spacer

EBI Dbfetch

>gi|73912721|ref|NR_000003.8| Mus musculus small nucleolar RNA, C/D box 35A (Snord35a), small nucleolar RNA
GGCACATGATGTTCTTATTCTCACGATGGTCTTCGGATGCCACAGTTAGGGCAGTGCCGATAATGCCAAA
GGCTAAGCTGATGCCAGGA



spacer
spacer