spacer

EBI Dbfetch

>gi|32455353|ref|NC_004952.1| Francisella novicida plasmid pFNL10, complete sequence
ACATAGTAGATCGACTCTTCTTAGGGATTTTATATTTTTTGATAAATCATCTATTTTGCTAGTTAAATCA
TCAAATTTATCATCTTGTTGTTTGACTAAATCTAAGAATCTATTCTCTTTTTTAAAATCGTTCATGCAAA
CCGCCTATAGCTTTCTTCTTTTTCTGAAATTATTTGTCTTCACACCATAATTAAATTCCCATTTTTATAA
GTAAAGTCTTTTAAAAGCTTGTCAGTCTCTTCTCTAGAAATGTACCAAATTTTACCTATTTTAGGATACT
TTTCATGAAGCTCTTCTATTTTTCCCCAGTCCTTTAATAGTCTACCTTTAGAGTCTCGTAAATAGTTATC
TTTGTGACAGGGGCCTCTTTTATCTTTTTTAATGTAACTATATGTTATTCCAACGTCACTATTACTATTA
TCCAAATCTTTTTTAGCATGCCAGTAAGAACTTTCATAACTTAACTCTATCTTTCGACCTCTTTGATATA
CAACAATAAAGCTATAGCCAGTAGTAACAACCTGTTTTACTTTTGTTAAATCTATTAACTTCTTATTTAT
TTTTTTATGTTTTTTTGAAAATTTAAATATTTCTATATTCATTCCTACACTTCCTCAAATCCAAATGGTA
GCTTATGATTCTCTTCTGGTTTCTTTTCTAATTTTTTTATATTTGCAATAAAAACTCTTTTTCTATCTTT
GATTTTTTTATTGTCCCAATTCCTCCAAGTATCATCACAAACCCTTTCAATATCATGTAAATGATGATGT
CTAAATATTGATCTGACATAATACAGATCTAGGTCTAGTTCATCACTTAACACAACTTCTCTAAGTCTTT
CAGATGCTTCGATTGGTATGTAATCCTCTTTATTTTTAGTATCTAAAAGCTTTTGCTTAAATTCTTCTTC
TGTCTCTGCTACCTTACTAACTGTAAACTTGATATTTGTAATCTTACGACCATGTTTTCTGTGATGATCC
TTGTCATCATAGGTTACAAAAATATCCGATAATTGATTAATCTCTTCTAGTGCTGGTAATAGGAACTTAT
TTTTAAAATTTGAATATCTGTTGCTGTAACTTTTAGGTAAATCAAAATCATTAATCATATCATCGACATA
CAATACGCAATCAACTATATTAGCATACCCTGCTTGTTCGCCTAATTTGCTTTTGAGAAGTAAGTATAAT
CTGCTTGAATACTTACTTTTAAATGAAAATAGTAACTGTCTTTCTGCTTTAGTAAAGTACTCTTGTAGTT
GTATCATGTGTGGCATTAATGACCAATGAAACTCGCAAATTAAAGCACTGCTTTTAGGGTCTGCTTCAAT
ATATGCAAACCAGTTAGCTATCTTCGTTTGTTCTTTATTCAGCCATACTGGCTTAGACATTATTGAGTGC
ATTAATTGCTTCAATCTCACTCTGTTATGCTTAACCCCTGTAGCTTTTTCAAGATCAGATAGGCTTATCT
TATACCTGTGAAACTCTTTATCTTCTCTTTTAACCATTGAGGCAACTAAGAATATTAAGTTTTGTTCTTC
TTTTGTAAGGCTATACTTTCCTGCAACAAGAGTATTAGACATAGCTATTTCTTTGCCAGCATTTACATTT
TTAACTTCTTTCATAGAACTAGAGTCATTATCTCGATATACAAATTCTATAAAACTTCTATTAGTAAAAC
AACTACTTCATAAAAAAAAGTAGTTTTAACGATACAAAAAGTAGTTTTAAATTCAAAAAGTGATACAAAA
AGTAGTTTTAAATTCAAAAAGTGATACAAAAAGTAGTTTTAAATTTTTTAAAAAAGTGCTTCAAAGCCTT
ATGTAGCAATACTTACAGAGGATTAAAAAAAAATCTGACAATATATAAAGAGAATATATAAAGAGAATAT
CTTAGGGGATTTTAAAAAAATCCCACAGACTCAAAGACTTTTTTGACTTTTTAAATCCTAGAAACTATAC
TTTAAGTACTTATTTAAGTACATGGATTTAGATTATGCAAACCGTTAATTATTCAACTTTTAGAAATGAA
CTATCTGATTCAATGGATAGAGTAACAAAAAATCATAGTCCTATGATTGTAACTAGAGGTTCAAAAAAAG
AAGCAGTTGTTATGATGTCGTTAGAGGATTTTAAAGCTTATGAAGAAACAGCCTATCTTATGAGAAGCAT
GAACAACTATAAGAGACTACAAAATTCTATTGATGAAGTAGAATCTGGTTTAGCTATCCAAAAAGAGTTG
ATTGAAGAATGATACTTTCTTGGTCAACTAATGCTTGGGAAGATTATCTATATTGGCAAAGCATAGATAA
GAAAAAGCTAAAACGGATTAATTTGCTAATCAAAGACATTATGAGAAATCACTTTGAGGGATTAGGAGAG
CCTGAACCTTTGAAGCATAATTTCTCTGGTTATTGGTCTAGACGAATAGACAAAGAACATCTGAATAATC
TATAAAATTGAAAATCAAAATCTAATCATTATCCAATGCATTATCCAATGCAGATATCATTATTAGAATT
TCTTAGAAATATGAAATTCCAGCCAAAGCGAATTTTAGATTTTTAAGAAACTACGATGATGTTTACCATT
CTGTCAATATGTACTTTTGTGCATAGTGACAGAATGTAGGATAAAACCAAGAGCCATTGCACATGGGAAA
ATAGATTATCATTTGCTATTGAAATGCTTTAGTGATGGCGTTAATATTAATACATTGATGTGCTACTCCA
GCCTTGTAGAGTTGCTTTCAAATTACTGGTTTTACCAGCCCGTTACAAAATACTAGCTTAGCTAGCTCGT
TTCAAATTACCGATGATATCGGACCGTTCCAACTTACCGACCAGTTCGGCAGGTATGTATTTGCGTGCAT
TCCTATCCAAAAAAACATCAAGCCAAAAGCTTGAAAAAACTTACAACACAGCTCAACAGAGCTAGATTGT
AAAACCCTGCTTTGTTAAGCAGAACGCAAAAATTGAATGACTTATAGTCATATCGCTTCGACCCTCGTAG
ATTAGTAGCCTTGAGCTATTAACTGGTTGAAACACTTACCAAATAAAGATTAAAAGCGATAAAAATGAAA
GATAAAGCAGCTAAAAACAGAGATTTTAGAAAGACTATTTTATCAGTGTTACAACGCAATAAAGATGGCT
CTTTTGCTACGCAAGCAAATAGAAAGTCTATTCTGTTGCAGGCAACTAAAGACCTTAAAAAGGTAGGGTT
TAGCAAGGTTACAGCCGAAAACTTCGGTAATAAGCATTGCTATGCACTTAGAGACCATTGGAGAGCCCAA
GGATTAGCTACAGCAACGATAAAAAATCGTTTAGCTTGTCTAAGGTGGTTAGGCGAGAAAATGGGCAAAG
AACTACCCGATAATCGAAAATTAGAGATTGAGAACAGGAAGTATAGCGATAATTCAATCAATAAAGCCCA
AGAAATCGATTTTAAGGCGATTTCTGCCTTAACTGATAGGCAAGCCCTAGCAATACAATTACAGCGCGAA
TTTGGGCTTCGTAGAGAAGAAAGTTTGAAGTTTCAGCCTAGTTATGCAATCAAAGAGCATAAAATCGAGC
TTAAAAGCTCTTGGACAAAGGTTGGAAGACCACGAGAAATCCCAATTTTGAATGAAAAACAGAGAGAATT
GTTAGAAAAAGTAAAAGAGGTAGCAGGTAAAGGCTCTCTAATTGAGAGCGAAAAGTCTTATAAGCAAGCA
ATGGAACATTTCACGACTCGCTGTCAAAGAGCAGGGATTAAGAATGTTCATGGCTTTAGACATGCGTATG
CTCAAGATAGATATAGGCAATTAACAGGGCGTGAGTGTCCTAAAAATGGTGGATTAACATCTAAGCAGCT
AACACCTGAGCAAAAGCAACAAGACTATGAAGCTAGAATGACTATTAGTGAAGAGTTAGGTCATGGTAGA
GAAGATGTAACAGTCAACTACTTAGGCAGATAAAAAGCAATATAGCTATAGAAGAAAAGAAAGCTATTTT



spacer
spacer