Dbfetch

>gi|189485775|ref|NS_000193.1| Uncultured Termite group 1 bacterium phylotype Rs-D17 plasmid pTGRD2 DNA, complete sequence
GTGTGGAATGAAATCATTACAGAATTAAAAGAAAAAATACCGACTGAATGGCTTGAACCAATAAAAGAGG
AAAGCTTTAAAGACGATATATTAACGCTTGCTGTTCCTGATACATATTATGCTCAAAAGTATGAAACCGA
TTATAAACCATTAATTCAAAATATACTAAAAGCAAAAACAGGCAAAGCCGTCGGCTTGCAATTTCAAATT
GTTGCTTCTAAATTACTGGCAGAGCCTGTTATAAAAGACGAAAAGCCAAAAACGCAATTAATGAAAAAAA
CGAAGTTTAACGGCAAGCCATATTTTGAAAATCCTGCGGAGTTTGTCTCAATTGCAAAAGCCGCAAGTCA
GGTAAAAGAGACAGATATTAAAAATGCCGAATTAACTTCAATGCCTAATAAATATGGCATAACTAATGTT
GCTTCTTTCAGTTTGCTTGATAGTAAGTTTTTTACTTATCCGAATGATAAAAGGAAAAAAACGAAAGTTG
AAATGCCTGTAAGGTTTAGTAATGGTGTTGTTAAGGTATATAATTTGTATCGAGGGCAATTCGCTATTAA
CGATAATGGTTATGGTCAGTTGACAACTACGCACGCAAAAATATTTTTTGCGATTATTCATATATGGCAA
AAGCAGAATAGCAGATATGCTGATAATAAGGGCTTTTATGCAGTTGTTGATATTTCAATGCGGGAACTTG
CAAAGCAGTTGGGTTATCAAAAAGTAAGCGGAGCTGATTACCGCAGATTATTGCAAAGAGTTAAAGAGCT
GGTTGATTTTCCTATGATACTTTCAGACGGACGTGTTGCTCATACTTTTACTTTTTTGAATAGTGCTATT
GGTCGTACTGTTCATCAAAGCGGAAAGAATAAATTAATGCTAAGACTTACTCTTAATCCTTTTATTTCAA
AACAATTTTACGAAAGAAATGTCATTTTAAGAAATCCTCAATGCTATAAGATTAAAAATCCTACCGCTTT
TAAATTCTTGTTATGTTATGATAAAAGAGTAGTTAAAGGTAATAACTTAAAATTAAATATATATGAAGTT
GCGAATGATTTGGAATTAAATATATCTAAGCTTTGTCACGGAGTTTCTGTGTTAAAAGTTGCATTTCGTG
AGTTAAATGGATACGAACTTAACGATAGTTATCGCTTGTATGTAGAATTAGTTAAAGAGGAAAGGGAATG
GATTGTCATTGCTGAACGTATCTCAAAAGAAAAACAACAACCATTAAAAGCGTTATTAGCTTAACTGCAG
AACTGACATAGAATGCGAAGCATAAGAGGAGCGAAGCTCCGTGCTTGTAGTTGTCTTTCCTCTCTTAAAA
GCCTGCCTTTTAAAAAAGCTCAAATCTAAAAGTAAAAATAGTCATATTAAACATTGTCTAAAATCTTGTC
TTTAAAAAACAATGAAAAAAATCTGTTGTCGTTGATGTTCTCTGGAACACCCTTGAGGCTGTTCAGTAGA
AGTAGCGGTATTCCCGCTTATTTATTGTCTTGTCTTTAAAATCTATTCTGTTTACTGTTAAAACGTAAAA
AACGATTAAAAATCGTAAAAACTGCGTTAAAGGCACGCTGGTGCCTCAAATAACGCAAAACAGACGTTCG
CTGGCATAATAGCCATTAAAAACATCTTAAAATGTCAAAATATGCCAATATTATGCCAAAATAAGGCATT
ATCACATAGTCTAAAGCCTTAAATAAAACAAAATAAAAAAAATAAAAAAGGCTAAATGACTGTGATAAGC
CTTGAAAAGCTTGTAAAAGCTAAAAAAAACGGATGTAAATCCGTCAGACGGACTGTAAAAAAGAGCTGGC
TAAAACTAAAGCCAGCGATAAAGCGTGCGTATAAAGACTTGATTGTATTAGCACGCTGTCCACATTGTTT
TTGATTGTTGTGAAAAAATGTGGGAAAAAACTTATGTTTTAAAATGTAAAAGATTGGTAAAAAAAAATAT
TGGAAAGTCTCTAAAAGGTGATAACTGATTGTTTAATACTAGTACTTGAAAAACGCAATAAAATGCGTTC
CAGCCTGTCTTTAAAATCTAATCTCTAAAATAATATAAGCCTATGATTAAATATTATAGGCGTTTCAAAT
TGCTCCTTCTTGATATGCAATTGGGACGTTGTCTCTTTTTGCTTTAATATGCAATTGGCTGACTGACAAC
AAAATAATAACGATAGTTTATGAAAGCGTAAAAAGCTAAGACGTTATGATAATGCTTAGTCGCTGTTGTA
AATATGTCTAAAAATTTATTATATATTTATAGGCTTGCACGACATTTAGATAACGTCTGTGATGTATAAA
TAGTCAAAAGCCGTCTTAAAGTAGACGGCAAAAATAAACAAAAAATGAGCGAAGCGAACACCCTCTATAC
TTGATATACATATATGCTACGTGGCGACAAAAAGAGCCGTAAAAAGTTATAAAATAATAATTACTTTCTT
AATCGTTTTCAGCTGAAAACGAAACAGTATAAACTTGATATACTATATGCTAGTTGCAGACAAAAAAAAA
TGAAAAAAAGATTAAGAAAAAAAGTGAAAAAAATTCAGCCCCAAAAATAGACCCGAATAAAACTTATCTG
CTTTGTTATACAAACTTACCTTGAGATACACACAAAAAAATATCTGGACAGTTTAAAGAAAAAAAATGAA
ATTGAAAAAAGCTTTATGCGTATATTTAACGATTGTTCTGTTTTTGACAGGCTGTGAAAATCTTAAAAGC
CAGATAAGAGGCAATCAGAATACTGTCGCTTCTGCCGACCAGCCGACAGGCGATATTATAAAAAGCGATA
ATAGTGGAATAATTGAAAAGCAGAAAGAAAAAGAGTCAGATTTAAAAAAAATAGAGAATAATGTCGATAA
TCCAAATGGTGATAACGGTGGCGATAATAATGGCGATAATCCAAATGGTGATAACGGTGGCGATAATCCA
AATGGTGATAACGGTGGCGATAATAATGGCGATAGTAGTCAACACAAATCGTCCAGCGAAGCGAATGGAA
AAGATTTAAGAGGATGGTTATGGGATCATAAAGGAAGTATTTCAGGTATAGTATTAGCGAGTGCGGTAGT
TATAGGTGCGATAGGATTTTGGGGTGGACAACCAAATGTTTGCGCAGTTAATTACTTTTATGTTCCCCAA
GCAGTTCAGGAAAATCAAGCCCAAGTTCAAGTTCCAGCAGTTCAGGAAAATCAAGCCCAAGTTCAAGTTC
CAGCAGTTCAGGAAAATCAAGCTCAAGTTCAAGTTCCAGCAGTTCAGGAAAATCAAGCTCAAGTTCAAGT
TCCAGCAGTTCAGGAAAATCAAGCTCAAGTTCAAGTTCCAGCAGTTCAGGAAAATCAAGCTCAAGTTCAA
GTTCCAGCAGTTCAGGAAAATCAAGCCCAAGTTCAAGTTCCAGCAGTTCAGGAAAATCAAGCTCAAGTTC
AAGTTCCAGCAGTTCAGGAAAATCAAGCCCAAGTTCAAGTTCCAGCAGTTCAGGGAAATCAAAACCCAAA
TCTAGTTTATTTTGACATCCACAGCGGCAGATATATTCCAGGAAATCAAAACCCAAATCTAGTTTATTTT
GACATCCACAGCGGCAGATATATTCCAATAGTTCGGGGAAATCCAAACCCAATTCTAGTAGTTCAGGGAA
ATCTATACCAAGTTCAGGGAAATGAAAGCCCATTTCCAGTTCTACTAGTTGAGGAAAATCAAGTTCAAGT
TCCAGCAGTTCAGGAACTACCATCACAACAACAACTTCAACGAATACAAAATCGACTAGATCAACTACAA
GGACAATTACGAAATTTAGAATCTCATGCAATTTTTCAATTTCAACAAATTCAGGTAGAGGCAGAGGCAT
TGCAGCTACACAATGAACAATACATTCAGCTCATTGGATCTATAGTTGATGACCCACTTTATCCGCAACT
AAACTTACAATTCCAGCAAATATGTCAAATACTGCGACACAGCCATTCCCTCCAATTATATGATATTGGA
TTTCATATATTTTTAATGCGTGAAATACTCGACCACCACCTACACCTAACCGCCCGAAACCTACCTGATG
TTTATGGACCCCCTCCACGATGGGAAGCACTGAGAGTACAGGAACAACTTGAACGACACAATCAACAACT
AAACCAACTATACCAACAAATAGAAGGCAGATTAGTTATCGAACAGAGTGTGCTAGGAGCTCGCCCCGAT
TCCCAACAACGCCAACAAGAGCTAAGGGAATTTAATGAACTAGCTATTCAACTGCAAGAACACCAGCGAC
GTATAGAAGCATTATTGAAGTGGCTTATATAAAGCGAAAAATAAAAAAGAATTTGATTACTGTGAAAACG
ATATGCGTCATACTGCTGACGCTCTAAAACTTTGAAAAATATTTGTTCAAATAGTATCCGTATCAGCAAG
GATACAGGCATTATAACTCTTACTTGACTATATAATGCCCATCCGTACCACCTTTGAGGCAAAAAATGCA
CCCACGTTTAGACCCTGCAAAAATATATTTAGTCCAGTCAAATAGTGATAATTCTCTTAATCTGGAGGCA
GAGATATTCTTATGAAAAAAACTGATAATAAAGATAATAAAGATAAACCCATAGGAAATGCATTTCCTAT
TAACAATCCGTTTAGAAGTTCTAGAACTGTTCAAAAAGCTTTAAAAATAATTAATAAAAAAGTTGTTAAA
AAAGATTAAATGAGGATATGACTGCAGTGAAATTTAAAAAAATATTTGCTGTGATTTTAATGTTGTCTGT
GTTCTTGTCTGGCTGTCAGAGGCAGGTTATAACAGGCGTTTCTAAAAATGAAAATGATGTTTCAACTTCA
ACGAATACTCCTGTTCCAGAGCCTACTCCTACTCCGACTCCTGCTCCAGAGCCTACTCCTACTCCGACTC
CTGTTCCAGAGCCTACTCCTACTCCGACTCCTGTTCCAGAGCCTACTCCTACTCCGACTCCTGTTCCAGA
GCCTACTCCTACTCCGACTCCTGTTCCAGAGCCTACTCCTACTCCGACTCCTGTTCCAGAGCCTACTCCT
GCCTTTATGGATTGTTTCCCTAAATATGAAGCCCCATTGTCTACTCCTGCTCCATTGGATGAGGATGATT
ATTATGATAACAGGGTAAAATGGGCTCTATCGCACGTTGATGATGATGGTAACTGGGTTAATGGTAAGCA
TTCCGAAGCTCCTAAGTGCTTGTTAGTAGACTATTACAATAAGTTTTAAAAATAAGGTAAGCTTTCCGAA
GCTCCTAAGCGCTTGTTATTATTAAAGGATTTGTAATTTTCAGCGTCTACTCCTGCTCCTACTTCACCAT
AGAGATTACGTCTCAAGACAAACTCAATTAATTATTAAGTTATAAATTATGAAAAAGCTTGCATAAATGC
AGGCTCTTTTTTTTGTGTTGACTTAAACGTTAGTCCTTTGTTAGTATATGTGTTTCTATGTGCTGATACA
CGTGTTTCTATGTGCTGATACACGTGTTTCTATGTGCTGATACACGTGTTTCTATGTGCTGATACACGTG
TTTCTATGTGCTGATTTTTTGAAAAAAGTGGCTATAAATAAGGATTGGGCTTACTCTCTATTTCTAACTA
CTCTATTACTACTATGTCTGCCTAAAGTCTGGCAGACAATTTTCTTTTTGAAATTTTAAAAGATAAAAAA
GACAAAAAACCAAAGAAATAAAGGATAAAAA