Dbfetch

>gi|224514635|ref|NT_113950.2| Homo sapiens chromosome 21 unlocalized genomic contig, GRCh37.p13 Primary Assembly
AAAAGAACAGCTGGCCTGGGCTTGCTGCTGGGATGCGGGTGGGGCTCTGGGGGGGAATTAGCAAGGCTTT
GAAAAGGGTCTTGAATGGACAGGGATGCCCATAATCGGGAAGCAACTTCAGTGGAAAATAAAACCTCCCG
GGTAGCTTGCCAAGCAGAAGCAGGAGATGAAGGTCGTTTTGTGTGCACGCCATGGCTCCCAGCCTGGGGG
TCCAAGGCCAGTGTGCCAGAAACTGCCTGGAAACTGCAAACACAATGGGACCCACCAGGGAGGACACCCC
CTCTCCAGGGCCAAGGGCCAGCAGGGAAGTCCCAGCTGCAGTAAGGTTTCCAGTGGGGCCTGCTCCAGAG
GAAAAGGGAGACCCTCCCTGATCTGAAGGTTCAAGTTCATTGCCAGGAAGCCGCCCCCCTCAACCCGCCT
GAGCTTGTGGGAGACCCTCCCAAGGCAGCCATGGGGGCCTCTCACACCGGCCCCAAAACAGCGTCAGGAA
GGAGCTACTGAAATCAGGCGGGTCTCCAGGGAGGAGACGCCCTGGCCACTGGGCCTTTGCCAGATGCTAT
TGCTTTGAAAATGGCCCAGACTCAATCTGAGAAGTGTCACTGGCTTCACCAAGAGGAAGGTGACCCACGT
CTCCAGGCTCTAGTTGAATCATTTCTGGAAACTGGGTGAATGCTCCTTATAAATGAGCAAAATCTGAAAT
CCTAAATTAAGTTATTCTTAAAAGAACACTGCCACATCAATTTCTGATACAGTTATTCATTGCTCAATAA
CAAACGACTCCAGAACAGATTGACTTGGGGGTTCTCCTGCTTCCACAGTGCCACTGGGTGCAGGGATGGT
TGGAAGGTCCCAAATGGCCTCACTCCTACAGCAGCTCAGCTGGGCTGCTGGTGGGAGGCCTGGTCCTCCA
CTGACTGGGCCTCTCCATGTGGCTGCTTGGACTCCCTCACAGTATGGCAGCCAGGTTCCCATCTGCAGGA
AGTGGAAGCCTAGTTTTCTTAAGATCTGGGTGTGGAAATCTCAGGATGTCACTTCTGCTGCATTGTTTTA
GTCAAAGCCATTAATGGGGAATCCAGGATCAGGGATTTACACTCTGTCTCTCGGTGTGAGGGGCAGTATG
CAGTTGTGCTGGGGAGGGAGAATTGGTAGGGCCATCTTTGATGACCACGATACTATAAGCCTGTGTTCAT
GCAGAACCACCTTGCCACACTGCCCAGGGCCAGTGTGCAAAGACAAAGGTAAGTGTGTTGGGAGAGTCTT
AGAGACAGGTGCCGAGTGCAAACCTGCCTCTCGGTGCTCAGGTACCTGGGCCCCTGCCAGGTGAGATGGC
AGACCGTGCCCTGCTGTCCTTCAGAGGCTTCTGGGCCTTTCCCTCTCTCTGTACCATCTCTATCCATCTC
ATGGGCCTAGGATCTGTAGAGCTGGGACCTTCTCCATCACCACTGCTGTGGGAGCTCCTTCCCACCAGAC
AGGCTCCCAGAAAGCCCTGGCAAGGCTGATCAGTTGGTGGGAATCCACCTGCAGGTCCAGAAGGGGGACA
CCAAAGTCAAGCCCTATTGATTTTTGCCTCTATCTGTAAGCTGCAGAGTGGAGCACCCTGCCCTCTCCAC
CCCATGTGGAAACCCTCCCATCATTTCACCTCCCTCCCCACCCCAAGCTCCAAACAAATCCTGTGCCTTG
GTCTACGATGAGGAGGGGGGAGGAGTATTTAATTTGGTAATAAACTTGGATCAGGTCCTGCTCCTGAAAA
CAGAGCCTGCCTCCATCTGCACTTGGCCATATACACCCAGCCTTAGGATTTGGGGGCCCAGCTCAGGAGG
GAAGGGGATAGGCAGCCCCTGAGCCCTGGTGAGACACTCATGGTGTGGCCATCTAGAGAGGGTGCTCGCC
GAAGTCTAGGGTCCAGAGTGTAAATGAGCAGTCACTAAGGTTTAGAACAGTATCTAGACCTTGGAAATGT
ATGCAGCATTCAGCAACAAGCCATTTAACTTCCAGAGATTGACCTCTAAGCAAAATATTGGAGCTGTGTG
CAAAGACCTCTTGTATACAGTGATATTCTGGGTGACATTTGACATTCTTTCTGCAAATGCCTGAGTCATG
CCCAGTTCATGCTTGTGAGGGGCACAAAACAGTGAACAAAGTCAACAGCTGTGTGCCTGTCCCGGGACAG
AGAGCTCGTGTTATTTGCTTTTGCAAATGATTAGATAAAATAGATTTGACGAAGATAGAGCGCGCACAGC
CAGCCCTCCCCTGCCCCAGCCTATTGAACGCTTGCATTTTCTCCAGACCTCAGCCCAGACATCACATGGG
TGGGCACTCTCCCTGACCTAACACGGCTTATACTCGGGACTCTGTGTAGTCTCGCCCACAGCACTCCTGG
TCTGTGATCAACGTGTTCATCTGTGGACCAGCTCTAAGTCCCATGGAGCAGGACCAAGTCTCGGTGACTC
CAGCCCCACCCCTAGCATTGTGCCCGCCAGGTTCCGCAGCAGATGCACGGGTGCGGCCATGGAGTGGACA
CGCGCTTAAGTAAGCCCTGTGGGACTGGGCCCTGGGGCTGTTTACCCACGTGCTGCCTTATTCAGCAATT
TTAAAGGAGCTGTAGGAAAATACGTGTGAGAAATGCTCATAAGATCATATCAAGGGACACAAGCCCATTA
TAAAACAGCAGGTACAATTTGATCGCAAGCAAAATAATATCAGTAGTATCTGTGCATTACAGAACAGACT
CATATCCTGCTTCTGGGAATGTAAAATGACACCTCCTGTGGGTGCACTGGGAAGGGAAGGATGGTAGGCC
AGGCTTTGGCAGTTTCTTTAAAAACTAAGTCTATTACCATGACCCAGCAATTGTACTCTTGGGCATTTAT
CCCTAGGAAATAAAAACTTCTGATCACACCGAAAAGGGCACACGAGTGTTCATGCATCTTTATTTATAAC
AGCCCCAAACCGGACACAGCCAACCCAGATGTCCTTCACCAGGTGACCGGCTAAACACACCGTGGTGTCT
GGAATACAGCGGTAGGAAGAGGTGAGCTACTGCACACACCCACCTGCCCGATGTCACGGGCATTGCACTA
AGCAAAAAGGCCAGTCCCAAAAGGTCACGTTCTGCCTGATTCTGTATATACCACTGTCTCGAAATGACCA
AGTGTGGCACTGGAGAACAAAGGAGTGGTTGCTAGGGGTTGAGGATGGTTCGGGGGAGGAGACCAGCAAG
GGGGAGCCCGAGAGAGATAGCTGGGTGATGGGACACCCTGGACTGGGCGGTGGCTTCATGAATCTACACG
TGCGATCGAATGGTGGAGAACTGTGCACACATCGTACAATACCCATTTCCTGGTGTCAGTTAGCGCTATG
GTGACATCAGCGGCAGCTGTTGCAGGGAAACTGGGTGAAGGGCCCATGAGAGCCCTGTCTGCTCTCCTTG
CCACTTCCTGTAATCTGATAATTATTTCAAAGGAAAAGTAAAAGAAAAAAATGCTGCAAAGAAAGATTCC
TAAAGGTAACTGGATTTATGTCTTAGTGCTAATATTAAACTGATTTTTTTTTAAAAATCCACTTCATTTC
CAATATTTTCCATGCTTTCTCCAAGCAACATGGATTACATTTGAAACTAAAAAATAATCAAGAGTGAACA
TTAGGCGAAAGCAGGGATAGAATCTACAGGAGCTCTCTGGACTATCGTTGTAACTCTCTGTGTTTCTAAA
ATTATTTCCAAATGAAAAGAAAGTTTTTAGGCTGGGTACGGTGGCTCACACCTGTAATCCCAGCACTTTG
GGAGACTGAGGCAGGAGGATCACTTAAGCTCAGGCATTCAAGACCAGCCTGGGTAACATAGCGAGACTTC
ATCTCAATAAAAATTAAATAAATAAACTTTTTTAAAAAAAGAAAAGTTCTTAAAAACAAATAGCAAATAA
GATCAAATGTTGCATACGTGTAGTGAAAAGACAAAAAGTAACAATAAAGTGAGAACTCTTTGCTTAGGGG
AAACTCATTAATTAGATTAGAGCAATTAAAAGAGGAAAACAAAAATATCATGAGATGTTGTGAATAAGGC
ATTTAAAACATTTTAAAAGTCCGGTCTCTTCATAGAGTGCATAGAGAGGGTGTTGGTGAATTTTCTGTCC
CTAGGGCAATACCTGGGTGACTAGGCATATTGGATTAGTTCGTTCCAGCTGCCATAACAAAGAACCACAC
ACTGGGTGGGTGGCTCAGACAACAAAAATGCATTCTCCCAGAGTGCTGGGGGCTGGAGGCTGAGATCAAG
GTTCCAGCAGGGCTGGTGCCTCCCGAGGCCTCTCTCCTTGGCTTCTAGATGGGGTCTTCTCCATGTGTCC
TCGAGTGGACATCCCTCTGTGTGTGTCGGTGTCCTAATCCAGCAGGGCTGGTGCCTCCCGAGGCCTCTCT
CCTTGGCTTCTAGATGGTGTCTTCTCCATGTGTCCTTGAGTGGTCATCCCTCTGTGTGTGTCGGTGTCCT
AATCCAGCAGGGCTGGTGCCTCCTGAGGGCTCTCTCCTTGGCTTCTAGATGGCGTCTTCTCCGTGTGTCC
TTGAGTGGTCATCCCTCTGTGTGTGCTGGTGTCCTAATCCAGCAGGGCTGGTGCCTCCTGAGGCCTCTCT
CCTTGGCTTCTAGATGGCGTCTTCTCCATGTGTCCTTGAGTGGTCATCCCTCTGTGTGTGGCGGTGTCCT
AATCCAGCAGGGCTGGTGCCTCCCGAGGCCTCTCTCCTTGGCTTCTAGATGGCGTCTTCTCCGTGTGTCC
TTGAGTGGTCATCCCTCTGTGTGTGTCAGTGTCCTAATCCAGCAGGGCTGGTGCCTCCTGAGGGCTCTCT
CCTTGGCTTCTAGATGGCGTCTTCTCCGTGTGTCCTTGAGTGGTCATCCCTCTGTGTGTGTCAGTGTCCT
AATCCAGCAGGGCTGGTGCCTCCTGAGGGCTCTCTCCTTGGCTTCTAGATGGCGTCTTCTCCATGTGTCC
TTGAGTGGTCATCCCTGTGTGTTTGTCAGTGTCCTAATCCACTCTTCTTACAAGGACACCAGTCAGATTC
AATTAGGGGCCATGCCAATGGCCTAATTTTACCTTAATCACCTCTTTAAGGTCCCTACCTCCAAATAAGG
ACATTCTGTGGTGCCGGGGGCTAGGGCTGCAACATATGGACTTGGAGGAGCACAATTCGGCCCACAATGA
TTGTCTTTCGGGTTGATGTTTTAATTATCACCTTATAGAAAACACTGAGAAAAGCAGCGAATAGGCCACA
TTCGAGGACAATGATGCAAAGAAACAAAGATGAGGTAATAATTTGAACTTAATCATTATATTTATTTATA
TCCCAACATTCAACAAACTTCTGGCACCAGATGGACATTCTGTGACTATTTTTGAACGATCTTATGAATG
ACATAAATTTGTCCTCTTTGGCTGTCTTCTCATGTGAATCCTAAATAGGTTTTCCAAGGTATACAATAAT
TCAGACACAGAACAAACACATTTTGGTCTAATTTGAATAATAAGAACATCTATGTTGCCCTTTCAACATG
AGAACTTGGACTTACAGATCTAGACCTTCCACTTTTCCAGGTTCCTCTTGCAAGCACTCCCCACTGGCCG
GGTCTAGTTCCCAAGTTGCATGTGAAGTTAAGCCTAAATAAATACCAACAATACTGAAGGGTATTATTTT
GTGATACTAGCAGTTTGGGAATAAAACATCAAGGCACCAGCAATTCCGCTCCAAGGTGTATACACAAGAG
AACTGAAAACATGTTCACAGAAAAACTTGCACATGAATGTTTACGGCAGCATTATTTGTAAGAGCCAAAC
AGTGGAAACAACTCAAATATCCATCAATTGGTGATTGGATAAACAAAACAAGATACATGCATAAAATGGA
ATATCATTTATCTATAAAAAGGGATGAAATGTTGATACATGCTACTATGTGGATGAATTCTGAAAACATT
TTACTGAGTAAAAAAGCCACACACAAAAAGCCACATGTTAGATATGACATGCCCAGAACAGGTAGCTTCA
TAGAGAGAAAAAGCAAATAAACAGAAAGATTAGGTGGATGAATGGATGAACAGATGGATGGATGGATAAA
TGGGTGGATAGATGGATGGATGGATAAATGGGTGGATAAATGGCTGGATGAATGGATGGATGGATGAATA
AGTAGATACACTGACGGATGGATGAATAGATGGATGGATGGATAAATGGATGGATGAATGGATAAATAAA
CAGGTGAATGGGTGGATAGACAGATGAATGTATGGATGGATGAATAGATGATGGATGGATGGATGATGAA
TGATGGAAGGGTGGATGATGGATGGATAGATGAATAGATGGGTGGATGGATGAATGGGTGATAAATGGAT
GGATGGATGGATGAATGAACGGATGGATTATACTCAGTATAATGTTTTCAGAATTCATCCACATGGTAGC
ATGTATCAGCATTTCATCCCTTTTTATAGACAATGATATTCCATTTTATGCATGTATCTTGTTTTGTTTA
TCCAATCACCAATTGATGGATATTTGAGTTGTTTCCACTGTTTGGCTCTTACGAATAATGCTGCCATAAA
CATTCATGTGCAAGTTTTTCTGTGAACATGTTTTCAGTTCTCTGAAATGGATGCATGGATGGATGGATGG
ATGGATGGATGGATGGATGGATAAGTAGATAAATGGATGGATAGATGAATAGATGATGGATGGATGGATG
ATGAATGATGGAAGGATGAATGACTGATGGATGGATGAACAGATGGATAGGTGGATGGATGAATGGATAC
ATGGATGGATGAATGGATGGATGAATAGATGATGGATGGATAATGAATGATAGAAAGATGGATAATGGAT
GGAGAGATGAATAGATGAATGGATGGATGGATGGATGAATGGATGGATGGATGGATGGATGAATGGATGG
ATGGATGAATAGATGATGGATGGATGATGAATGATAGAAAGATGGATAATGGATGGAGAGATGAATGGAT
GAATGGATGAATGGATGGATGGATGGATGGATGGATAAGTAAGATGGGACATGATAGGTGAGTCCCAATG
ATCATTAGGTGCAGCCATGATGTAAACCTGTCAGGGGAACTGGAAGAACGTACGGCCTCTTTTCTAGATC
TGCCATCCAAAGGCAGTCACAGTTCTGAGGCCTAAGATTCTTTGAGCACTTACCATGTGCCAGGCACCAT
GCCAAACACTGTGGTCAGCTCAACACAGGGATGAGAGTTGCAGACACAGACTCGGAGATGCTGCCACAAC
CACTGGCCGCAAGTGGTGGGGAGCTGTGCAGTTGGACTCTGGAGCCTTGACACCCCCAGACAGATAATCA
GAACTGGCTGACTCCATCAGCCAAGGCTGAGATCCACTGTCCTGCGAGCTCAGTGCAGCTCTGGTGGTAA
GAAACTAGCCTCCTTCTGACAGCTCCTAAACCCAGATGAACAGCTCCCACTCTTCTTGCACCTTGTGAAT
GCTGACCTGGTCTATCCTGCCCCCAGCCCACGTGGCCAACAGGACTGGCGCTTGGCTCTGAGGCTACATC
CTCAACTGGGCCAGGCACGTCTGCCTGTCATGAGTTCTGGTGGTCTTCAGCCCTGCCGAGTGACGATGAC
TAACAACGTGTCGGTTCTGTGCTGGTGCAGTTCCAGATGTCCCTGCATCGTCTGACCCCCACATCCTCCT
GAGAATACACAGTAGAGAACATCTGGCCCTGGACTCAGCCTCAGCCACTGCGTCACGCCTGAGCCAGACT
GCTTTTTGGAGCCTCAGTTTCCTTTTCCGTGGAATGGGTGCTGTCCTGATTGGGCAAAGTCATCTGAGGC
TGACTGATGCACGTGCCCTCGCACCTCCAGGGTCTGCCCACAGCAGGTGCTCAAGGGGCTGGTTCCCACC
GACCCACGGGGCCCAGGACCAGGAGGCTGTGGCCTGCCTCCTATAATGCGCCCCTGTCTCACTCGGCCAC
AAGGCAAGGCTTCACTAATCAGGGCGTTGTGGCCTGAGGCCTGGCCATTCTGTCCCTGTAGCCGGAGACT
GGCCCCCTCCTGGACCCCCTCCTGGACCCTCTCCTCACCCTGCCTGCTGCCCCCACCTCTCTACTCCGCT
CGTTTGCTAAGTCCCTGGATACCTCCTGCAGGCGTCCTTGCCTGTGCCCGCCTCTGCCCACCTGGAAACC
CACACATGACCCATTCTCTGCTCCTGCTGGGTCCACAGGCCTGAAGGGGGAGCTGGGTCCAGACAGGTGG
GGGTAAGCAGAGGGGAACGAGCAGTGCCTGCTGTGGCTGGGGCAAGGGCCAGGTTCAAGTAGGTCAGAGG
TGCCGAGAGTCTGAGGCTGGGAACCCGGCTGCAGGCCAGTGGGGAAGGGCAGAGGCATGACGGGGTAGGC
GGGGGAGCTGGCTGATAGGTATGGGGCCAGGAGAGCCCTCTGGAGGCCTGTGGTTCCAGGGCTGGAGAAC
AGTCAGGTTTGGGGAGTGAGAGGGGGTCCCTCTGGGTGCAAAGTCACCCAGGGAGATTGCTGAACATGGT
GTTGCGGGGAACTGAGGCCGGGGGCTGGGCTGTGATGGGGAGGTGATGGGGAGGCTGAGAGCAGAGGGGG
TGTGGTGGGGAGAGGAGGAGCTTATCAGCCCCCGCTGCAGGGAGCGGCCGGAGCTGCAGAAGTCCCAGGA
TGCACCCCATGCCAAGTGGGGGAGTCCAGGAGTGGGGAGCTGGGTCCTCACCAACAGCAGAGGCTGGCAG
CCAAGGCTGCTGCAAGGCAGCCCTAGGGCCCTGGGGGACACTGGGTGGCTACAAAGTCCTTCTGGGCTGG
CAGAGGCCCCTCCTGATGCCCCACTCTCACTTTGCCAGACGCTGAGGCAAGTGCCTCAGTTTCCACCTGG
AAGCTCCCCTAGCCCAGGGAACCCCAGAATCATCACGCTCTTTTTCATCTCTACACCCTCCAGGATGAAC
ATCGGGAGGAGGGGGCCTATTCCAGCCCCAGGGGCTTGATTTCCACTGAAGTGCAGGCTTCAGGTTCTCA
AACCCCTTCTCCCAGCACCACAGCCCCGGCACCATCCCTGAGTCAAAGCACAAGCCCAGGCGAGGCAGCC
CATCCCCCGGGGGTCCCCACTCACCCTGCCGCCACAGCGCACGCCTATAGATGCAGATGGGGTGAGCGGC
CACCTCCTGTCCTGGGTGTGCAGTGATGTTTACTCTCCCAGACCTGCACTGTGGAGATGTCCCCCGGGAC
AGACCTCGGATGACCCACTGCGGCATCATCATCGTGTTTCCCCAAAACCAGGGCTGGTTTCCATTTTGCT
ACCCACGGCTTGGAGGCCTTGAGGAGCTCTTTTCTCCTGTGGTTTTTCAATGGAGGAATCGCTTGTGCAC
AATAAGCTGCACTCATTTAAACCATCCAGATCGGTGAGTTTGACAGATGTCTACACCATGAGACCACTGC
CACAGGCAGGATTCGGGGCCTTTCCCCCACCCTCAAAATCTCCTCCTACCTGCCACAGGCAACCGCTGAC
CTGCTTTCTGTTGGTGGGGTTATGCAGTGGTGTGACCTTTTTGCAAGCAATGAAGCAACCCCTGCCACAG
CCTTCTATGACCACCTCCCCTCCCCTCCCCTCCCCCTACCTCCACCTCCCCTCTGCCCCCACCTCCCCTC
CCCTCCCCCTACCTCCACCTCCCCTCTACCTCCACCTCCCCTCCGCTCCCCTCCACCTCCCCTCCCGTCC
CCTCTACCTCCACCTCCCCTCTACCTCCACCTCCCCTCTACCTCCACCTCCCCTCCCCTCCACCTTCCCT
CCCCTCCACCTCCCCTCCCCTCCACCTCCACCTCCCCTCTACCTCCACCTCCCCTCCCCTCCCCCTACCT
CTACCTCCCCTCTACCTCCACCTCCACCTCCACCTCCCCTCCCCTCCACCTCCACCTCCCCTCNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGAGCTCTTTTCTCCTGTGGTTTTTCAATGGAGGAATCGCTTGTGCAC
AATAAGCTGCACTCATTTAAACCATCCAGATCGGTGAGTTTGACAGATGTCTACACCATGAGACCACTGC
CACAGGCAGGATTCGGGGCCTTTCCCCCACCCTCAAAATCTCCTCCTACCTGCCACAGGCAACCGCTGAC
CTGCTTTCTGTTGGTGGGGTTATGCAGTGGTGTGACCTTTTTGCAAGCAATGAAGCAACCCCTGCCACAG
CCTTCTATGACCACCTCCCCTCCCCTCCCCTCTACCTCCCTTCCACCTCCCCTCCCCTCCACCTGCCCTC
GACACTTCCTCCCCTCCCCTCCAGCCTCACTGGCCTGCCCCTTCTGGAGCGCCCAAGCCTGCTGCTGCCC
CGGGGCCTTGGCACGTGCCGTTCCTGCTGCCTGGACAGCTCTTTCTCCAGGCACTGCCTCCTTACTTTCC
TGGGGTCTGTGCAATGGCGTGCCATCAGGGAGGCCCCCCTACCCCTCCTGTGTTAGATGGTGCCCGCCCC
TTCCCTGAGCTCTGCCTCCCCTCCGGCCCTCGGGCGGTCCAGTGCAGCACACACTGCAGCCGCTGTCAGG
AAGTACTGGGAGGGCAGAGCCTGGGTCTCTGGGGTTTTGCTGTGGTCTCAGTGTATCCCGCTAAATTCAG
ATATTGAAGTCTCTCCCCCAGTGTGCTGGCGTGAGGAGGTGGGGCTCTGGGGAGGTGGAGCCCTTGCGAA
TGGGATTAGCGCCCTTATGAAAGGGACCCCAGAGAGTTCCTTTGCTCCTTCTGCCGCACGTGGATACAGC
CAGAAGGTGCCATCGATGAACCAGAAAGCAGACAGACACTGAATCTGGGGGCGCCTTGACCGCGGGTGTC
CAGCTCCACAACAGTGAACCAGAACAGTGAGAAACAGGTTTCTGTTGCTTATGAGCCCCCAGCCTATGAG
CACGTGTGATGGCCGCCAGAACGGACCCAGCGGGTTCACTGCACGGACACAGAGCGTCTTCGCTGCCTGC
CTCTGCCACACCAGCTGCGAGGGCCCGCAGATGGCCAGTTCCCCTCTCTCCCTGTGTGCCTGCCATGCGG
GTTAAACAAAACTCCCACAGACAGAGCCAAACGGAGAGAGAGCACCAAGGTGGAGGGGACGGTAGGGGGA
CTGTTCCTTTTCAGTCACGTGGCTGAAATGGTGTCTCAGCCAGGCCTGGAGCCCGGACCTCCTGAGCCCA
CACCAAAGTTGCCTCCCGCCTCCTGAGCCCACGCCAAAGTTGCCTCCCACAAACACGCTGCTTTCCTGGG
TGGGGGAGCTCGCCATTCCCCGACACGAGCAGGGCCAGGCTCTGGGGCCGGCTGCTAAGGCTCAAATCCC
AACTTGGTGTGACGTGGGTGACATGCTCAATCTGCTGTGCCTCGGCTTCCCCTTCTGTAACATGGGGATC
ATCACAGTTCCTTCCTCCTGGGGTCTGTGGGGACTCAGTGCCTCGGCTTCCCCTTCTGTAACATGGGGAT
CATCGCAGTTCCTTCCTCCTGGGGTCTGTGGGGACTCAGTGGTAGCCGTGGGAGAGGTTAGGGAGCCTGC
CTTGACTCATGGCCAGCGTTTGATGAGCTAAAATGGGCGGGGCCATGAGACGGGCAGGTGGCAGGGAGCT
TCAGTCACCTGAGAGCACCAAAGGGGAGGCCGGAGCCTGGCACACCCGTCCTGCTGGCCCCGTCTTTGTG
CCTGGCCTGAAGTGGGTCACTTCCCACCCCACCCCCTCTCCGTATCAGGCTGTTCACCCCCACCTTCCTG
CCCTGTACCCCCAGAGGAGTGTGCGGATGGATGGGTACGTGGGCAGATATCCAGATGGATAGACAGACAG
CATCAAACACCGCACTTAAGCAAAGAACAAGTCTTAATGTAGCGGGGGCTGGAGGGGAGCGAGCGCACTG
TGAGAACCAATGTTCATCGCCCAGCACCGCCCAGCACCGCCCAGCAGCCTCCTCACCAATTCACTCAATT
AACCTCTGTCCTCCGCGAGCAGAACACATTCTGCTCAGTGTCGCCCAGGATTCCATTTGACAGAAGCCAA
ACCACTTCATGAGGAGCTTAAATAAAGAGCTCTCCTCCTACCCTTGGAACACACTTGAGCGTAAGCCTAT
TTTTGCATATGTTACATAACACTCTCTCCTCATTCATGGACAGGGAACGCTTCCCTATGAATGGTGTTCA
CACTGAGGCAGAAGACTCTCCCTCCCTTGCGGAGAGAAGAGGCGGAGCTCCCGTTGCAAAGTCTGCAGCC
ACAGGTGGGGAGGCCTTGGGGGTGCTCCTGGGAATACGGGCAGACAGGTGGATGCCCCACGTCGGCTCCC
ACTGGGTGAAGCCTCGTCCTGCTGCTGACTGGACCTGCTAGGGACGGGGGCAGACTCTTCAGGTCCCCAC
AGAGCAGACTGGCTGTGACAGTGGGCTGGATGGTGGCCCCTCGGGGAGCTGAACACACCACCAGGGCCAC
ACGAGAGGATCCGGTGGGGAGGGACAGGAAACACCCCGGCCAGCTCACCTGGGCGGGATCACAGAGGCTT
GAGTTCTAAGCTAAGGACTTCGGGCTACTTGGTGGGCCCTGAGAAGACAAAGGCAAGACCCAGGGCCTGC
CGGGGAGTGGCCGGAGCTTGCACAAGAGCCAGGCTCGCCTTCACCCGGGACCGAAGGCACACACCGTCTC
TGGGTGCCACTGACTGGACAAAGACAAGAGGCCCCTGACGGCTTTCTACTTGGCCCATTAGCCTCATGAA
CCACAAAGTCACATTTGTAATCAATCCTATAATTCTGTTTTGAGTAGCACAATTAGGCCGCTTTGAATTT
TTATGAGCTAAACGTTGATTCGTTAACTATAAACATTGCATTCCACCATTTCCGAAACACTGTTTTGGAC
TTATTTTTTTTAGGGGACTAAAAAAAAATGGGATGGGTCACCTCCAAGAAGCCCAGCCAGACCTCATCCT
ACAGGGCTTGTTTTCGTCACAAAGGACCGCGGGGCCCTGGGAGGGTGGGGAGGACACAGCCGAGGCGGCT
GATTTTTCATGGCAGGAGCAGGAGAGTGCCCCACAACCTCGGCTCCAGCGATCCTCCCACTGCAGAGAAT
GGGACGGGGCAGGAACTGTCAGTTCCACAGTGAAATATCCCCGGAGCCAGGCAGAGAAATCCATGCTCTG
CCCATGCACCGGGTGTGTGATTGTGTGCGGAGGGCCCAGCTGTGTCACGAGGACCCCCAGCGATGCCCGC
ACCACTGGGCTTCCCCAGACAGGCCTCCCCCACGAGCCATCTGGTGGTTCCCTTGCTGGCCGAGTTGTCT
CCTTTGAGGCTGTCTCTACCTGGCATGAATTCTGCCCTGAGCTTACTCTTCCCAAAGCTTCACTGCTTCC
TTCTTGACAAATGTCATGCCTGTGATTTGGAGGGGACTTTCAGGAACCTGCCCTCATCAAGGCAGGATGA
CAGGCCAGGCACAAACCCAGTAGACATATTCCTCTCCAAACAGCCCCACGGTCTCCCGCCAGCTCTTGGG
AATACATGGACTGTGAATGAAAGTTGACCAAGGAGGTCAGAAATTAAGTCAACTCAGAGAAATCACCTCC
GCAAATTCGGCCACACCAGTGCAGAGCCCCTAACCTACCAAAGAGTATTTCCTGGCATGGGCACCCATCA
GGATTTGTGTGGAGACGCCTCCTCACCTGCCATCTCTGTGGTGGAGACACCTCCTCATTTGCCGTCTCTG
TGCTGGGGACACACCCTCACCTGGTGTCTGTAGTGGGGACACCTCCTCACCTGCTGTCTCTGTGCTGGGG
ACACCCCTCACCTGCTGTCACTGTGCTGGGGACACCTCCTCACCTGCTGTCTCTGTGCTGGGGACACCCC
TCACCTGCTGTCTCTGTGGTGGGGACACCTCCTCACCTGCTGTCTCTGTGCTGGGGACACCCCTCACCTG
CTGTCTCTATGGTGGGGACACCCCCTCACCTGCTGTCTCTGTGGTGGGGACACCCACTCACCTGCTGTCT
CTGTGGTGGGGACACCCCCTCATCTGATGTCTCTGTGGTGGGGACACCCCCTCACCTGCTGTCTCTGTGC
TGGGGACACCCCTCACCTGGTGTCTGTGTGCTGGGGACACCCCCTCACCTGCTGTCTCTCTGGTGGGGAC
ACACCCTCACCTGGTGTCTCTGTGGTGGGGACACCCCCTCACCTGCTGTCTCTCTGGTGGGGACACCCCC
TCACCTGGTGTCTGTGGTGGGGACACCCCCTCACCTGGTGTCTGTGGTGGGGACACCCCCTCACCTGATG
TCTGTGGTGGGGACACCCCCTCACCTGGTGTCTGTGGTGGGGACACCCCCTCACCTGATGTCTGTGGTGG
GGACACACCCTCACCTGCTGTCTCTCTAGTGGGGACACCCCCTCACCTGGTGTCTGTGGTGGGGACACCT
CCTCCCTTGGGCATGTGTACGTGGTCAGGGCACCTCCTCCCCGGCTTGTCTGTGTGTGGGTCCCCGAGGG
AAGGGAAGCCACTTGCTTGCTAGTCAGGAGATCATGTGCATGCTTCCCCTTCACACTCTGGGCCTCTATG
AACTGCTTCCATTTGCAGCAAAAACACCGAGCTCCCAGCTGCTCTGGCAAGCGCTCCAGGCTCCCATAGG
CGCCCCCACAAAGTCAGGTTTGTTTCCTTTGGCACATGAGGCATGGAGAATTGTAGGAAAGGAGCCTCCA
CCAAGCAGAGCAGATGGAGGGAGGAGGGCAGCTTCCTGCTTCCCAGGCGATGGGACCCCACAATCGTCTG
ACCCACTGCCATAGCTTCCTGGACATTACTGAAGGGCTCAGCTCAGGGTGGAGGGATGAGCACCTCTGCT
GTGCCTACCTCGAGTGTGGAACTGGCAGGACTGTGTGGAAGGGCTGCCTTTCTTGCCTTGCCCATCTCCT
GGTGCCTGGATGTCCCGGGCACATCCCGATGTCCAGAGCTTCCCCCACCCACTTTGCTCCCAGAGCTCCA
GCATCACCCCTCCCTTTGCTGGTGCCTGAAACCATCACTGCTGCAGGGCCTGGGTGAGGAATCAGGCTGC
TCACAGAGCGCCTGGCCTGGCTGCTTCCTACTTTTCCTGCACATGTGCCTGACAGCCCAGGCAGGGAGTG
GGGAGGTGGGGGGAGAGGGGACCCCCTTGGAAGCGTACCTCACCTTCTCATCATGCCGCTTCCCCACCTA
GGAGGGAGAGTCTCAGAAAGACCCTTGCTTTGTAAGGAAGAAGCTGGCCAGTGTCCCGTTGCCCCCACAA
GGCCGCCCATCTAACCCTCTTCTCACACAGGATGGAGGGAGGGCAGTCCCAAAGGCTCACTGGGCCCTGG
GCCCTGCAGTGGATGGATCTGTGGGACTGGAGCCCTGAGGAACCAGGAGCTGAGAGTGTCCCAGCATCAG
CAGCCCAGGCTCTTCAGGAAACTCCGCAAGCAGCGGCTCACCCCAGCCAGCTGCTAAACTCCAGCCACAT
GCAGAGACTCTGAGTGGACTTTTACCCCCAGCCCTGCCTGGGCAGTCCCCCAGACCAGAGTCCAACTTAC
ACAGGCCACACTGGCCGGGCCACGGTTCGCTGTGCTCTCTGGCACAGACCACGGCCCTTGGGGTCTGTGG
TGCATTGAGCTGTCACGGGCTTGCAATTCCCCAAACTGGAGAAAACCCTGGAAAGACCAGAGGCACAAAA
AGGAAACCCACTCCCCTAGTCTTTCATTTCCTTCTCCTTGCATTTCCAACCTGGGGAGGGGAGGGGAGCC
CGGGAGGGTGTGCAAAGGGGAAGGACGGGGCGAGACCCGGCTTTCCAGCATCTACTACGAAATGCCACAT
GCAGAGCAGGTCAGCAGGTCCCAACCCCTTCCACCCTGTTTTCCAGCATCTACCACAAAACGCCGCATGC
AGGGCAGGTCAGCAGGTCCAATCCCCTTTGACCTGGCTTTCCAGTATCTACCACAAAACACCGTGCACAG
AGCAAAGTCCGATTCCCTTCCACCTGGCTTTCCAGCATCTACCACAAAACGCCGCATGCAGGGCAGGTCA
GCAGGTCCCATCCCCTTCCACCCGGCTTTCCAGTATCTGCCACAAAACACCACATGCAGGGCAGGTGAGC
AGGTCCCATTCCCTTCCACCCGGCTTTCCAGCATCTATCGCAAAACGCCGCATGCAGGGCAGGTCAGCAG
GTCCCATTCCACCAGGGCTTTCTTCTCATCTAAGGAGAGAGGAGGCGTCTGCTGGCGTTGGGTTTTCCCC
TGGGCAAAAGACAGCTGTAAACAAAACAGCGCTAGGCAAGCATGCCGAGGTGAGAGGGGCCAGAAACCAG
GGAGGAAGCTCTCCAGATAACAGAGCTGAGCCTGACTGTGGCATCTCCAGGGTCTGTTCCTGCCACACAG
GCACTCCAGGCCCACATGGGAGAATGACAGCTCCTCCAGAGCCGGCCCTCAGGAAGTTCTCCAATACCCT
GAGCTACTGTGAACCCTCGGAGCACCGTTGGTGAAGGGTGCTTTTCGAGGCTGTCAGGGTGAGCGTGAGC
CCCCAGGCCCTGGTGGCATTTGTCATGGGTGGCATTGGTCTCTGTCCCTACAGCCTGCCTCCTGGGGCCA
CCACCACCTTCCTGGCTGCCCCCTCCAGCCTGGCTACTTAGGGGCTACTGGTACCCAGGAGATCAGGGAA
GCCTGGGTTGCCAGCGGCCGGGGTGGGGGCTGTGGCACCTGCCGGCCGCTATGATCTGAATGTTGGTGCC
CCCAGAAACTCATCTGTTGAAATCCTCACCGCATCATGATGGCATTGGGAGGCCATGGGGCCTTGAGGAG
GTGGGGAGATCCTCAGGGTGGAGCCGTGTTCGTGGGATTCACGCCCTGATAAAGGCCACACAGAGCTCCC
TCAGTCCTTCCACACGCAGGGACACAGACGAAGGATGTTGTCTGTAACCCAGCCGCAGGCGCTCACGGGA
ATCCGACCCTGCCGGTGCCCTGAGCTCAGCCTTGCAGCCTGCAAGGCTGTGAAAAATAAATGTCCATGCT
TAGAAGCCACCAGTCTATGGTACATCATTACAGCAGCGGGAACGGACTGAGACATGCGGTGATCTCGCTT
CTGGGGACAGGGGTTTCTGTCCCCAGCTCTCAGCTCCATCATCGACCCTGACAGAGTCCACAGTGAACAT
CCAGGGAGCAGGGCCAGCTCCCGGGCCCCTGTTCCTGGGGTATGGCTGCTTGTGTCTCACAGCAACGTCC
CCCACACCCTGCACCTTATAGAAAAGGGGGCGGGACTCATGAAGACTCCTGGGTCTTGGCTCCTGGCCTC
ACCTGCTCAGAACCCAGCTCAGTTCCCCCATGGCCTCCATCCCTACCCAGTCCCGAGTCATCATTGCCCA
CTTGGCACCCCCCAGCCCTCCCTGGCTCCCCGCAGGGTCCATCCCTTCCTGCCAGGTCCTTGCTGGGATT
CTCTGTGCACGTGGGACTCCCCCATTTCCGGGGGGATCAACCCCAGTGCTGATGAAGGCAAACTCAACAG
CAGTCACACCTGGGAGTCCCACTGTCGGGGTCTGGGACCAAGAGGGAGCAGCAGGGCCAGGAGGCTTGCT
GGGCCCTCTGGGATAATATGACAGATCACGCCCACACACGAGGATGGCCAGTGGGGACGTTTGAGGTTCT
CCCAGGCTTGATCACTCCCAGGCCAGGGCAAACCCCACACCCCACCTTCCGCCCTGGGAGAAGTGGTGTC
CCTGGCTACAGCCTCAGTGAGCACCCCCTGGTCTCTCTCCTGGCCCTGCCTCCCTCCAGGCTCACTGCAA
CCTCCACCTCCCAGGTTCAAGTGATTCTCCTGCCTCAGGCTCCTGAGTAGCTGGGACTACAGGTGTGCAT
CACCACGCCCAGCTACTTTTTGTATTTTTAATAAAGACAGGGTTTCATCATGTTGGCCAGGCTGGTCTCG
AACTCCTAACCTCAGGTGACCTGCCCGTGTTGGCCTCCCTAAGTGCTGGGATTCCAGGCATGAACCACGG
CACCCGGCCAAGAATTTGTTTCTTTATAAAAAATCATGGCTAGAAGGTTTGGCTTTTTTTCTTACTGTAA
AAGCAATGAATGTTCATATAATATTGGACTTGTAATAAAATGTATCCCAAGTCTGCAGGGAATCCCCATG
TGGGTGTCAATGGGCACCTCGACTTAGTGGCCGGCTCTTAATTCATGGGTCCACCCCCTGCACCTCTTCC
CCCTTGGTTGTCTCAACTTCAGTCAGGAGGACTGGAGCCCACCCGGCCACTCAGGCCACAAGCCCGGGAT
CTCCACGGAGTTGGGGGTCCCCTCCCACCCGCATCCAACCCATCAGCTAGCTCTGTTGACTGTGCCTTCA
AAACACATCCCACATTGGGCCTTTCCTCACCACTCGAGGCGTGTCCCTGTGCAAGGCCCTCGATTTCTCC
ATCAGCATTTGCAGCCAGCTGGGGGCCCGACCTGGGCAGATCCAGCCAGAAACTGGGAAGTGGCCACAAT
GGCGGCGGCCACCTTGGTGGACGTGGGGAGAATTGGAATGGCAGGAGATGAGTGAGATGCGGAGACAGAT
GTGCCTCTGCGCTTGTGCCAGGCTCCAAATTTGGAAGCATCGCTGATGGCCAAATTCCAACGAACCTGGA
GTCCTGCTGTTGACTTTCTGATCCAACCGGTGAGTGCAGGGTGGCCCGGCCCTCCCTGTGAAACCAGACT
TGTCTGGGGTGGTGTCTGACTTTTCTCAGTGAGCTCCGAGGCCCACCATTCTCATATCATCTGGAGGGTT
TGTCAAAATGCAGATTCGTGGCTCCACTTCTGACCTATAGATCAAAGCTGTGGGGATGGGGCCCGGGAGC
CTGTATTTCAAACAGCTCCTAGGTGGTCCTGGTGGAGGTTAAGAACTTCTGGCCTGGGGATTGGGAGTGT
GGACTCTGCAGCGGCTCATCTCAGGCTGGAGTCCCGGCTGGAGTTTGTAAGCTACACAACTGGCCGCCCT
CCACATCCTCCTCCGCAGGACAGGCTCCTGCCGTGAGTGAGACGATGTCCAGCTCAGCTCGGCGCCTGGC
ACACTGGGGACTGCCCTCAGCTCTGCCACTCTTGTTATTGTGGTTATTGCTGTGGCCATTGTGACGCTCT
GCCTTCCTTGTTGTTGAGCCTGCTGCTGGTTGCACGTGACTTTGGACACCTATTTCCAGATGCCCGGCCC
TGCACGCATTCATGGGGTTGCCGTGGAAACTGTGCTGTGAGGATGGCAGAAGCCGCAGGGTGAACAGAGT
CTGAGTTTCCCAGGCACCGCGGCGGGCATCAGCTGATTATCTGCAGTGGGCATCTCTGTTACTCTGCGAT
GGTCTCGGGTCTCTGTTAAGCATATTCACTGACACGGCACCACTACTCCCCCTTGTCCAAGGCCATCCCC
AATGCCACCCTAAGGCAGCTTTTACTTTGGAAATCTTTATTATGACTTTATTTCCTATTTAATTTATTAG
ACTCCTTTGATGAGAAATAACACCTAAGTTTCCCCTACTCTCCTTTAAAACAAATTCCCCTCCATGGTTT
CTGTGTCTCCTCCTCCTTCGCTGTCTGAGTTTCTTGGCTTCTCTGTTTGAATCAGTGCCCAGCTCTGTGG
AGGGTCTGCGGCTGCTGCCTCTGCCAGTGCTGGTCCCACCCCGTCGCAGAAAACACATTTATGAGAAGGC
GTGGGGCGGACAGAAGATGCCCCGTCCTGGACTCCACGCCCGGCCTGGGGGCAGTGGGGCCCTGAGGTGT
CCTGGCTCTTGTTGAGAAAAGTATTAGTATTGGGCTGGAACCCCGAGAACGAACCAGAAATTTCAAGGGG
CGTTGCCCTTATCTAATTTTGTGTCCTTTCTGTTTTTTAAACGTTAGAGACCTTTGGTCCGCCATGTTTG
CGTTCACCTTTTAGCATTTTTGGCCCCAGGCTTAGTTTCATCAAATCCACTTTCTGCACAGCAAGTGCCC
GTTGTGAGCTCATCCTCCACTGGCACTTCCATTTCATGGGCATCTCTGCGTATCAGAAGTAGCTTCCTGC
GGTCTGGTGCATTGTAGCCGTTCCAAGAGCAAGAAGAGCAGAAAGAAGAAAAAGCACTCAGCCCCTCCAG
GCCAAATCGCATCGCAGTTTTGGAAGACTCCTGTTACCTTGGTGTTTTCTCTCCTGGTTTCATTGGCCTT
CTGACTGCTGGGAGCAAAGGTTAAATATTTCAAGGGAGCAATCGTAATCCTTCTGTTCAGCCCCAGCCCT
TGCCAGAGACTTGGGAGTTGCCTGGTTTAGGCACCAGCAGCTCAGCAAACACCCACCGCCTCTGGCCACC
AATTTGCAAGGTCGGTTTGTGCAGACAGGAGGCCTCCCCTCCCTCTGCGGGAAGCAGGTGCTGGCCTCTC
CTCAGCCTCCAGCCATGCGGAGCCTCTCACCTGGGGCCCGTCGCTTCCACTCAAGGAGGCAGATGGAGGA
AGGAAGCCCAGGAGGCTCCTGAGGATGCCTCCACCAGGGGGCACAGTCTCTGGAGGGGCGGAGTCTTGCA
CGGTGGGTCTGCACTGGAGGGCAGCCAGCAGGGTGCAGCTCTGCCAGGCACATGCCCCCTTGCAGCACTC
TTTGGGCCAAAGGGACTTGGAAGGTGACCAGAGGGTTTAAAAGTCCACGTGCCCTTCTTTGCAAGCATGG
GCAGTTCCCTTCGTGGTTTCCTCTGGGGAGCCGGTAACAATGTGTGGACAGTAAGGGCATTGCCAACTTT
AATGAGTCTGGACCCTCAAGGCCCCTGTGAAAGGCAGCTTCGGGGACAATGATGGAAGAGGGGACAGGCT
CCCAAAGACCCCAGAGGCCCAGGAGGCATCATGGTCAATGCAGCTGACCTGGAGCTGCCAGCAGACCCCT
GGAACCAATCCTCGGGAAGTGTGGACAAAGGGCTAAAAGCTCCGATGGATGGAGCGCCCAAGCCAGAAAT
AAATGAATGAATGAATGAATGAAATCCCAGGCTGCTCCAACAGCCACCCAGGGACTCGCTGTCCTGACCA
CAGCCCCCCACCAGAGGCGTGCCCGGGGGAGCCCAGGGATGCACTTCACCAGCAGAGAGCACTGTGGCCC
ATCCATGGCCAATGCCATGGCGGGTGTGTGCCCCCCTCACCCGGAGAGATGGGGCAGCCCGTGGCCACAT
CGGGCTTCTGAGGTCAGGAACAGTTACTCCAAGGGGCTGACGGTGATGCCTGGGCAGGATGGATGTGGGT
GGGGGTCAGTTGGCTCCTTGGCTTACCAGTGGGGGACCTGCCTGGTCGCCCCAAGCAGCAGCGGAGCCTC
ATGTCAGGCTGCCTGGAGCTGCCCCCGTCTTCCCTCTCCCCAACCCGGAGGGAAGCTCTGGCAACTCAGC
TGGAAATGGGAGGGCAGGATTTCTTATGCTGGGTGATGTCAAAAAGGCCCCCTGCCCCCACCTTCAAGAT
GTAGAGAGAAAGGAGGGCAGAAGCCTGGGGTGCTCCCTCCCTCCAGCAGCTCCCTGGTGATGTGTGTTGC
TCTAGCCTGGAGAGTGCGTGTGTGTGTGTGCGTGCCCGTCACCCTCTGTCTCTCTTCTTCACTATTGGCA
AGCATCCATTTGGTGCCTTCTGCACATCAGGACTGCCAGTGGGGCGGCCCCAGGGAGGAAGGGAGCTGCT
CTCAGCTGGTTCAGGAGCCTCTGTTACTTTTGCTCATCAATGTCCTGTTCATATTTTGAAGCAGCAGATA
GGAAGGAGCAGGAATGAATGTGAGAAGCTGTCCTGCCATGAGCTGGTGGAAGAAGGCCCCTCTTTGTTGG
GACAGGAGCTGTGTGCCGCACCTTGCACCCTGCTTCCCTCCCCCACCAGCCAGGGTGAGAATGCAGGCCG
GTCCCTGTGGTATCAGCGCTATTGGGCTAAAGGACACGCATGGGTGCTGGCTGTTAAGGGGGCCGTCACA
GCCCATGCTATGTGGCTCTGGCTTCCTCAGGACCACTAAGGGAGAAGGGGCCCCTGTAGCAAAGAAACAT
GGTGTTCCAACTGACCCTGGAAGCCTGTTGGCTGGGGAGGGGACAATCTCAGTCAGACTGTTCTCCCAGA
TGCTCATCCCAGTGCTTCCTCTGAGGTCCCTCAGGGAGCAGGGCCCTGTTCAGTCCCCCAACAAGCCCTT
AGAGCCCAGAGCCAGGCCATGAGCAAAGCCCATGGTGCCAGGCAGCTGGCGTGTGGTCCTTGGGACAGCT
CCAGGAACCTCAAGTCCTCTGCAGGTACAGCTGCTAATGACAGATAATGACAGACCACAGCCTGGAAGTG
GGGCCCACGGCATCTGACTGGCAGCAGCTGAAAAGAACTTAATGACGGTCTCTGAAAAGGCCCAGCGGAA
CCCCCACCTGGCACGTGGCAGGAACTCGTGCTTTCCTTTTACTTAGGAGTTGAAGGATCAATTTAGAAAA
TTGAAGCCAACTACGTCTCACCATCAAATCCCTAAAAGCTGCCCTCCCTCTGAGAAGCTTCCACGCGGCC
CCCAGGACCCAGTGCTGCCACCCCCAGCCCACAGCCTCCTGACGTGGAAACTTGGCTGTGGCCAATGGAA
TTGTCTGCAGGTATCAGGCCGGCCTTTTCAGCAGAGGCGCCTCCCATGTGGAGGGGAACAAAGCCCGTGG
AAGCTCAGGGAAGGGAAGAAGTACTGTTTCCTTCTCGTTTGCAGGACTGCAGGGCTTCTTGGAGGTGGGT
GGCTGTGACTTTGGGAGCCCAGGGTGACCTTGAATGTCCCCAAGCTGCCGAAGATTTCTGAAATTGAGAA
GCTTGGAGAGCAGGCCCCGTTTCAACGAGCAGAGCCTACAAGGGGTGCCCTGAAACAGTACTGAGGGACA
CTGAGAAGCAAGGCCTGATGTCCCAGGGCCAGCAGGAGGCCAGGGGTACAGCTGGGGATCCCAGGTGGCC
CTGTTCAGAGAGCACCAGCCCATGTGCCCACCCCTGCAGGGAACTTCAGGGGGTTTCTGAAGGACCTGAG
GCCAAGAGGAGGAGCTGAGCAGGGAGAGAACTGGAAAGAAGAAAGACAGCCCTGCCTTGCCATTCACTGC
TACTGGCCTGCGTGCTCACCAGAACTTGAACAAACCATTAAAAAACCTGAGAACTGGGTACAGTGGCTCA
GGCCTGTAATCCCAGCACTTTGGGAGGCCAAGGTGGGCAGATCACCTGAGGTCAGGAGTTCGAGACCAGC
CTGGGCAACATGGGGAAACCCCATCTTTACTAATAGTACAAAAAGTTAGCCAGGCATAGTGGTGGGTGCC
TGTAATCTCAGCTACTTGGAAGGCTGAGGCAGGAGAATCGCTTGAACCTGGGAGGAGGTTGCAGTGAGCT
GAGATCACGCCATTGCACAACAAGAGTGAAACTCTGTCTCAAAAAAAAAACAAAACAAAACAAAAAAACA
CACACAAGAAATGGGATCTGGGCTGGGCTTGTGAGCACGAGAATAAGAAGGAGTATTTTTTTCATTGTGA
TCACAGTTTGCAAAGACTTTTCTTGCACAATTGGGGTGGAAAGTAGGAGAAAGGTCATGGACTGAGGTTC
TAGGTTTGGATCCTGCTCCTCAGCCTTTCTTTCCTCATTGTAAAGTGGGTTTCAGTGGCTGCCTGGTAGG
GCTGTTGAGAGAGCACCCAGAGCCCTGGCACCTCGCATATAACAGGCACCCAGCAACTGGATCTTAGGGG
CTGTTTTGGGAAGGCGGCTGTAGTGGGTTGAATGGTGGCCCCCCAGGAAGGTAAATCCACATCCTAACCC
CCAGAACTTGTGCATGTGACTTATTTGGAAAGGGCTTTTACAGATGTTTTTAAATTAAAGATCTGGAAAT
GAGGTCACCACGGATTATCTGGGTGGACCCTAAATCCAAGAGCAAGTGTTCTTATAAGAGAAAAGCAGAC
CAGGTGTGGTGACTCATGCCTGTAATCCCAGCACTTTGGGAGGCCGAGGCAGGCGGATCACCTGAGGTCA
GGAGTTCAAGACCAGCCTGGCCAACATGGTGAAACCCTGTCTCTACTAAAAATGCAAAAATTAGCTGGGC
TTGGTGGTGGGCACCTGTAGTCCCAGGTACTCGGGAGGCTGAGGCAGAAGAATCGCTTGAACCCAGGAGG
CAGAGGTTGCAGTGAGCGAGATCGCGCCATTGCACTCCAGCCTGGGTGACAGAGTGAGACTGTCCCCCAC
AAAAAAGAAAAAAGCAGAAGGGGACCTGAGACAAACAGAAGAGAAGACACAGAGGCGCAGTCAGAGGAGA
AAGCCACTGCAGACGGAGTGAGCGGAGGCTGGAGTGACGTGGCCCCAAGTCAAGGAATGACTAGCCTCCT
GAAGCTGGAGGAGACAACGAAGGACCCTCTTCTGGAATTTTCAGAGGGGCAGGGCCCCTCACACCTTGAC
TTTGTGCTTCTGGCCTTGAGAACATGAGAGCAAATTTCAGTTGCCCTCAGTTTCCAAGTCCCTGGTAATT
AGTGTAGCAGTCCCAGGGCACTCACAGAGGCCACAGCCGAAACTCCCAGGGATGACCCTGTACCCATCCT
CCACTTTAGCCCCTCAAATGTCCAACTAAAAGCCCTACATCCCCAGCCTCATTTGCATCTAGGAGTGCAC
GTGACCGTGCAGAGAGGAGCACTGAGTTTGGGTTGAGGGGGCCGTGGAGAAATCTGCTTCAAAAGAAACA
GACTCTGCTGGGACATGCCTTTCCCTTTGCCCTTTGCTGCCTGGACAAAGGACTAAAGGCTGGGACAGAG
CAGCCATCTTGCAACCATGAAGCAGCCAAGCACCTCCACTAAAACCCCACTAGGAGTGGCTGGAAAAATA
GACAGGTCCTGGGTCCCTGGTGGCATGTGGAGCCTTGTATTCACGTTTTCTCTTTTCTTTTCTTTTTTTC
TTTTGATGGAGTCTCACTCTGTCACCCAGAACAGAGTGCAGTGGCGTGATCTCAGCTTACTGCAACCTCC
GCCTCCCAGGTTCAAGCAAATCTCCTTCCTCAGCCTCCCAAATAACTGAGATTACAGGTGCCCGCCACCA
CACGCGGCTAATTTTTGTATCTTTAGTAGAGACAGGGTTTCACCATGTTGGCCAGGCTGGTCTCAAACTC
CTGACCTTTAGTGATCTGCCTGCTTCAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCATGCCC
TGCCTGTTTTTTTATTTTCTATATCTTATGATGTCTGACTTATTTATTTATTTTTTTTTAGATGGAATCT
CACTCAGTTGCCAGCCTGGAGTGCAGTGGCGCGATCTTGGCTTACTGCAATCTCGGCCTCCTGGGTTCAA
GCGATTCTCCTGCCTCAGCCTCCCATGTAGCTGGGATGTTTGACATCTTAAAAGTCTTGCTGGCCAGGGA
GAGACTGGCCTTCCCAGGGCTACCCAACTCTGAGAGATACTGAAGGGCAGTCCTGGGCTTCTTATTTACA
AACCAACCAATCCTGAGTCTATGCACACGACTACCTCTGTTTAACTCTCATACACCAGGCCAATAATGCC
CCTGCTCTAAATCATCCCAGGGCCAGGTGCCAGGCAACTAGAGACCTCCCCTAGAGCCCAAAGCATGCCG
GAATTACTCGAATTAGCAGATCCTGAGCTGTTCCCCGCTCTACATTTCCCGAGGAAACCCCAATACATAC
TCTGGCCTGTGCCCTCTCCTTGCCCATTTCTGCCTTCTGTCCAAAACTGCTGCTCCCCATACAGCCCTGC
GTGGCATGGCATGCCCCCCATCTCAGGACCTGTGAGTAACAAATTCTTCTTTCAATGGGATTGGCTTCTC
TGCGTTCTCATTCAGTTACCTCCATAAATTACAATCCCAAGGACACAAATGAGACAAGCCTCGACCTCCA
GACTCGTTGGGTGAGAAAAATACTAGATTGAGCCATTGAGGCCAATGCCACCTACAAACAAACGCAGTCT
CCAAACCAGCCCATGTTGGCATGGCTTGGCCTGCATGGGGCTCTGCTCAGAGGGTGCAACTTGAATTACC
ACTAAAGGCTCAGCTTTCGTCCCTTGTCCTTGAAGGAAGTTCCTGGGCCAGTCCTCTCCCAGTGTGTCTT
CCTTCCCCTCCCCAGGGGAAGGGGAGGGCTCTAGTCAACTGAGGGCTCCATGGATGTGGGCATGGAGACT
GGCACACACATTTCTCTCAACCCACCACCAGAGGCCTCAGGGCCCACACCTTCCTCTCTCATTGTACCCT
GGCTGTGAAAACACCAGATGCCGTGTACCTGTGGGGGTAGCCTGGTCCAGCTGGCCAGGGCCCAAGTGCT
CATCAGCATAAGAGGTCTCCAACTCTCCGAGATCACAGCATCCTATGAGGGAGGCGACAACTGTGGTAAC
AACGATGGCCATGGTGTGGCCACCTACCGCAGGATCCTCCTCTCTCTTTTACAGGTGTGACCATTGTCCC
TTTGATCCTCACCACAGCTCTCGGGTAAGGATTGCAACTCTCATCCCATTTTACAGATGCAGAAGCTGAG
ATGCTAGAGATGTGATTGTGTCAGTTTCGGAGGACATGGGGGTGAAGGCACAGCTGGAATGAGAGCGTGA
AGCACTGGAGAGGCAAGCCCGCTCACCTTCTGCTACATCTCCAAGTCATAGCAACATGAAGTGGGCCACG
AATACCACCAGACTGTATTGCTGGGGTAGTAAAGATAGGAGGGGCCCAGGGGGCACCCCTGTGACAGCCT
TGGCCGATGCTTTGCAATGGAACCTCCTGGCTCTGCAGGTTTGACTCTAGGCCGAAGAGTCACAGCAGCA
GTTTCCATCAACTGAGGTGCTTCAGTGTCCGATCAGGCACCCTGCAAACACAGTCTGTTCCACCGCCCCC
AGGCAGGTGCCAGTGTCCCCATTAGCAAATGGTGAAGCTGGGTCTCAGAGAGGTCAAGTAACCTTTCTAA
GGTCAGACAGCTAATAATTGACAGAACCTAAATTTGACCTGCAGGGGAGCCCACTTCTTAACTTCTAGGC
TAACCTGACTCATAAAAAGTACACTATTCTCTGTTTCTCTCTCTCTTTCCTTTTTCTTGCTGATTTTATA
TAAAGGGCTGGCATTCTGATTGTTCTTTTTTCAGGTTTAATCCTTATTTTAATAAAGTTTTCAAGCAAAA
AAAAAAGGTACACTAGAGAGGTTCACCTAGGGACTAGTTTCACCCAGGGTCATCATTCAGTTCAGCAGTG
AGTGCTGAATGCATTTGCTCCAGCTCCCTCGATCCATCTCAGTTTGGCTTCTCACCATTCCCACCCCATC
ACCAATACTACCACCAATACAACTGTCACTGTTCCCATCACCACCAGCATCACCCTCACGATCACCACCA
TCACTACCATCACTACAACCAGTATCACCACCATCACCACAAACACCAGCACCATCACCACTATCACCAT
CACTATCCTCAGCATCACCACTGCCACCACCATCACCATCCTCACCATCACCACTGCCACTACCACTGTC
CCAACTGCCACCACCACCATCACCATCACCACTATCACCTCTACCATCACTACCACCACTGTCACCACCA
CCCTCACCATTACCACCCTCACTATCATCACCATCACCGCCACCACCATCACCACCACAAAAACTACTGT
TTTCATGACCACTGCTATCACAATGAATATCA