Dbfetch

>NZ_DS990632.1 Octadecabacter antarcticus 238 scf_1106129327948 genomic scaffold, whole genome shotgun sequence
TAAAAAAAATATGGAGAGATTCAATGGGACTATCAATTGCGACAAACACAGGCGCTCTTATGGCATCGGC
TGCCGCGTCCAGTGTAAACAAGGACATGGAAACATCGATGGAGCGCCTGTCGACAGGCAAGCGCATCAAT
TCTGCTTCTGACGATGCGGCTGGCGTCGCAATCGCATCACGTTTGACATCAGAAATCAGAGGCACCAACC
AAGCTATCCGCAACGCACAGGACGGCCAGGCGCTGATCGACACAGCTGAGGGCTCACACAGCGAAGTCGA
AAACATCCTGCAGCGTATGCGCGAACTAGCCGTACAGGCCGCGAGTGACACGAACGATACTGCCGATCGC
ACAAATCTTCAGGTCGAATTTGATGCACTCCTAGAAGAAGTTGATCGTATTTCTGCCGTGACTACGTGGG
CTGGTCAGACATTGTTAGATGGATCCGGTGGCTCAGCTGGTGCGTTCACGTTCCAAATTGGTGCTGGTAC
ATCTTCCAGTGACACGCTCACTGTGACAATTAAAAGCCTCGGAAGTTCTGGCAGCGTTGTAACGGCTGGA
AGCTCACTATCACTCGCCAGCAACGGTAGTGCTGCTACTGCAATTACCGCGATCGATACTTCGATTGCAA
ACCTAAACGCCCAACGTGCAGAATTGGGTTCAGCCTCAAACCGGCTAGATAACACAGTGGCAAACCTCAC
TAATGTTGCGATAAATCTCGAAGGTGGCAGAGGTCGGATTGAGGACGCAGATTTCGCGTCAGAGAGTACT
TCGCTTGCCAAGTCACAGATTTTGCAGCAAGCATCCACCGCAATGCTAGCACAGGCTAATGCGTCGAAGC
AGAACGTGCTAAGCCTGCTACAAGGATAAAAGTTAACTAATTGAGGCCGACATCAACGTCGGCCTCAATT
CTAATACGGAGTTTTACAATGAAAAGGGTTATTACATACGGGACCTTCGACGTTTTCCACTATGGTCACT
TAAGAATTCTCGAAAGAGCCCGGCAGATGGGAGACGAGCTTTACGTTGGCGTTTCAACAGACTTGTTTAA
TTATGAAAAAGGGAAGCTTGCTTTTGAGAGTTTCCCTACTCGTAGAAAAAAAGTATTTGGTACAAACTTA
GTAAATCAAGTTTTTGCAGAAAATTCAATGTCTCAAAAGTGCTCGGATATAGCTCGATTAAAAATAAACA
TACTAGTAATGGGTGACGATTGGAAAGGTGCGTTTGATTATCTACATGACATTTGCGAGGTACGCTACTT
GATGCGGACGCCCAATGTATCAAGCACCATGATTCGCAACGCAATGAAAAGCTCACAAATGGGCCAGAGC
TTAAAATGATTGCTGAAAAAATCAACTATCATCAATTGCATATCACTGAAGAAGATGTCGATAGATTGAG
GGCATTGTCAGATCAGTCAATGAATTTTTCAAATATGGCTGATGACGACTACTTTTCAAAGCCAGAAAAT
GTTTATAAACTAGCATTTATTTTAGGTATTAGAAGTGATGCAGCGCAATTACTAAAAATATGGCAGAATC
TTTCTGAAACATCAATCGTGCGTGATGCGATAGAGTTTGAGATACGCCTTTTAATAGGTCCCAGGATAAA
TAT