spacer

EBI Dbfetch

>gi|209529740|ref|NM_000231.2| Homo sapiens sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein) (SGCG), mRNA
GAAACTCGTGAGAGCCCTTTCTCCAGGGACAGTTGCTGAAGCTTCATCCTTTGCTCTCATTCTGTAAGTC
ATAGAAAAGTTTGAAACATTCTGTCTGTGGTAGAGCTCGGGCCAGCTGTAGTTCATTCGCCAGTGTGCTT
TTCTTAATATCTAAGATGGTGCGTGAGCAGTACACTACAGCCACAGAAGGCATCTGCATAGAGAGGCCAG
AGAATCAGTATGTCTACAAAATTGGCATTTATGGCTGGAGAAAGCGCTGTCTCTACTTGTTTGTTCTTCT
TTTACTCATCATCCTCGTTGTGAATTTAGCTCTTACAATTTGGATTCTTAAAGTGATGTGGTTTTCTCCA
GCAGGAATGGGCCACTTGTGTGTAACAAAAGATGGACTGCGCTTGGAAGGGGAATCAGAATTTTTATTCC
CATTGTATGCCAAAGAAATACACTCCAGAGTGGACTCATCTCTGCTTCTACAATCAACCCAGAATGTGAC
TGTAAATGCGCGCAACTCAGAAGGGGAGGTCACAGGCAGGTTAAAAGTCGGTCCCAAAATGGTAGAAGTC
CAGAATCAACAGTTTCAGATCAACTCCAACGACGGCAAGCCACTATTTACTGTAGATGAGAAGGAAGTTG
TGGTTGGTACAGATAAACTTCGAGTAACTGGGCCTGAAGGGGCTCTTTTTGAACATTCAGTGGAGACACC
CCTTGTCAGAGCCGACCCGTTTCAAGACCTTAGATTAGAATCCCCCACTCGGAGTCTAAGCATGGATGCC
CCAAGGGGTGTGCATATTCAAGCTCACGCTGGGAAAATTGAGGCGCTTTCTCAAATGGATATTCTTTTTC
ATAGTAGTGATGGAATGCTTGTGCTTGATGCTGAAACTGTGTGCTTACCCAAGCTGGTGCAGGGGACGTG
GGGTCCCTCTGGCAGCTCACAGAGCCTCTACGAAATCTGTGTGTGTCCAGATGGGAAGCTGTACCTGTCT
GTGGCCGGTGTGAGCACCACGTGCCAGGAGCACAGCCACATCTGCCTCTGAGCTGCCTGCGTCCTCTCGG
TGAGCTGTGCAGTGCCGGCCCCAGATCCTCACACCCAGGGAGCAGCTGCACATCGTGAAAGACTGAGGCA
GCGTGGATGGGAAGTAAACGCTTCCAGAGGAACTCAGAAAAAATTATGTGCCAGTGAAAGTGTTTGGACA
AAAACTACATGATCTCAAAATGCACGTGGATGTGAGACACAAAAGTTGACAAAATGGAAAAGCAATGTGT
TTTTCCACTGGATTAATTTTCACCGGAACAATTGCGAATTCTCTCTGCCTCGCCTCCCCCTATCTTGTCC
GTGTGGGCACACACTGAGTGTTGAGTTGCCGTGTGGAGTTAATGTATGACGCTCCACTGTGGATATCTAA
TGCCCTGTTGAGAGTAGCCTTGCTCAGTACTAAAATGCCCCAAAGTTCTATACAGCATTTCCTTTATAGC
ATTCAAACCTCACATCCTCCCTTCAGTTTAATGCAAGTAAGTCAGGTTTCACAAGAAAATTTTCAAGTTT
TGAAGGGAATTTGAGGTTGATCTGGTTTTCAAGATGTAGTTAAAGGAATAAATCACTCAAAATTAAACTT
TCTGTATATAGTCAATAAGCAATAAAAACCTCATTTTTCAGAGTTAAAAAA



spacer
spacer