTGCTTCAAAAGGAATATCCGATAATTGAATGGCAGTTGAAGCAGCAAGACCAGCTAAAGCA
TCTGGCATTACTTCTGGATCATGAGACATTAATTGTATCATGATTTGAGTTTCTGCATGGTAATCTTTTG
GGAAAAGTGGACGTAATACACGGTCAACAATTCTCATTACTAAAATTTCTTCGGTACTAGGACGCGCTTC
TCTTTTAAAGAAACCACCTGGATAACGACCTGCGGCAGCGTATTTTTCTCTGTAATCAACAGTTAAAGGT
AAAAAGTCTACATCAGATTGCTTGTAGTTTGATACTACTGTACAAAGCAACATTGTTTTACCCATAGTTA
CAACAACAGACCCGTGGGCTTGCTTTGCTAATTTTCCAGTTTCGATAGTAATTTCTCTACCGTCACCAAG
GTCAATGACCTCCTTAAAAACTTGTGGAATCATAATTTTTTTTAATCATTTTAGTTTGTCTCGATTTGTT
GGTGGCAAATCATTTGTTGTTGTGTTGCTAGGCTTCGTGAGAAGTTCCTTTTAGCAAGGGAGACAATTTA
TATAAAGCTTTGTTTTTTAAATTATTAAAAAAGTAAGTTTTGAAAAGGTGTTTTTCAAAAAAAAGCTTAA
TCTGTAATTTGACGAAAGATACGTTTTTCTTTTCATTTGGTGATAAAAAAAAACGGAGCCATTAGCTCCG
TTTTTTTTATATAAATATCGTTGGCTTATTTTCTTAAACCAAGCTCTTTTACAATTGCACGGTATCTTAA
GATATCCTTTTTGATTAAGTAGTCTAATAAACTTCTACGCTTACCTACTAATTTTACTAATGAACGCTCA
GTATTATAATCTTTACGATTTTGTTTTAAGTGCTCAGTTAAATGTGTAATTCTGTGTGTAAACAAAGCAA
TTTGTGCTTCTGCAGTTCCACTATCGTTTTTTCCTTTACCGTGTTTAGCAAAGATTTCTTCTTTAACTTC
TTTTGTTAAATACATTCCAATATTATTTAAATGATTATTATGCATTTGAAAGATTTTCTTTCAAGGCTGC
AAATGTACCATTTTTATTATTATATTTTGCTTAATATGTAAAATATAATGGATGTTTTTTAATACATATT
AATTTAGGACATTAGAAAGTACTTTTCTGAGCTTTTTAGGATTTAGTCTGGTGTCAATAATAGTTCCTTT
GGTATCTATTAAAAAGTTTTCGGGAATATTTTTAACTCCGTACATATAGCCCACAGGATTTTCCCATCCG
TTTAAGTCACTTAATTGTATCCAATCTAATTGATCCTTACGAATGGCATTAAGCCAAGCTTCTTGATTTT
GATCTAATGATACGGCTACAATTTCAAAACCTTTAGCGTTGAATTCATGGTAAACTTTTCTTAATTCTGG
ATTTAATTTTTTACAGGGTAAACACCACGAAGCCCAAAAATCAATTAGTGTATATTTCTTTTTTACATTT
GAAAAAGTAATCGATTTTCCATTGGAGTCATTTTGTGTAAAATCAGTGAATTGATCTCCTTTTTTAGGGT
TTTTACTTAACTTAATAAATGTGCCTATTATTTTTCCGTATTTTGAATTTTTGGTTAGCTCATTAGCTTT
GTTATATGATTTGCTAATAATACGCTTTTAATATAAATATTTCGTATATTTAAGGATGCCAAAATCATCT
ACTCT



spacer
spacer