spacer

EBI Dbfetch

>gi|56160738|ref|AC_000014.1| Fowl adenovirus A, complete genome
GATGATGTATAATAACCTCAAAAACTAACGCAGTCATAACCGGCCATAACCGCACGGTGTCACTCGGGTA
CAAATTATGAATTCGATCTTTGGACTTTTCGACGCGCCCAGTGACTGTACTTTATTGCGCCAATTCACCA
CGCCCGGGAGATTTCGAAATTGCTATTTCCGTGCAGTTCCGCATTCCGAAGTACAATTTAACCGGTTTTA
TGGGTGTTCGGTGTTTTTCTAGCTTAATCATTGTTTTTAGACGACACAGTGGGTATCTGTTTTCGCTTGG
ACTTGGCTCCGCTTTGTGAAAATTCAACTCGATCCAACATTTTCCTTATTGATGGAAGGCTTTTATTATT
TGCACAACAGACATCGCGCTATTTACACAGAACGCAAAGTGCTGTCTTTTTTATTCCTTGTTCCGGGTAC
ATCTTTTATTGCTAGTGCCTCGCCTATTTTTAGTCACGTATCTTCCTTGTTCTATAGCTATATATTCACG
CGGTTTTCGGTCTCTCCTCACTCGGCAGATGACTTCGGAAGAGAAGCTGCAGAGTTCGTCTCCGGAGACC
GGCCTCGCCGCTGTCGTCCTGCAAAGCCCCCTTGAGGTACGTGTGCCTGCCGTTCTTCCTCCTCCAGTGC
GAATTGACATCTACCGCTACCCAGGCTTTCCGCCAACGGAGACCATCTGGCACGGTCTCATCACGCAGAC
TGAGTTAAACCAGGCTTTGGAGAGCATCGTTGAGCAATTGTAGTAAGTGTCAGTCCCTATTTTTCTGTTT
TTTCTTGTATTTCCTCTTAGACGATGGACCCGTTCGGTTCTTCTTCAGTCCCTCCGTGCTCTACATCAGA
CCTTCCCGAACCCAAGCTCTATTTCGTCCGCTTGTCACCCCATGCAGTGCCTCCAGTTAGGGCTACGCAC
GGAGCTGCAGGATACGATTTGTTTAGCGCTTACGACATTAAAGTGCCTGCTCGCGGTCGGGCGCTAGTTC
CCACAGATTTAGTTTTTCAATTTCCGCCCGGCTGTTACGGTCGGATTGCTCCTCGCTCGGGCTTGGCCGC
CAAATTTTTCATTGACGTCGGAGCGGGTGTTATCGATCCCGATTACCGCGGGAACGTTAGCGTGGTTTTG
TTCAATTTCTCCGAGAGCTCGTTCAACATCAGGCGAGGCGATAGGGTAGCACAGCTTATTCTGGAGCGTA
TTATGGTTCCGGAGCTGTCGGAACTGACGCAGCTAGGCGAGACAGACCGCGGGGCGTCGGGTTTCGGGTC
CACAGGTATGGGTGCTGTAGACCGCAATCAGCGCTCTGTGTTGGAATGGCTGACCCCTGGTTCCCGTTGA
TAGGACCCTTGCGACGAAGTCGACTTCGCTGTACGCTTGCAAGCAGATTTTGAGGGGGACGACGACACAT
ACGGACATTGTCTGTGCGAAGGCAGCACCAGCAAGAGGCCCTGCTGTACGCTCTGTAACAGTTACTGCGT
GCTTCTTTAGGTATGATTGTGAGCGTGTGGCAGCTCGCGACCATCGCGATTGAGTTTTGCGATAAGTGGG
TGGGGAAATACTACAGATTCCGACCGTATCATGAGAGACTTTTGCTTATGCAGAGTCGGCAAGCTTTGGA
AAGGAGCTTGCGCCGCTGCGTAAGTGAAGTTGGACCTCCGCCAGAGCCTCTAGAATAGCGATGGAGTCCG
GCGCACGTGGTGCTTCCTGACTTTCTGCACCATTACCGTGGTGTTTCTGGCCTTCTTTCTGCAGAAACTT
CTCAACTACATAGATTTCAGAGATAGCGACTGCACAGAATGTTTTTTTGTGTAGTTGACAGGACTATGGA
CCAGACAGCAACCCATACAGCTTTGATTCTTCTGATCGTCTTGACGGTGTTCACGGGCGCGGTGGTAGCT
TTGATGTTGTATATTGCGATAACTGGACTTCCTTGCTCTATGCTTTGCTCTCAATAAAGATTTTCAGAAT
GGTGATTCTATGGTATTTTGTCTTTTTTCTAGACAGTCATGTCGCGTGAGTCTGAACGTTACTGGACTTT
GGTGCACGCTCTGATTGATCGGGGTGTAGTCAGCCGTGAACAGTGGCAAATGGTTGACCCTGCGCAATAC
CAGTTCTACCACCGCTCCAAACAGAGGGGTTTTAAGGTCCGTCACATTCTTCGTGATGTGATTCGCCACA
TGTGTTGGTCTCGGACTCTGTTAGATTATATGTCCTCGGCCTCGACACCTAGTCCGGACGATGTATTACG
CAATCCCCTGTATCAGTTGCTGTTATGTAATGGATATAACCCCGCTGTTGTGGGGACAGCGCTGATCCGG
TGGGCGGGCCATCAGAGCAACCGTAACACTGTTTGGATTCGAGGCACCCCTATGTCCGGAGCTCCGTACT
TGGCACAGGCTATCGCGTACTGCTCTCCCCTCGTAGGGAGCGTTGATTGGCGCAACAAGTCTAACCCATT
CGAAGGGTGTCCAGATAGTCTGGTGTTTTGGTGGGACGGCGGTTATGTTTATGATTGTTGTGTGGGTCTG
GTGAAGCAGGTGTTCCGGGGAGAACATGTTATTTTGCCTCCTGAGGGCTTGCGTGGCCCCAACCCGTGCT
CTGAACTCTTCAGGACCCCAGTCTTGATGTACAGCCAGGCGGATATTTGTATGACTAGGCTGAGATCAGG
GGAACTAAGTGCAGAGCATGCGGTGGGCCTCAGGGATTGTATGTACCTGATCCGTTTGACAGAAGATTTT
GACTGCGCGGGTGGTATATCGTGTGCAGATGTCAAACAGTTTGTGGCGTGGAGCCGCGAACACCCTGGGG
AGGTTCGCGAGACCCACGAACTCAAATAAAAATTCGGGACTTCTGTGTACGTTCCTTTTCATGTTTATTA
AACACTGTTCTTTCGAGTGAGTCATATCACGTGGAAGTTAATTGCGACTGGGAGCCGCAGAAGCAGGTGG
TAAAAGCAAGCTATGCAGGGATAGTTTACGATGTCCCTTGGAAGACAGACATAGAGTGTTTGTCCTTCCA
GTCGCGTGTAGGCGCCTTGGCGCCGCGCAACGGTTACTGCTGTATATATTTGTTCGAGGGCAGGGTTCAA
GTTGCATAACCTGCAGTGAGTAGCATATGTGTATAAGATGAGATTAAGAGGGAGTTGGGGCTGGTGGTCG
TGTTGAGCAACGAAATTGACGACCGTTTTGGCCCAGTGAGCTGTAAGCACTCGGATGAGGGATAAACAAA
AGAGGGAACGGGGTGTCTCGCAGCTGCAGATGTACTGGATAGTCCAGTCGGTACATCGCATCTCAATAAC
TCTTATCCAGCTGCAGAATGACCTGAGCTGGAGGTCACACTCTTCGTCCGTAATGCAGTGGGGCGAGTGC
TTGAAGGGGTACATCTGTCTTTTAAGGAGAAAGAGTAGGAAATCGGGATCTGTGATTAGGGTAATGCCCA
CGCGCGTGAACAGGGGCTCGATGTAGATATGCCAACTGTGTTGGGGCTCGTCCTCATCGTTGTCACTATC
CCAAACAAGGTCGCACGACTCGAATGTCTGTAAAACATCAAAAGTTTATTACTGATTTTGAAGAGGGGTA
CGTATACAGGGGTTACAGAGTTTATTATCGCGTTTGCAATGCAGTGTCATTAAGCAAGCACAAGCGGCAG
CATTAGCAACAAAGTCGCGTAGCTCTTTGCGCGGGTGGTAGCATGGAGGGGTCTTGGTGTGGTCTCCTGT
GAGGAAGAAGACGACCGTGTTCCGCGCCGTGAACTCGTTGGCGAGCGAGAGGTCCGCGCAGTGGATTAGC
ATGGGGGTCGAGGGGATGTGGAACGTTTTCTTATTCAGCCTGCAGGTGGCAGCATTGCCTTCCATAAAGT
GCAGCATCAACGGGTCCGGCTTCTCGTCTACGAAGGGCAGACAGTATAGAGAGGCGTGGGGTGCGATTTC
GCCCAGTGATAGTATGGAGTTGATTCGGCTGTCGGAGATCGCGAGCGGGAAACACGCGCATAAGGCATTA
AAGAGACTCTTGGCGTTGGAAAGTCTTCCTCCGCAGAGCACGAGGGTGTTTAGTTCTCCTCGGAGCCATC
GGAGGATGGCGTTAGCTGCCACTTTTCCCTCGTAGCCTTCGGCTTCCATCATCTGATGGAACCAGTTGTC
GCAGACGTTGTAGAACGCAGCCTTGAGGGTGTCGGGCTCTTCGGAGGGTAACTGGTTAATGAGGCTCTGT
CCGGGTCCGAACCGTTCCTTGAGGGCTTCGAGTACACGCTCTCGTTCGTAGGTGGGTATGAGGTTCTTGG
ACGGGAAGTTCCACTGGACTTCGTGTGCTACACCTTCGACAAACAACCGTTCAACCAACTGATCCATGGG
GGACGTGGACGGAAATAAGCAGGGTGAAGGGGTGTCTGGAATGCAGGATGCTATTTGCTCCTCTTCGCTA
CTTAAAGACGACTGAGACTCGCGTCGCCTCTTGGTGCACTGTGGGAGAGAATTATATGTCATGTGATGAG
TGACAAGCATTGCATGGGGAGGTCCACGAGCGGGAACAGAGCATTCCTTTGTTCTCGCATAGGAGAGCGC
GCAAGGCGTCGTTGTCATTATCTGCCTGTAATTGGTGTATGCGATGAATGTAGCGGGAGAGCTCTCCCAG
AAAGAACCCGCAGCCGTTGGCGGGTTCGTAGAACCTAATAATGATATGTTCGTCGGGAGCAGTGGGCAGA
TGTTCGGGATGGGGGAGCTGATATAAGCGGACGAGGCATTTTTTCTCACTGATGTCCACGAGACCGTCGC
GGGTCATTGTGGTGAATGACCTGCCTTTCAGCAGCTGGTTAGCAACGGGATCTTTGAACGTGTTACAATG
AGCTGTGCAGGGGAAATAAAGCATCTTGACTAAATCTTGCTGTCTGGCGTACTGGCCAAAGTCGAACGCG
TTAATGTTGGCAGTGAGGACAAATTGGAATAATCTGAGGATGGATGCAGTGAATATATCTGCGGCAGAGG
AAGGTTCTCCTACGACATAGAGCGTGTTAGTATAATGGCACAGGCGACTAATGCTCATGGCAGACATCCA
CAGATAAATGGCGTAGATGGCTACCGGAGCATTGTAACCTTCGGCTTCTAGCATGGCTCGGAGATCTCTT
TGTGAGGACAGCTCGAAGCCTTGCAGATTGAAATTGATCGTTTGACTGAGCCCGTAGCTGCAGTATAATT
TGCGCGCTTCTTCCAGAAGCGCGGGGGCGACCGATTCGAATAGTTCAGCATCTTGGGGATACCGAGTGAG
CCAATCTTTGTAGGTAAAGATGTTGTTTCGCTGGAGATCGAATATTAGCCTGTGTGTGACTAAATCGTCG
TCGTCTTCTCCCGTGTGGCGGTTCCTGAGTCTCTTAACGCTATCCTTAAGTTTCCTGAAACGTTCCTGGG
GGAGAAAGTTTTTCGAGATCGGTTAGTTTGGGGTTTCTCTCTAACTGCTTTCTATGTGTTTCGCTAAATT
TGATGATAGATTTGGCTGTTTTCAGGAATCTCTCCTGAATGTTAACATTGAGAGGGATGATCGAGTACTG
CTGATCTATACTGCACCACCTAAAGGACTCGGATACTGGGTCCGGAGTGTACATGACCCAGCTGAACCGC
TGGTTCTGCTGCAGGAAGGAAAAGTAAGCTTTGAGAAGGACAACGAGGTCCTTCGAGATGTTGTGTGCGA
ACGCATAGAGGAACCTAGCGAACTGGAATTGGGGAATATGACAGGATAGGATGTGCATTTTCGCGTTCAC
TTTGAGGGTGGGAACGTTTCCTATCGCGGTGCGCGGTGCCATGTTGTGCAAGACTACGAAAATGTAGAAG
GCTGTACAGTGGGCAGAGCGAGCAAAGAGCTTAGAAGGAAGGGCGTGAAAGAGGACAGAGACGCTGGAGC
CTGAACAGAGCTTATCCATGCACTCGTCCATGATAATGGCGACGGGTCCCCGCTTGGAGACTTTCACGTA
AATGTTGTCTGGATGGTCGATGTTGAGATGTTCGGGTGCGGTGGCCTCCTCGTAAGTCATCTCCATAAAT
TCGGGACGGAACGTGCTTGTCTTAGGGGCGATGGTGCCGTCTTCCCTGCAGTCGAAATTGGCCTCGACCA
GCTGCAGGTTCCAGGACGTCTGTTCGATGGGTGGAATCATGTTCTTTTCCGGAGTGATGAAGATGACCGT
TTCGGGGATCGGGTCCAACATGTTGCACGAGATGAGCGCCCGCAGCAGATGCGACTTGCCGGATCCGGTG
GGTCCGTAGATGACCCCGATGATGGGCTGCTTGCCCATGTTGATGGACGGCAGCTGTCCGTGTTGGAGGT
AGCGACTGTCCATCTGTTCCTGGGCTTTAACTTCTTCGTGGGCTTCGAGAAACTTCTCATTAACGCCCCC
TAGGCTGTAGAACTCGTCGTAGGAGGGGAAGTGTTGCTCGCGGAAGAGCTGCGGTGCTAGGTCGACAGCT
CCGTCGTACCAGCTGGTGACGCGCTGGTAGAAGTCCCGCGAGGCTTCGTACTCTTCTTCCTCATACTCCC
AGGCTTTCCGCTTCCTGGGAGCTATCATCTGCGAAGAGTAGGTCGTGAACTTGCCCGCATTCCTCTTCGG
ATAGGAACGCGTAGGGTTCCCATCGTAGGGGTGCGAGGGGGTCTTCGTGCCCGACGATTGGGACGGGTCG
TACGTCTCCTGTCGTGCGGGGATTTGGGTGCTCATTGTCGTAGGGGTACAGGTAGTCCCCGTGCTCGTAT
AGGGTGAGGTCCTTCCACGGACGCAGCACTCGCGTGAGCTGCTCGTTGTGAATGGTGAAAGGGTCGTAGC
GACTGACCTTGTTCAGAAGCGTGGTTTTAAAGATGGTTCTCCGCGTGTGTAGCTCTGGGATGTTGCTCTG
CGCTCCGAATTGCACGTCCTCGTGTCTACGCCAACAGCGCAGCAGCGTGTCGTAGATGAGTTCGGACTGC
CTGTGTCCCTTCGATCTGATTTTCCCGGGTCCTACCGTGCGGCACTGTTCGTTGACGCAGATTGAGTTTT
TCAGTCCGTACAGTTTTGGCGCTAGGAAGATGGTTTCCGAGCTGTACGTGTCACTTCCGCAGGCTTTGCA
CTTGATGTCGCAATCGCAGGCCCAGTAGAGGCCGGGATTTTCTGGATCGAAAGTCAGTCGAGTGGATTCT
GTTTTGATTCGGTGCGCGCCGCGGCTTTTCATGCGATGATAGCCTGTTTCTGTGACGAACAGGCTGTCGG
TATCGCCATAGAGGCTGCGCGGCTCCTCCCTTCGCAGGATGTGCACTCCTCTGTCCGGTCCGTACAGGAT
GTCACACCACTCGCTGAAGAAGGCCCTCGACCAGCCCAGCACGAAGCAGGCGATTTGCGTGGCGTATCTT
TTGTTTGCCACCTGCTTGTCCAGGCTTTCCAGATGGAGCACGGTTAGGGCTTCTGGTGTGGCTTCGAGGA
GACGCATAGGTTTAAACCGGGTCTCGTTAGCGCGAGCGTAGTGGGCGGAGCTTAGCTCCCCCTCGGGTAT
ATAAGGGCCCGTCGCGAGGGTCGCCTCGACTTCCAGGTCTACGGCGACGAGAGGATCGTCTTCGGTAAGT
GCGTTTTTCGGCTTACGGGCACTCTCGCGATCGCTGTCGTCTCCTTCTTCTTCCCCATCCTCTTCTGCTT
CGGGCTCTTCCTGTTCGGGGTCGTCTGCGTAGCGGAACTGTTGTCGTAGACTCTCCTCACTGAAGGGGTT
AGGCGCGTTTTCGAGGGTGACTTCCGTTCCGTTGAACGAGTCGTCATTGAGCAGCGTGACGTGTTTGACG
ATTTCAGTGCCTTCGTAGATGTTTTTCTTATCTGCTTCCGAGAGGTCCTGTTCAAAGATGATGCGCGTGG
TGTCCATGTTGGTGGCAAACGCACCGTACAGCGCGTTGCTCAGCATTTTGGAGATGGATCGAATCACTTC
GTTCTTCTCGCGATCGGCTTTTTCTTTGGCGAGGATGTTTTTCGTGACGTAGTCGGCACATAGCGTTTTC
CATTCCGGAAAAACAATGTTCATCTCGTCATGGAGGACCTGGACTCGCCATCCCCGGTTGTGCAGCGTGA
GGATATCTATGACGGTGACCACCTCGTCGTAGAGAGCCTCGTTGGTCCAGACCAGTCTGCCTCCCCTCCG
GGAGCAGATGGGAGGGAGTGGGTCTAACATTTCGGGCGGGGGAGGGTAGGCTTCTATTTTCAGGATGGAA
GGCTTGATACGCGCATCGAAGTAGCTCAGATGCGATTCGTTGGTCAGCAGCCGGTTGAGCTCCTCCACGT
GCTGCGCGGTAAATTTTGGATCTAGGGGCATTCCGTGGGGCATGGGGTGGGTGAGGGCGGAAGCGTACAT
GCCGCAGATGTCAAAGACGTAGACGGGTTTCAGGTAAGGTCCGAGCACGTTGGGGTAGCATCGTCCGCCG
CGGAGCGCTTGGCGTATGTATTTGAACATGGGGCGGTGGGGGGCGTAGACTTCGGCCACGTAGTCGGGGG
AGGGTTGTTTTTTCTTTTTGGTTCGACCTTTCTTTTTGGGGGGTTCGGGGACGGAGGGAGGGCATGTCGC
ACGCTGTTCGCGGACGTAATTGGAAAAGGTAAGTTGCTTCCAAAAGGCATGAGTGTTGCTGGGGATGGTG
GGCCGCACGAAGATGTTAAAATGGCCTTCCATCCCTAGTTCTCGTTGGAAATAGGCGTCGTAGCTGTCGT
GTAACGTGTGGGCCAGCTTTTGGGTGACGCGGACGTCCTGCATGCAGTATTCGAGGCACGCTTGGACGAT
GTCGTACTGCTGGCCCGGGTGTTCTTTCTGCCATAGATTCTTCTGTTCAGCGATGACGGATGGGTCTTCC
CAGTACCTTTCGACAGGAAAGCCGTCGGCGTCCGCGTGAAAGCGCCCCGTGGAAATGAATTCGTTGATGG
CCTCGTATGGGCAATGTCCCTTGCAGAGGTCTAGCGCGTAGGCTGCCGCGGCTTTGGAGAGTTTGGCCCC
GCTGGTGAGCTGTAGAGTGTCTCGCACCATGAACCGCACAAATACCGAGCGCGCATCCTGATGGGACACG
ATCCCGCGAGACCAGCGTTCTACGCGGGAGGCGTCTTTCTTCACGTAGTTGGGGTTTGGCATGCGGAAAA
TGATATCATTGAACAGAAGGCGACCGACGCGAGGCATGAAGGATCGATCACATTTGCACGCTTCCGGGAA
TAGGTCCCTGCGCTCGACGAGTTCCGTGGCTAAGAGGAGTTCATCGAACTTACATATGTTGTGACCTAGC
ACTACGATGTCTACGGAATAAAAGTTATCCGGGAGGGAGAGGGGGGAGGTGGGTTTCTCGAAGAGCTCGT
ACGGTATTTTGTGAACGGAGCCGTACTTTCCGTCCTTGACTAGCTGGTCGCAATAATCTCGGTTGGCAGC
CGCGTAGCGGTCGACTAGATTTTGGGCAAATTCTATTTGCAGACGGGACCTGAAGTTGCGAAACCTTCTG
GCAACCTCGCCCGGATGGCTGTCTAGCCAATAGAAGCCTTCGTCGAGGGCTTTGAGACGGTCGTCCTGCC
GTGCTAAGCGTTCGGCGCGGGAGACCAGCTGGGGGTCTCCGCTGAGCATGAAGCACAACATAAACGGATG
CATGCGCTTGCCTTTCTTTTCGAACACGGTATACGTCTCGATATCGTAGGTGATGTACAACTGACGTATG
TGGGGGTGTTGGGCTGGACAGGAGAAGTGGACGTGCTGCCACAAATCGCTGCCCGATCCCTGGACGGCGT
GGTAGTAGAAGGCAGAGCGGCGTTCGTTGCACGAGTGTCGTCTGACCCAGTGTCGGCCGCAGGTGGGACA
CTGTTGAACCGGAGTGCGGCTGGTGATCCAGACCCATTCTCCGGTGACGTTTTTGGCGATGAGCATGGGG
GGAAGGGCGGGATGTTCGGAGATGTGCACGGTCCGCAGGCGCGCTGTTTTGCCTTTAAAGTTGATGACGG
TGACCTGGGCGGGCTTAAAGTCGGGGAGGGAGCGTTCGGGGTCTCGGGCATAGTGCAGATAGTCTATTCG
GTCGTAGCCTCTGGCTCTCTTAGACAGCAGGAAGCGGTGGGTGCGTAGGAATTTCTTGAGACCTATGGGG
AATACAGTGGGTTGGAAGCGGAAGGGCTGTTCCTCGATGTAATAGACGTTTGTGCGTAGGGGGTTGCCCC
GGAAGCTCTTGAAGTACTTTCGGGTCTCTTCCAGCCGTTTAGCGGAAATGGTTCGGATGACGTGCGAATC
GGGGCCCAGCACGCTGTCCGTGAGGGGAGGCCCCGCGTCTGCTTCCATTTACAGAGGCTGACCTCGTCGC
GCCGCCGCTTCGATGTCTTCGCGGCGGTGGCGGAGCACGCGTCTGAGGTTGGCTTTGATCTCCTCGTTGG
TAGCGATGGCTACGATGCCTTTAAATTTGATGCGGAAACTGATGTCGATGCTATCGATCAGCTCTTCGCT
GAGGTTGAGCTGCTTCAGCACTTCTTCGATGTCACCGGAGCGGTCTCTGTATTGAATATCAGAGAGAAAC
AGTTGTTGGTCCGCATCGTCCATGCCTTCGAATTGACCCGTCCGTTCGACCATCATAAGAAAATCGCGTA
ATATACGTTCCCACAGGGTTTCGAATATGGTGGCGGGGTTGGATTGCTCGCTCCATATGCGTTTAAAAAC
CTGCTGCGCGTTGACGTCCCATCCCACGACGAGTACTTGTAAGGTCAGGACGTCGACGTACCGGCGGAAC
TCGCGGTTGGCGATGAAGTGGCTGTACAGGTAGTAGAGTGTAGAGGCGATATGTTCGGCTAAGAAGAAGT
ACAGCACCCACTTGCGCAGGAACGACTCTCCCATGAGTCCCGCGTCGCGCGCGGTCAGGAGCATGCGGTA
GAAGTCGTTGGCAAACCTGAAGAGTTCGTGTCTCCGGGCGGCCCCGCTGAGCTCGTCTTGCAGTGCCCCG
ATGGCTTCGAGCGCTGTGCGAATCACCTCGTCTAACAGCTCTTCTTCCTCCTCTTCTGGTTCTTCTACTT
CCATGGCGGCTTCTTCTATTTCTTCGGGAGGGGGCGCGGGGGAGGGGGGTCTCCGTCGCCGCCGCGTGAC
GCGGGGCAGGCGGTCTACGAAGGCCCGCACGGCACGGGGCCTAATGCGGCGCGCTTCGGACGCGGTGATG
GCTCTGCCGTGGCGGTCTCTAGGGCGCAGGCCGGTGCGGTCGGTTACCCGCCGGCTGCAGAGGGTGATGG
CGCCTCCTGACAGACCCGTTCCTGCTAAGGAAACGGCGTCGCTCGCTAGAGTGCTCATGAAACATCTCGC
CATTGTTTCCGTAGGTTCCTCTACGTCCCGTCTTCCTCGAAACTTGCGCTCGGCATCCCGCACCAGTTGC
TGGGTGTCTAGCTCCGCGAAGGCTTCCGCGAAGTAGGAGAGCCAGTTTGGTTCAAGGAACACATCGGATC
CAGGTAAGAACCGATATCTTTCTTCCGTTTGAAATAGATCATATGCGTAGCAGAATAGATAGTGGCAGAG
GGCGACTCTTAGTTGGCGGATGGCGGCGAGCAGTTCGGCGTCGGCGGCAGAGGCCGTTCGCATGAGGACG
CCTTCTTGCAAGCCACCCGCTCCGTTGCCCGACAGTAGGCTGTGGTGTTCGGCGTCGAGCTGCGGCAACA
CTTGTCCGTGACGGCCTACGTCGATTCCCCTACCTCGCAGATGCGCCCGGCCCATGTCCGCGGCCACGCG
GTCCATGAGTACGGCGTTGTGCATCTGCGTGAACGTACCGTGAAAGTTGTCGAGATCGAGAAATCGCATG
TACTGCCCTACATTGACGGCGTAGGAGCAGTCGGTCAGACAGGTCCAAAAGAGGCGTCTGGGTCTTTGGG
GTGGGCTATCGTAACCTATCTGCATAAAAACGCGGTTGTCGAAAAGGTAATCGTTGAGCGCGCGGTGCAT
AGCTTGGTACCCGAGGAGAAGGTGCGGCGGCGGCAATCCGTTGTAGGGCGGCGCGGCGACGTTCGGCGAT
CGCGGCGCGAGGTCTCGGAGTTGCATTAAACGGTAGTCGTACACCCGGCTGACGAGAAACACGCTTCGGG
GGTGGACCAGGGCTGGTTCTTCCCGAACGAGGACATAGTCAGCGGTGATGACGGGTTCGCAGAAGCGGAC
GGTGGCTAGACTCTGTCCGGTGAGATCCGCGAAGACTCTGTAAGCCTGAAATTGAGCCCCTGACGTTTTT
AGACCGCTCGTAATGCACCCCGTCCTGCAAAGCGTTCGAAACGCGAGCGTGAGCGCCGGAGGACCCCATC
AACAGCAACCGCAGCAGCAACAGCACGGTGTGTCGTCGGTCCGTCGTCCTCCTTCACCACCCCGATATCC
CGCACAACATGCCTATCCCGGCGCGGGCGCGACACCCACGGCAGGACGAGGCGATTTCGACGGCGCGCTT
GATCCCGATGAAGGACCGGTCGCGTGCGGGCTGGCGGCCGGGGCCGGTGTGGACGAAGTTAGAATGAGGG
AGCGGGACGCCGCGCGGCGAGCCACGGTGCCCGAGATCAATCTTTTTAAGGCTCGACGTGACGTGGTGCC
CAATGGGGATTACGAGAGGGATCTGATGTACCACTCGGGACAGGCAATCGATATCGATCGGCAACGTGTG
CTCACTCCGGAAGACTTTAAGGGGTCCGAGCCGGCTTTCACGCCGGCTGTCAACCATATGCGCGCGGCCG
AGTTGAAGAGGGCGGCTGAGCAGACGGCATTTGGGGAGGAATTGAGGAATACCTGCCATCAGACCCGCAT
CCGCACGGCTCTGTTAAGGCCCGAGATCGGAGCGGGAATCTACTATCTGTACGATTTCGTCCAGACTTAT
CTGGAGCATCCGGACGGTCGGGTGAAGCTCAATCCTCAGCTGGTGTTGGTGGCTCAGCACGCGGGCAATA
CTATGCTGGCGCAGCGCTTGTGGGCCATCGCAGAGGAGAAGAATGCGTGGTTGAGAGATTTGATAGAGAT
GGCGTACATGATCGTGAACGATCCGTACCTCAATACGGAGCAGCAGCTGTCGGCCATCTGCACGACGGTG
GTCGAGTTGAGCATGAAATACGCCAAGTTGGCCGCCAAGAACGGTTACCCGTCCATGGCGCAGATGGCTA
AGGCGCAGGAATTTTTCTACCGGGTCATGCAAGCGGTGCTCGATTTAGGTGTCCAAGTGGGGGTGTATAA
CAACCGACCAGCTCGGTACCGTCAGAAGCGCATGAGCGAGATTCCGCAGATGACTGACGCCGAGTACATG
TTCGGTTTGACCCAGGCGCTGGAGAGCAGGCCTCCGCAGGGCGAATCTTTTGCCGACGAGGGGCCGTCAG
AATCGGACGACGAGGATGACTTCATCTGATACGTTTCTGGCTCTTGCGCCCTACGGGCGTCAGGAGGTGG
CGGACGCCCTCAGTTCGCTCCCAGATGGCAAGGACGCGCGGTCGCTACGTCATGCACCCTACGCAAATCG
CCTCATCAAACTCCAGAGCGCCATGGTGCCTCCAAAAGTGGACGGTACTTCCGAGCGGGTGGCCGAAATC
GTGAAAGGGCTAGCCGAGCAAGGCGCCATCTACCCCGATCAGATGGGCGCGATCCACTCAGATTTGCTTA
ATCGAGCTTACACGTGGAATTCCATGGGGGTGCAGGAGAGCATCCAGGCGCTGGTCAACGACGTGATCCA
CGGACAGAACCGGACATTGCAAGACGAGCTTGCGCGGACGAAAGAAATAGCGAATGCTTCGCTCTTGACC
CAATTTTTCGATTCCCTGTACAAAACGGTGGATCGTGGGCAGCGAAATTTTGAGGGCTTTAAGAAACTTT
TGCGTCTTTTCGTGAATAACGTGCCGAATGCCGAAGTGTACGGGTCTTCGGGGTCCTTTAGCGTGCAGAT
AAATCTTGGCGGATCTAGTCAAAACATCAATCTGACCAATGCGTTTGAGAATTTGAAGCCGATATGGGGC
GCACGGTGGGACGCGGTGAATAATCCTCGCATCGGGGCGCTTCTGACACCCAACACTCGAGCGTTGTTGT
TTTTCGTGAGCTCTTTTTACGACTACGGGGCTATGGAGCCCGGTAGTTACTTGGACAATATCATGAGGCT
GTACAAGGAGGCTATCAGAGCCGATGTGGACGCGGAGGGTGATGCCATTATGGAGCTCGGGGAGGCGGGC
GCAAATCTCAACTTGCGGTTCAACGATTACAAGGACACACTAAACTACCTCCTGCAAAATCGAGAGGTTG
TACCCGACACGGCTCCGCTGGAGCTGAGCGCGGAGCAGGAAATGCTCTTGAAGTACCTGATGAGGCAACT
ACGACAGGCTCTTAAGGACGGGGTCCCGGCGGACATTTCTATCAGTACCATGACTCAGTACCTAGATCCT
AGGCTGTATCAGACGAACAAGGTGTTCGTGGAGAAATTGCAAAACTACCTGTTGGCGGCTCAGGCGCGCA
ATCCTGTGTATTACCGACTGTTGGTGCTGGACCCCAACTGGCGGCCTCCGGCAGGCCTATATACGGGTAA
TTACGTGATACCCGACCGCTACGACTTTGAGGACGTGCAGAGCGAGCTTGAATACGCGGGTCCCTCCAGA
GACGAGTATTTCGATGATTCTTTGTTCGCACCAGGTCCTCAGCGCCGCTTAAATTCGGCCGAGGAGGCTC
AATTGGAGCGTGACATCGAATCTTTGACCGGCCACATTGACGAAGAGCTGGGCGTCCAATCTCAGGCTGG
CTGGCTCGCCGATCACCGCCTGCCTGTCGCGTTCGATGGCGCTCTCAGCCTTACCGAACGCAACGCCTAC
AACACGCCGTTGCCCCCCGATTCCCACATGCGTAGCCGTTCTAGCTCCGTCGCTAGCGATCTTGGGCTAT
TGAACCTATCTGGGACGGGGGGACCGGGCTTTTTCGCTAGTCTGCGGCCTTCCATCGGCAGCCGTCAACC
GACCGGCACGGCCGTGGGCCTCCGCCCGACGACACCGTACAGCGGTTCGGGGTGTATGAGGGGCACCGGT
CTGGCGCGCAAAGTTTTAAACCCGGCCGCGTCGCGCCGGGGGCGCAAGCTACGGTTCTACTGAACCCTAG
ACTCTGACGAAGAAACTTAAAAACGCTTACCGCCATTTCGCCGCGCAGAAGTTGGAAGGATGTACCGGAG
CCTGCGACCGCCGACGTCGATTCCTCCTCCGCCTCCCTCTGGTCCCTCGCCTTATCCGGCGATGATCAAC
GGATATCCCCCGGATGTGCCGGTGGGGTCACCTGCCAACGGAGATGCGGAGCTGTTCGTGCCGCTCCAGA
GGGTGATGCCGCCTACGGGTGGACGGAACAGCATTAGATACCGGAATTATGCGCCGTGCCAAAACACCAC
CAAGTTTTTTTACGTAGACAATAAGCTGAGCGACTTAGACACCTACAACGAGGACGCGAATCACAGCAAT
TTTAGGACGACAGTCATTCATAATCAGGACTTAGACCCGTCAACGGCCGCCACAGAGACCATTCAGCTCG
ACAATAGGTCGTGTTGGGGCGGAGAGCTAAAAACAGCGGTGAAAACCAATTGCCCGAACATCAGCTCGTT
TTTCCAAAGTGATACAGTGCGCGTGCGTCTGATGAGCAAGCGCGATCCGGGGGGTACCGACCCAGACGCG
GGGGTGAACAACCCACCCGGGGCCGAGTACAAGTGGTATGATCTGAGGATTCCCGAAGGTAACTACGCGT
TGAACGAGATCATTGACCTTTTGAACGAAGGCATCGTCCAGCTGTACCTGCAGGAGGGGCGCCAAAACAA
TGTGCTCAAGAGCGATATCGGGGTTAAGTTCGATACGCGGTATCTGGATTTGCTGAAGGACCCCGTGACG
GGGCTGGTGACGCCCGGCACCTACGTTTACAAAGGATACCATCCCGACATCATCCTCCTCCCCGGCTGCG
CGGTCGACTTTACGTTCAGCAGGCTTAGTCTTCTGCTCGGTATCGCGAAGCGCGAGCCCTACTCGAAGGG
GTTTACGATTACTTACGAAGATCTTCAAGGAGGGAACGTGCCCGCGCTGCTCGATCTGTCCTCCGTGCAG
GTAGACGATCAAGACGAGGACGTGATCGTGGTGGCAGACGCAAGGCCTCTTTTAAAAGACTCCAAGGGCG
TTTCCTATAACGTGATCACCACTGGCGTGACTCAACCGCAAACCGCTTATCGGTCTTGGCTCCTTGCCTA
CCACACCCTGGACTCCCCCGCGCGCAATAAAACGTTATTGACTGTTCCGGATATGGCAGGTGGTATCGGC
GCTATGTACACATCGATGCCGGACACGTTTACCGCACCTGCCGGATTTAAGGAAGACAATACGACCAACC
TTTGTCCTGTGGTGGCCATGAACCTGTTCCCGAGTTTCAATAAGGTATTTTACCAGGGCGCGTCCGCCTA
CGTGCAGCGCTTAGAAAATGCCACGCAATCCGCAACGGCCGCTTTCAACCGGTTTCCCGAAAACGAAATT
CTAAAGCAGGCCCCACCCATGAATGTTTCCTCGGTGTGTGATAACCAACCCGCCGTCGTTCAGCAGGGTG
TGCTACCGCTGAAGAATTCTCTGTCTGGCCTACAGCGCGTGTTGATCACCGACGACCGGCGCCGTCCCAT
TCCATACGTGTACAAAACCATCGCCACCGTGCAACCGCGCGTTTTGAGCAGTTCAACCCTGCAGTGAGGA
GCGGAAGGATTTTCAAACATGTCCATTCTGATTTCACCCAGTGATAACAGAGGTTGGGGAGCAAACATGC
GTTACCGCCGTAGAGCATCCATGCGCGGGGTCGGTCGCCGTCGTCTCACCCTGAGGCAGCTATTGGGTCT
GGGGTCTCGCCGGAGACGGCGATCCAGGCCCACGACCGTCAGTAACCGTTTGGTGGTTGTGAGCACCCGC
CGCCGCTCTTCCCGAAGACGCCGATGAAGCAAGCAGCTGATGAGATGTTCTTCTGACTATGTGTGCCGTC
GCTATACACAGGAGCGACGTCGTTATGCCTTCCGTTCTTTTGACCGGCGGGCGGACCGCCAAGGGCAAGA
AGAGAGCCTCTCGTCGTCGAGTGAAAGTGCCTAAGTTGCCTAAGGGAGCGCGCCGAAAGCGTGCGTCGGT
GACGCCGGTCCCTACCGTAGCTACCGCGACCGCTTCCGAGCGCGCGGCTCTGACGAACCTAGCCAGACGG
CTCCAGCGCGGCGACTACGCCGCTTGGAGGCCCGCCGACTACACGTCACCGGCCGTTTCCGAGGCGGCTC
GCGCAGCCGCCTCGTCCGGCACCCCCGCGACCGCGAGGGATCTCGCGACGGGAACCCTCGCTCGCGCCGT
GCCCATGACGGGTACCGGCGGAAGGCGGCGCAAGCGCACCGCTACCCGCCGCCGATCTCTGAAGGGGGGC
TTCCTGCCGGCTCTGATACCTATCATTGCGGCCGCTATCGGCGCCATTCCGGGCATCGCAGGCACCGCCG
TGGGCATCGCCAATCTGAAGGAGCAGCAGAGACAGTTTAATAAGATTTACGGGGACAAAAAGTGATGCTG
ACTGGACGCACTAAAAGGCCCTTTCAATAAACGCGTTTTTGTAGAACCGGCTCGCGTCATGGACTACGCT
GCGCTATCACCGCATCTCGGTGGGTGGGCCCTGAGAGACCACCACATCGGCGACTCTAGCTTGAGAGGGG
GAGCCATCAACTGGGGCAACCTCGGGTCGCGCATAACCAGCGCGCTGAACTCCACCGGTCGCTGGCTGTA
TAACACCGGCAACCGCTTCGTGCATTCGAACACTTTCAACCAGATTAAACAAGGCATACAAGACAGCGGG
GTCATACGCAACGTGGCTAATTTGGCCGGAGAGACGCTGGGGGCCCTGACCGACATCGGCCGGTTGAAGT
TGCAACAGGATCTGGAGAAGCTGCGGCGTAAAGCTTTGGGGGAGGAAGGTCCAGCGACCCAGGCCGAACT
GCAGGCTCTCATTCAGGCCCTGCAGGCGCAAGTGGCTGCCGGAGAGCCGCCCGCCGCACCCGCGGCGCCG
GCGCCGGCCCCGCCGCTCGTGCCCACCACTCGTCCTATTCCCGAAATGGTAACGGAGGTTAAGCCTCCCG
TTACGTCTTCGGCGCCAGCCGTCCCCGTAGACGTGCCGACCACGCTGGAAATGCGACCTCCGCCGCCCAA
GCGCAGGCGCAAGAGGGCACGACCGGGACAATGGAGGGCACGCTTGGACAGCCTCTCGGGTACCGGAGTA
GCGACCGCCACTAGACGTATGTGTTACTAAAATTCCGTCGTTCCGCTATGTCTAATTTTTAGCTCACCGG
TTGTCTCCCGAAGGCGTCATGACTGCGCTTACTCCCGACCTGACCACGGCGACGCCGCGGCTGCAGTACT
TTCATATCGCGGGCCCTGGCACCCGAGAGTATCTATCCGAGGATCTCCAGCAGTTTATCTCGGCCACGGG
GAGCTACTTTGACTTGAAAAACAAATTCAGGCAGACGGTCGTAGCTCCCACTCGCAATGTCACCACCGAA
AAGGCACAACGTCTGCAGATCAGATTCTACCCGATCCAGACGGATGACACGCCAAACAGCTATCGCGTGC
GCTACAGCGTCAACGTTGGGGACAGCTGGGTGTTGGACATGGGGGCGACCTACTTCGACATAAAGGGTGT
GCTGGACCGCGGACCTTCCTTCAAGCCGTACGGCGGAACGGCTTATAATCCCCTTGCGCCAAGAGAAGCT
ATTTTCAACACCTGGGTGGAGAGCACTGGTCCTCAGACCAATGTGGTGGGACAGATGACCAACGTGTACA
CAAATCAGACCAGGAACGACAAGACGGCCACGCTTCAGCAGGTCAATAGCATCTCCGGGGTGGTTCCCAA
CGTCAACCTGGGACCCGGCCTCAGTCAACTAGCATCCCGGGCCGACGTGGATAATATTGGCGTGGTGGGA
CGTTTCGCCAAGGTAGACTCAGCGGGCGTGAAGCAGGCGTACGGAGCCTATGTCAAGCCCGTGAAGGACG
ACGGGTCTCAGTCTCTGAACCAGACCGCGTACTGGCTGATGGACAACGGAGGTACCAACTATCTGGGTGC
CCTGGCTGTGGAAGACTACACTCAGACCCTGAGTTACCCCGATACCGTGCTCGTGACCCCTCCCACCGCT
TACCAGCAAGTCAACTCCGGCACCATGCGGGCATGCAGGCCCAACTACATCGGCTTCCGAGACAACTTTA
TCAACCTACTGTACCACGACTCGGGCGTCTGCAGCGGAACGCTCAACTCCGAGCGCTCCGGCATGAACGT
GGTCGTGGAACTCCAGGACAGAAACACAGAACTGAGTTACCAGTACATGCTGGCGGACATGATGTCCCGT
CATCACTACTTCGCGCTGTGGAACCAGGCCGTCGACCAGTACGACCACGACGTGCGCGTCTTCAACAACG
ACGGCTACGAAGAGGGCGTGCCTACTTACGCCTTCCTGCCCGACGGGCACGGGGCGGGCGAAGACAACGG
TCCCGACCTCAGCAATGTCAAAATTTACACCAACGGACAGCAAGATAAGGGCAACGTGGTGGCCGGAACG
GTTTCCACACAGCTCAATTTCGGTACCATTCCCTCCTACGAGATCGACATTGCTGCTGCCACCAGGCGCA
ACTTCATCATGAGCAACATTGCCGACTACCTGCCCGACAAATACAAGTTTAGCATTCGCGGTTTCGACCC
TGTTACAGACAACATCGACCCTACCACCTACTTTTACATGAATCGCAGGGTTCCCTTGACCAACGTGGTA
GACCTGTTTACCAACATTGGTGCCAGATGGTCCGTGGACCAGATGGACAACGTCAATCCCTTCAACCACC
ACCGTAACTGGGGGTTGAAGTACAGGTCTCAGCTGCTCGGAAACAGCAGATACTGCCGTTTCCATATTCA
GGTGCCGCAGAAATACTTTGCCATCAAGAATCTGCTCCTGTTGCCCGGCACCTACACTTACGAGTGGGTC
CTCAGAAAGGATCCCAACATGATTCTGCAGTCCAGCCTTGGCAACGACTTGCGCGCGGACGGCGCGCAGA
TCGTGTATACCGAGGTGAACCTTATGGCCAATTTCATGCCCATGGACCACAATACCAGCAACCAGCTGGA
GCTGATGTTGCGCAACGCTACCAACGACCAGACCTTCGCGGACTACTTGGGCGCCAAGAACGCTCTCTAC
AACGTTCCGGCCGGCTCCACGCTGCTGACCATCAATATTCCCGCCAGAACATGGGAGGGTATGCGGGGCT
GGTCTTTTACCCGCCTCAAGGCCTCGGAGACGCCCCAGCTGGGCGCTCAGTACGACGTCGGTTTCAAGTA
TTCAGGCTCCATTCCCTATTCGGATGGCACCTTTTACCTGTCCCACACGTTCCGCAGTATGAGCGTGTTG
TTTGATACCTCTATCAACTGGCCTGGCAACGACCGTCTGCTCACACCTAACCTGTTCGAGATCAAGAGGC
CAGTGGCCACCGACAGCGAAGGCTTCACTATGTCGCAGTGCGACATGACCAAGGACTGGTTCCTCGTGCA
GATGGCCACCAACTACAACTACGTGTACAACGGTTATAGGTTCTGGCCTGACAGACACTACTTCCACTAT
GACTTCCTACGCAACTTCGACCCCATGTCGCGTCAGGGCCCCAACTTCCTGGACACCACGCTGTACGACC
TGGTGTCCAGCACTCCCGTTGTTAACGACACCGGCTCACAGCCGTCTCAGGACAACGTGCGTAACAACTC
CGGCTTTATCGCCCCTCGCAGCTGGCCCGTATGGACCGCACAGCAGGGCGAAGCCTGGCCCGCTAACTGG
CCGTACCCGCTGATCGGGAACGACGCCATCAGTTCCAACCAAACCGTCAACTACAAGAAGTTCCTGTGCG
ATAACTACCTCTGGACCGTGCCGTTCAGCTCGGACTTTATGTATATGGGAGAGCTGACCGATCTGGGTCA
GAACCCCATGTACACAAACAACTCCCATAGCATGGTTATCAACTTTGAGTTGGACCCCATGGATGAGAAT
ACTTACGTGTACATGCTGTACGGGGTATTTGATACCGTTCGCGTGAACCAGCCCGAGCGTAACGTGCTAG
CCATGGCTTACTTCCGTACGCCTTTCGCCACAGGCAACGCTGTGTAAAAAAAAGACGGCTGGGATGTCGG
GAACCACCGAGACCCAACTGCGGGACCTGCTGTCCTCTATGCACCTGCGGCACCGCTTCCTGGGTGTTTT
TGACAAAAGTTTCCCAGGATTTCTCGATCCGCACGTGCCCGCCTCAGCTATCGTCAACACCGGCTCCCGG
GCCTCCGGAGGTATGCACTGGATCGGGTTCGCGTTCGACCCTGCCGCAGGACGATGTTACATGTTTGACC
CTTTCGGGTGGTCAGACCAGAAGCTGTGGGAGTTATACAGAGTCAAGTACAACGCTTTCATGCGTCGGAC
CGGCTTACGGCAGCCCGATCGCTGTTTTACCCTGGTCCGTTCTACCGAGGCCGTGCAGTGCCCCTGCTCG
GCCGCTTGTGGGCTTTTTAGTGCCCTTTTTATCGTCTCTTTCGACCGTTACCGGTCGAAGCCCATGGATG
GCAATCCCGTGATCGACACCGTAGTCGGTGTGAAGCACGAAAATATGAATTCTCCGCCCTACCGCGACAT
CCTGCACCGTAACCAAGAGCGCACCTATTACTGGTGGACCAAGAATAGCGCCTATTTTCGTGCTCATCAA
GAGGAACTCCGACGAGAAACGGCCCTTAACGCCCTACCTGAAAATCACGTTTAATGACCGACTGTAAATA
AAGAACGACGCACACACGTACTGTACATATTTGTGAATAGAGCAACCGTTTATTAGATAAACGTCAATAA
ATGCCGACCGATAGACCGACAAGGCTCTTCACTGGCTTTATTTAAAGAAACAAAAGGATTAAGCGAACGG
GTCGTCACTGGCGATGGGCGAGACTGGCGCCAACACCTCCGTTTTAAAGGCGTACGACTCGTTCCAACGG
AACTCAGGCACATGTGTGGGCTCTGAAGAACCCATCACGGCAGTAAACAGCTCCGTAGCAAAGACGTACG
CGTAGCGCAGATCCATGGCCGACAGACGCCAGGCGCAGGTTTTTTCGGTCTTCTTCAGACCGCGGCCTGC
TCCGCCCGACGCCGCCTGCGGGTTGCAGCAGGTGAACACCATGGTATGCGGGTTTTTCTTGTGAGCCTTC
ATATCGGGCCTGCTCTCGACCATGTCGCGAGTAATGTCGTCTGTGCCGTTGAGCTTATAAGGAGTCATTT
TACAGAACTGTCTCCCTGAAATGGCTCGATCGGAGGCGTAGTTGCAGTTGCAATTGGTTGAGATGAGGAC
ACATTCCTCTGCCCGGCGCTTGTCCGCGTTGGGGTAAAGCGCCTTCGTCCAGTCTATGTCGTGACGCATC
GCGCTGACCGCCTTGGCGGCGTCGGAAAAGACCATGGCGCAACTGCCGTGCGCGTGGGGATGAGGGAAGC
CGCTGTGCTCCTGATCCTTGTAGCACACCGCGTTCGCGTCGAACCTGAGCACCACCACCTGTCGTCCAAA
CCGGTTCTTCTCGATTACGCCGTTCTGTTCGGCCAGAGCCCTCTTTCCCGCCTCGCTAGACGGGTTCAAC
TCCACGGTACGAGGTTTCGTCACCATGTCCACACCGTGCATGCATTTCGGGAAGGGCTCCTGGAGCGCTG
GGAACCAGCCATGGCGCCAAACGTGCGCCCCTCCGGGCACGAACTTGGGCTCCAGACCCGCGCGGCTGTA
GATAACGGCTGCCAGGAACCGCCCTACCTGAGCGTTGAAAGAGTCGTAGCTAGAAAAGGTCAGGCGAAAT
TCGGGATGCTTTTTGCGAACGTATGTACCCCCCATTTTGGTCCAAATGGAGTCGTCGGGGCGCACGCTGG
CTCCCTGCCACTGTAGGTCGAGAGCTTCGCAGATGCTGGCGACGGTGGCCATGGCGCGTTGCGCGCCGTA
GACCACGGGGTCTGACAGAGGGGCCTCCGGGGATTCCTCGTCGCTGGCGTTTTCTTCGTCATCGACAACG
GTTTCCCGCCGGCGGGTAACTCGCCTTACGGGGGATGGGGACTCCTCGCGGCGGCTGACCTTCTTGCGAG
TCGCGCCTCGGCCCGGGGCGACCACTTCCACTTCTTCCTCCTCCTCTTCCATCATGACTTCTGCCGTTCT
CTTGACAGGCTTGGTGCTGCGAAAGCCATGAGCTCTTTTCGGGGTTCTTTCCATGACTTCTGCTTCGGTG
ACGGGATCTCGCGTTTCAAAAAGTTCTTGCTCTCCCTCCTCTTCAGAGTCAGGGACTACTGCCGGAGAGG
GTGGAAGCGTCTTTTGAAGCTTCCTGGGACCTATAGGGTAAAGTTAACGCCCATCGTCAGCGAGACCACG
CCTCGCTGGCCGATGGGATCACGAGACACGATAAAAGACCGCGACCAAAACACTCTTGGGGCTAGTATCC
CTACCCGGGTGCGAGCGTGGCAGATCTTCGCTCTTCTGCTTCTCCAGTGGATTCTCGGGGTCTTTCGGCC
CCGTCGGTCTCTGGGGTGGGAGAGGCCTGCTCCTCCCTCTGTTTGACTTGATTACCGTCGACGGCCCGGG
CTCTTCGAGGTCCACGAAGTCCGCCACGTCTTCGTCGCTGCTGATCGTCTCTGGGTGAAGCGTTTCTGCC
ATCGTGGCTGTCATCGAAAATGGCAGACAAGATTACCCGAGAGGAAAAAACCATAGCGACGCTGGACCTC
GTGTTACGCGTGGTCGTCGATGCTGGTAACTGGGACGTGTTCTCGAAACGTTTGGTTCGCTACACACGCG
AACAGTACGGAATCGAGCTGCCCGAAGATATCGGGGACTTACCGGACACATCTGAGGTCTCGAAAGTGCT
GTTGAGTCATTTGGGGGAAGACAAGGCGGTACTGTCCGCGTACCGAATCGCGGAACTGACGCAACCTTCC
GAAATGGACCGCGCTAAGGTCACAGAGGGAGGCCTGGCCGTACTTAACGCGAGTCGCGATGAAAGCGAAG
CTCAGAACCCCTCGAACCCCGAACCCGAGAGCATCGAGAGCGACGCCGTAGAGGATCTCGGCGTTGCAGC
AGAGAGCGACCCTAGCGATGACGAACCCGACCCAGAACCCGAGTATGACCATCGAGAGGCGGATCATGAC
TCTGATGCGGATAGCGGATACTATTCGGCAGATGGGGGACGACCTGGAACACCAGTGGACGAGGAGCCCC
AGGACGATTCTCCCTCTTCCGAGGAGACCGCATCCACTGTCATCGAAGAAGCGCAGACTAGCGCTAGCAA
CGATTCTCATGACGACGACACTCACCGCGACGACGGCAGTGCTTCTGAAGAGGATCTCGAGCGGGACGCC
CTCGTGGCCCCGGCCGATCCTTTTCCCAACTTGCGGAAGTGTTTCGAGCGCCAAGCCATGATGCTGACCG
GGGCGTTAAAAGACGCCGCGGACACGGCTGATCCGCCAGAAACGCTCTCCGTCGACAGCGTGCAAAGGCA
GCTCGAACGCTTCGTCTTTAACCCCGACCGCCGCGTGCCCGCCGAACACTTGGAGGTACGCTACAATTTC
TACCCTCCTTTCCTCACCCCCAAGGCCATCGCGAGCTATCACATCTTTGCCGTCACCGCTTCCATCCCTC
TAAGCTGCAAAGCCAACCGCAGCGGCAGCGACCTTCTAGCCAAAGCAAAAGAGAGCACTTTCTTCAAACG
CTTACCTAAATGGCGTCTCGGGATAGAGATCGACGACGGGTTGGGAACGGAAGTCACGGCGGTAACAGAG
CTGGAAGAGGCAAAAATGGTTCCGTTAAAGGACGACGTGTCTCGTCTGCAGTGGGCAAAAATGCGCGGCG
AGCACATTCGCTTCTTCAGCTACCCGTCGCTGCACATGCCTCCCAAAATTTCCCGCATGCTGATGGAAAC
GCTGTTGCAACCGTTCGCGGACGAAAACCAAAAGGCGGAAGAGGCACTTCCCTGTCTGTCGGACGAGGAA
GTGCTGGCCATCGTGGACCCGACAGGGCGCCTCCACGGCGAGGACGCGCTCAAGGCCGTGGAAAAGCGGA
GGGCCGCGGTCACTATGGCGGTACGCTACACCGCGACCCTCGAACTCATGGAACGCGTGTTCCGCGAACC
GTCTATGGTCAAAAAGATGCAGGAGGTCCTCCACCATACCTTCCACCACGGCTTCGTCGCCCTGGTACGC
GAAACCGCAAAAGTCAACCTGAGCAACTATGCGACCTTCCATGGGCTTACCTACAACAACCCCCTGAACA
ACTGCATCATGTCCAAGCTCCTAGAAGGAGCAGACAAGGAGGACTATGTGGTGGACTCGATCTACCTTTT
CTTGGTCCTGACGTGGCAAACGGCTATGGGTATGTGGCAGCAGGCCATAGACGATATGACTATCCAGATG
TACACCGAGGTCTTTACCAAGAATAAGTACAGGCTGTACTCGCTGCCCAACCCGACCGCCATCGGCAAGG
CCATCGTGGACATCCTCATGGACTACGACCGGCTCACCGAGGAAATGCGGAAAGCGCTGCCCAACTTCAC
CTGTCAGAGCCAGATTACTGCCTTCCGCCATTTTCTACTGGAACGGTCCAACATCCCAGCGGTCGCCGCG
CCTTTCATGCCAAGCGACTTTGTGCCTCTGGCTTACAAGCAGAGCCCTCCCCTCCTCTGGGACCAGGTCT
ATCTGCTGCAGCTGGCCTTCTATCTCACTAAGCACGGAGGCTACCTGTGGGAAGCCCCGGAGGAAGAGGC
CAACAACCCGTCCAACCGGACTTACTGTCCTTGCAATCTCTGCAGTCCGCACCGGATGCCAGGTCACAAT
GCGGCATTGCACAACGAGATTCTGGCTATCGGAACGTTCGAGATCCGCAGTCCGGACGGGAAGACCTTCA
AGCTCACGCCTGAGCTGTGGACCAACGCATACCTCGACAAATTTGACGCCGAGGACTTCCACCCGTTCAC
GGTGTTCCACTATCCCGAGAACGCATCGCGGTTCGCATCCACTCTAAAAGCATGCGTCACGCAGAGCCCC
GAAATCTTGAGCCTGATTCGCCAGATTCAGGAATCGAGGGAGGAGTTTCTGCTCACCAAGGGCAAGGGGG
TGTACAAAGACCCGAACACCGGAGAAACCATCTCCAGACAGCCCCGGGACACTGCCCGCGCGCAGCACGC
TGGAGACGGTCAAGCTCTACCAGCCCCTGGAGCCTATACCACCGGAGGAAATAGAGCGGAGACAGCGCCT
GCTGGAGCTGTACGGCTTGCCCCGGACTACCAAGACGGGCAGTTTCCTATCGCGAAAGTCGGCCCGCACT
ACCATGGCCCAAAGAATGTTAGACGAGAAGACCAGGGTTACAGAGGCGGGCCCGGAGGTGTACGGGGAGA
GCGCGAGGTCGTCCTTTCACGAAGAGCAGGAGGAAGACGTTTCGGACGGAGAAACACTAGGCAGTCAGGA
TACAACGAACGGGCTAACCGATATTTCGGAAGAGGAGGAGGAGGATCTGTTCGAGGGCAACAAGGAGAAC
ATCCCACCACCTCGCCGTCCGCCTCGGAACCGCCGGCTCCGAGCCGCATACTCGCTCGAGGAACCCCTCC
TTCCCCCGAGCGCCGCGACCGACAAGAAGAGTAAGAAAGTCCCAAAAAGGCGAGGTAAATATCGCAGCTG
GGCTAAGCACCGCGTGGCGATATGCCAGGCACTTCGCGATGCGGTCTTTGACCGCAAAAAGGCGGGCGAA
ATCCTCAAGCGGGGTCACCGGCTCTTCGTGCCCGCTACTGTCATAGGCTACTATGCTCGCAAACTCTCTC
CCTCATTTCTCGCTCCTCTCTCCAGCCACACCGCACCCCTCCTCCCACCAAAAAAACACCGGCGCTAAGG
CTGTGCGTCTGCGCCAAGATCCGGTGCCGCAGCACATCGCGGACCTCAGAGGGGAAATACTCGACATCCT
GTTGGAAATCGAGTCGTACGCCCGCCGCCGTCCCGACCGCCACGTGTCCATTCGCAACAGAACGCGCGAA
AGCATCACCCGAAAACTGCATTACGAGAAAAATGAAGATAAGCTTACCCGTATGAAGAGCGATGCTATCA
AGTTGCTCGCTCTCTGGCAGACCGTTTAACTCGTGTTCCTTTATAGCCCTTCGGAACCATGAACCTGATG
AACGCCACACCCACCGAATACGTATGGAAGTACAACCCAGTCTCCGGCATTCCCGCCGGCGCGCAACAGA
ATTACGGCGCCACTATAGACTGGGTGTTGCCAGGAGGAACCGGTTTCGCAATAGCAACCAACGACATTCG
AAGACAAACCCTTAACCCGGCCGTGACCCGTGCAATTACCGCGCGTTTTGAAGCTGAGTCAGACCAGCAA
CCGTACGCTAGCCCTCACGAGACCAATGTTATCGCGGCCAATGTCCTCGACTCGGGTTATCCCAAATCCG
GTCTCTACCCATTAGAGCTCAGCGGCAATCAGCGCGTACAGCTGGCAGGCGGCCTAATGGTAGGTCGCAC
TGAGGGCAGGATGCAATTAGCGGGCGGTTTAACAGAAGGAAGAGTGCAACTTTCTGGAGGTTTCCACGGA
CGGCCGTTGGTTAGAGGGCGGAGCAGAAGACCGCCCAGATGGTGCGGCGCCGAACTGACTGGGAACGGAC
TGCCCGAGCAAGCCGAAGTCACTTCTGACACTTACAAGTACTTCCTGAGAACACAGGGTCCCAGCCAAGT
GGTTGAAGAGCCCGGCGTCTTTTCGCAAAGACAATTTATGACTACCTTCCTCCCCTCCGTTGTCCCTCAT
CCCTTCGACAGCACCAACCCCGGCGATTTCCCCGCGCAGTACAGTGCCATCTACAAAGGCCGCACGGCCT
TCGAAGACACCTTTTGGGACTGGTGAAGCGCACCTTTTGTTGGCGATGCTCCGTTTCGCAATAAATTTCT
TCCAATTCTCTGTCGTTAAACGGCTCCCGTCTGGTCACTGTCACGCGCTCGCCGCCCTCGCTCGTCACCC
GCGCGCGGTACCGTCGCCTCAGCCAGAATACAAAACCGGGGTTCAGGGGTTCGTCGAACCGTACCACAGC
CTGGTCGTTTAATCTCAACCAATATTTTCTAGGGTTCGACATCATGAACGAGGAGGTTCCCCTAAAGCGT
GTCAGCCCTGACGAAACCGAGACGGTTCCCAAAAAACCGCGAACCGACGTTCGCGACACCGTCAGGGCCG
GCACTGACGACACGGTAGATCTCGTGTACCCTTTTTGGTGGAATCTCGGAACGGGAGGGGGCGGAGGAGG
AGGAGGCGGGGGCGGCGGCAGTGGAACCTCTCTCCAGCCCAATGACCCGCTTTACGCCGCCAGCGGGACC
ATCAACCTACGCATGACATCCCCGCTAACGTTGTCACAACGAGCCTTGGCTCTCAAAACGGACAGCACCC
TCACCCTCAACACGCAAGGCCAGCTGGGCGTCAGCCTCACCCCCGGAGACGGGCTCGTCCTCAACACCAA
CGGGCTCAGCATCAACGCAGACCCGCAAACCCTCGCATTCAACAACAGCGGGGCGCTCGAAGTCAACCTA
GACCCCGACGGACCCTGGTCTAAAACCGCCACGGGGATCGATCTGCGTCTAGATCCGACGACGCTCGAAG
TAGACAATTGGGAACTAGGAGTCAAGCTCGATCCCGACGAAGCCATCGATTCCGGGCCCGACGGTCTCTG
CCTCAACCTGGACGAGACTCTGCTGCTCGCCACCAACAGCACATCCGGCAAAACGGAGCTCGGGGTACAC
CTCAACACCAGCGGTCCCATTACTGCGGACGACCAGGGCATCGACCTGGACGTCGATCCCAACACCATGC
AGGTGAACACAGGACCTTCCGGAGGCATGCTGGCCGTCAAACTCAAATCTGGCGGCGGGCTCACCGCTGA
CCCCGACGGTATCTCGGTCACGGCCACCGTCGCGCCTCCGTCCATCAGTGCGACAGCTCCTCTCACCTAC
ACCAGCGGCACCATTGCACTCACTACGGATACGCAAACGATGCAAGTCAACAGCAACCAACTGGCCGTGA
AGCTCAAAACGGGAGGCGGTCTGACGGCTGACGCGGACGGAATCTCCGTTTCGGTTGCACCGACCCCGAC
GATCAGCGCTTCTCCCCCGCTAACCTACACCAACGGGCAAATAGGGCTCTCTATCGGAGACCAAAGCCTC
CAAGTCAGCTCTGGACAGCTCCAAGTCAAACTGAAAAGCCAGGGCGGTATTCAACAGAGCACGCAGGGGC
TGGGAGTGGCGGTTGATCAAACCCTTAAGATTGTGTCTAACACGCTCGAGGTCAACACGGACCCGAGCGG
ACCCCTCACCAGCGGCAACAACGGTCTCAGCTTAGCGGCCGTCACACCCCTAGCAGTGTCTTCCGCCGGC
GTCACCCTGAACTATCAGTCCCCTCTTACAGTCACGAGTAACTCTCTCGGGCTCTCCATAGCCGCGCCAC
TCCAGGCGGGTGCGCAAGGCTTGACGGTAAACACGATGGAACCCTTGAGCGCCTCGGCGCAGGGCATCCA
GCTGCACTACGGACAGGGATTTCAGGTCGTCGCGGGCACGCTGCAGCTGCTCACTAATCCCCCCATCGTT
GTCTCATCCCGCGGGTTCACCTTACTCTACACTCCCGCCTTCACGGTGAGCAACAATATGTTGGGGTTGA
ATGTAGACGGCACTGACTGCGTGGCTATCAGTTCAGCCGGCCTACAGATCCGTAAGGAAGCCCCGCTGTA
CGTGACCTCGGGAAGCACTCCAGCATTAGCCCTTAAGTACAGCTCCGACTTTACCATTACCAATGGTGCG
CTCGCGTTAGCGAACAGCGGCGGAGGAGGAAGTTCCACACCCGAGGTGGCCACCTATCACTGCGGGGATA
ACCTACTCGAGTCCTACGACATCTTCGCCTCTCTACCCAACACCAACGCGGCTAAGGTGGCGGCTTACTG
CCGTTTAGCTGCTGCAGGTGGCGTGGTCAGCGGGACCATTCAAGTGACAAGCTATGCCGGACGATGGCCT
AAAGTGGGCAACAGCGTTACGGACGGCATCAAATTTGCCATCGTCGTGTCTCCCCCCATGGACAAAGACC
CACGATCGAACCTCAGTCAGTGGCTGGGTGCCACCGTATTCCCTGCGGGCGCGACTACTGCTCTCTTCTC
ACCCAACCCGTACGGCTCCCTCAACACCATCACCACACTGCCATCCATCGCCTCGGACTGGTACGTGCCC
GAGTCCAACCTGGTCACGTATACCAAGATCCATTTTAAACCAACGGGGTCGCAGCAGCTGCAGCTCGCGA
GCGGAGAACTCGTTGTTGCAGCGGCGAAATCGCCCGTGCAGACGACGAAATACGAATTGATCTATCTGGG
ATTTACGCTTAAGCAGAACTCCTCGGGTACCAACTTCTTCGATCCCAATGCCTCCTCCGATCTATCCTTT
CTGACACCACCGATTCCGTTTACTTATCTGGGGTACTATCAATGAACTTGTTAACTCCTGCAGCAGCAGC
AGCAGCAGCAGCAGCATGGCTGACCAGAAAAGGAAGCTGGCGGATCCGGATGCCGAGGCTCCGACGGGCA
AGATGGCCCGCGCGGGTCCGGGAGAACTGGACCTCGTCTACCCTTTCTGGTACCAAGTAGCCGCTCCCAC
GGAAATCACACCTCCGTTCTTGGACCCGAACGGTCCCCTGTACTCCACGGACGGCTTGTTGAACGTCAGG
CTCACGGCACCCCTCGTTATCATCCGTCAATCTAACGGCAACGCGATCGGGGTCAAGACCGACGGAAGCA
TTACCGTCAATGCGGACGGCGCGCTGCAGATCGGAATCAGCACGGCCGGACCTCTCACCACTACCGCCAA
CGGCATCGATCTTAATATCGATCCCAAAACCCTGGTCGTTGACGGTAGCAGCGGCAAGAACGTCTTGGGA
GTGCTTCTGAAAGGACAGGGGGCGCTACAGAGCAGCGCGCAAGGCATAGGCGTTGCCGTCGACGAGTCTC
TACAAATCGTCGATAACACCTTGGAAGTGAAGGTAGATGCTGCAGGTCCGCTCGCCGTCACAGCAGCCGG
CGTAGGGTTGCAGTACGACAACACCCAATTTAAAGTCACGAATGGGACTTTGCAACTGTACCAAGCGCCC
ACTAGCAGCGTGGCCGCATTTACATCCGGGACGATCGGCTTGTCCTCCCCTACGGGCAATTTTGTGAGCT
CTAGCAACAACCCGTTTAACGGGAGCTACTTCCTGCAGCAGATCAATACCATGGGCATGCTGACTACCTC
GCTCTACGTCAAAGTCGACACAACCACCATGGGTACGCGTCCCACGGGCGCGGTAAACGAGAACGCGCGA
TACTTTACCGTCTGGGTGAGCTCCTTCCTCACGCAGTGCAACCCCTCGAACATCGGTCAAGGGACCCTAG
AGCCAAGCAACATCAGTATGACCTCTTTTGAACCCGCCAGAAACCCCATCTCACCTCCCGTGTTCAATAT
GAACCAAAACATACCCTACTACGCTTCCCGATTCGGGGTACTGGAGTCTTACCGGCCTATCTTCACCGGC
TCGCTCAACACGGGAAGTATCGACGTACGGATGCAAGTGACGCCCGTCCTCGCCACCAACAACACGACCT
ACAATCTCATCGCCTTTACCTTCCAATGCGCCAGTGCCGGACTGTTCAATCCCACCGTGAACGGCACCGT
GGCCATCGGACCGGTGGTGCATACCTGTCCCGCTGCCCGCGCCCCCGTTACGGTCTGAACAATAAAGACA
AGGTGAACCATTTATACAGTCTCACGTCTCTTTATTGCATACGCTCCGCTAAATGTTTCCATTCGCTCAT
TTGCCAGTAATACAGCAGATTCGCAAACTCACTGAACCAATCTTCTGTATAAAAATGTACGCGCTGCGTG
TCCAAATCAACATCAATTTTCCTCATATACAGACAGGGGCTGCCACCCGCCTCCCCCAAGCGCGACACCG
CAATTAGGAATGGTAGCCTGCTGTGCAGGTCCACGTGAATTAACATCCCGCACACGTTCCCGATCGGTCG
CTGCATAAATACTGGAGAGAAATCGCTAAACCCCGGTGACGCCCACATAGCCACGAAGTACACCCCTGCC
ACATTCAAGTCATCCTCCAACCTGGCCCAAACATAAGTGGCCAAATCGGAAGGAGCCAGGTGGCAAGCCG
ATAACCCCATACGATGCAAAGGTAACCCGTGGCAAGCGCATCCCCCGAAATGAAGTTCGAAAGAATCGTA
ACACAGTAGCTGATAGGCATGAAGCGGCGTCGGCATCTGAAGACCGTCATCATCTTCGTCGTCTTCCATG
TCATCCCCAACTTCCTCCTCGCGCTCCGCTTCCTGTTGGCGGCGCTGCTGGTGCTGCAGCACCATCTCCA
GGATCTGCTCGTCGTTCATCTTAATCCGGAATTATCGCGTACGGATGTTCCTCGTCGTCCGAACTGACAA
CAGAAGGCGGAGGAGCTGTCAGTGGTGCTGTAGAGGCTAACGATGCTGCAGCACCGGTCTCTTGCAATTC
GAAATACCAAGGGTTGCTACTGACGGTCCAGTTCCCGCCCCGTGAACCAGGCCAGCGGGAAATCGGTGCA
GGTAGGGGATCCGGTGAAGGAGACCGGGAATGGAGGGAAGGAACTGCGAGATCCTTATCCACTCGATACA
AACCGTATAACAGGGAGCCCAACGCCAGGTACACCAGGAACGTACTACAAACGAACACGCTGATTACAAA
GTTTAACGAAGACAGATGGTTCTGTAGGAACAGGAAGCTGCACAGGATGATGCTGCTGTAGGACAGGGCG
ACCAGGAGGGCCAAGAACTCGCGCCAATAGCGTCCACAACACTGCAAAATCAAACACGTAATTAGCTATA
CGGACGTTCACCAGCGACTCTCGCGCGTCGTTCCATAAACACATTGCGCAGATAAGCCAACTGAGCAGAA
CAGAACAGAGAGAGAGGTTGCCGCGTCGAACACTGTTTGCACTGTCCGAAACACTCGGGATGAGACTCCC
CGTACTTCCCGTGCACATGAAATACCCACTCTTCGACGTTAGCGTAGGACAACCGACGGTAACCGGGGAA
GTAACACAGTCCCTGCGACACGATCGGCCACAGTTCCGGCGACACCATCACGCGGAGCATGCTTCTCAGG
CAGACGGGTTGGGTCACGGCGCTGCTGCGAGAAATAGTTTCCACCATGATGGTGGCCGTCACGGTCACGC
GACACGCATTCATGAGAACAACCGGAGACCGCACAAAAGGAACAGACGAAGGCACTTGCGAAAAGGACAC
CTCAAAGCTCATCGAGCGGAGAGCCATCTTTACGGATATCTTCTCCGCAATCAGAAAGCCTGTGGTGAAA
AACTTAAAATCTGTCTTCCTGCGAGCAAGCATCCACGGTTCCAAGTCGTACTTCATCCCAGGTGTAATAA
AAAGCAACCTACGTGAGAGGTAGTGCAGCAGGGCGGTCTTCTCTGCCCGGTTCAGGTGAAGGGCACTCAC
AATCCGGACTATGCAATTCATGAGTACGTAGTCTCGCCGTTTGAAACACACAAACTTTGCGCTGCGTACC
GTCACTAGCACCGTGACAGAACTATGCAATCGCCTCATCAGATCATTATCGAAACACCGCAAGCTAGCCA
CGGCTCTATTTATGCGGTACTCGTTCAGTCTCTCCATTTCCTCCTGTCGACAAGTTGGATCGTGACGTAG
GAGAAAACTAAACCATATTACTCCTACTTCGTTATGAAAGCCACAAGCTCTGCTGACGGTTAAAGACTCC
TTAAGAAAGAAAAGGTAGTACAGTCAAGCTGACCCATACAGGTGAACCCGCCCCAAGTCACGTAAGTCAA
CTCACCGAAAGAGGACACAGAGCCATATCCGCTGCTTCAAAGCTTTATTGACGGGTCTAAAGGCGTAAAG
AAAAGAAGAATTTACCGTTCTGCATCTCAAACCCCACCACCACGCGAAAAAGTCCGAACGATGCTGCAGC
ACCGTTCACGCAAAAGTCCCGGACGCGCACAAATAAACCCTTAATCCCGATAACGGTGCTGCAGCACCGT
CACGCTGCTGCAGCATCGTCAGACGTTTATGACATGCAGCCGATTCCGTGCGGATTTATGGTCCCATAAC
GGTTCCAGGTCCTTTCGTTGCTGCAGCACCGTTTCACGTAAAGAAGCTGTACAGGTCAAACTGGTCCGGA
TTACTGATTATTCGGGGGAGAGCCACGTGACGTAGACTCGAACGACGTCCACTTCCGATACAAACCACAT
CTCTCTGGACACAGGCTTGTCCGCCTTGAGCCAAACCATGTGATTCTTCCGGTCCGTTCTGACGTCAATG
CCGACACGCCTCTTGGTGTTTGAACAGGCATCCCAGTACGTAGCCAGGACCACTCGGTGACGTCGAGGTT
GAGGTTTAAAGGTCACTACGGCCTGTAACCCGGTACTCCAGGGCCCTAAACTAACATATTCTCCGGCCCT
GCCCACTACATTCGGGTGATCAAATATGACATAATCCTTAAACAATTTGGGGAACTTCAAACAGCCACAT
TTGGGCGGGACAGGAAGATGGTGCGCAGAAACATTGATATGAGAGCGCCATCTAGGGACATCAAAGCGGT
GCCCGCCTGGATGGCAATCGTACTTCTTAGTTCCGGTAAAGTAATAGGTGTGAGTCCGGAAACACGTAAA
CTCCGTCACTTCCTGTGTCGTCATTGCCCTCGCCCCTAGTGACGTCAGAGTGCCACGCCCCTTGTACAGT
CTAATAAATTTTAATACACCCCCGCCCCTAGCATATAAAACAATGGGAGCCTCGCCCACATTCCTATCCC
TAATAAAATACCATCTGACCGAATACCCGTGTTCCATCCCTATTGTTTTAGTATAATAAGGGTCATAAGT
CCACAACTCCGCGGCATTGCCCTCTGTCACCACCAACAGCAAATAGGAAGATGCCATGTCATCCTCTCGT
AAAAGCATCCTCCAATCAGCTACCTCTTCCGTGTAGTACTGAGTTGGCTGACTGTAATCACGCCCCGTGA
CGTAGGCTGACCACGCGGAAGGAACACTTCCGTGCATGCTCAGTAGCTGGTCAGCCTGGTGAGTATCCAG
GGCCTTCATAAAGGTCAAAGGCGCCATAATGTGATAACACAGTCCATCCGATCGGAGGAAATCAAAGGGA
ATATGTACATCTTCACAATGGCGCCTCCCAGAATAAGACCATGCACAGATTTGACCTTTCCACCAAGCAC
GTGACTCGCAAGCCTCATGTTTTTGACCAGTCAGATCGCTCCGTATATACTCGTCTCCTATTGGTCGATC
AAAACCGTACGAACCAATACTAGACGCAATCACCACTACGTAATCCGCGTCATCCCTAGAGATAACACTA
TCCGCATCCCTATTGGCTGACCAATGACCACCGGAAGACAGCAAAAGGTTTAACCCTTTTGTGTGTAAGT
CCATCCTATAACCCTGGAAACTTTCCAATGGGGGATCTAGCGCCACTATGCGGCCAACCTTTTTTGACCC
TCTGTCCGGACTAGAAGTTGGCGGGACAAAGCCGCGCATACAGTGCCCCCTAGCGACATCCCTATGCAAT
GAATTCGATGGTCCTTGAACTCCGTAAAAAAATGAGCAGTGGTCCTGACTGCGTAATAGGCCGGCCCCCT
CACATCCTGCCCCCACAAAAGGGCGTCTACCTTCTTACAAATATCTCTCAGCTGATTGGTCCAGTCCAAC
AGAATGACCGGGGACTCTGGCGTCATAATGGTATGCATACGCAAAATCTTTCTCATCATTTCACTGGTCC
ATTTATATGTGCCGTCATAGCGCGCCCTATTAATAAGCGGACACACATCGGGATACATGTCCTGAACCAG
AATAATGAGCTCCCCGCTATCTTTACCATCCAATACCCCGAGCCGCCGCATTTGACTGACAACCCAGGGG
CCGTCCGAAAAAGTCAAAAAAGTCTCATTCCACCATACAATTAACTTGGGCCACGAAGGAAAATCCGGCG
AATAGGTGCCCATCAAGCGCCTGACGTCAGCCTTAGGATATGGCGGATCCCATCTGGAATCCGACCCATT
AAAGCACGAAGATAGGGCAGACATCGGCCAATGGCCAGGAGAATGGGTAGAATTAATAAGGACTCCGCCT
CCATTTCCGAGCTTTTAAAAAAAAGAGAAAATGGAAATCAGCCAAGAGACCACCACCCCGTGATTGGATG
ATTGGTCATCAGAAGATCGATAAGGGAATTTATTTTCTGGGAGCCCCCCCCCCCCCTACTCCTATTTAAA
AAATAACCCTTTCCTCACCAAGCTCAGAAGACAGAGGAGGAGAGTAGAGCGCCGCTCAGAGGTCATCCGC
CGAGAGAAAATCCCGCGCAGAGAACAGAGCTCTCAGGTAGGGGTCTGGAGCTCTCTGGAAAAATCGCGGG
CTCTTATACACTTACTCTCCGCCCATTCGAAAGCCGCGCCTGACTAGAGTACACACTATAAATTCCATTC
CGGTGACTTACTACTAGGCGCTGGCCACTTATCAAAAGAAACAGTTCTAAGAATAGGACAAAGTCCAACC
GCAATAAAACACCCTTGTCAAACATGATAAGAGTGTTCTCGAGAAGGTACTGGAAAAGCAAACAGTCCAA
CTCCCAAGTTAAATATTACGCAAAGAGGCGTAACGAGAAAAGACTAGAAAGTGTAAACACACCTCTCCTA
GTTATATATAAACCCAGCGGGGCAGTCCCTAGAAGAACACTACCTCAATCCAGTTACACATTAACCCGGG
AACCTATTATTGATTAACTAGACAGTACTTCCTCATTTTCTACTGGAACTTTCCACTGCCCTCCGGGGAT
TTTCCATTGGCAATCATTAACTTGACTTTGTACTTTATGTTTACTCTCCATAGCAACGCACCTTATATGG
AAAATATGCTCCTCCCCGGACCGCCCATCGTACCACCTGAGCAGGTAGGCTGTACCTTTTCCTATTGGCC
CATTATGAGCTCACCTGGTTAATCATATACCCGCTCCGCCTATATAGGTAGCATACCGGGACAGGTTCCC
TCACAGTCTATTGCAGACTGCCGAAGAGAGAGGAGCTCCGCATAGGACTGGGACCAGAACCCCGAGACTC
TGCCGGTAATATTTTAATTTCATTTAATCGAATCAAATAAATCAAAAATCAACTCAAACCCATGATTCTC
AATGGAAATTTCTTGTGATTTTCTTTCGCGCGCGACCACCCCCTATGGCACCCCCCTGTACACCCCCCTG
TACACCCCCCTGTACAAGGGAACCTACCCCCCTGTACAGCGACCACCCCCCATGGACACCCCCCTGTACA
TTCTACAGGTATGGCCCGCAACCCATTCCGCATGTTCCCTGGGGACCTTCCATACTACATGGGGACCATT
TCCTTTACTTCGGTGGTCCCTGTGGACCCTAGCCAGCGGAATCCCACCACTAGCCTTAGAGAAATGGTGA
CCACCGGCCTGATTTTTAACCCTAACCTGACCGGCGAGCAACTGCGGGAATACTCATTCAGCCCCCTAGT
GTCCATGGGGAGAAAGGCAATCTTCGCAGACTACGAGGGTCCCCAGCGCATTATCCACGTTACCATTAGG
GGGCGCTCCGCGGAACCCAAGACCCCCAGTGAGGCCCTCATTATGATGGAGAAGGCGGTCCGTGGCGCGT
TCGCGGTTCCTGATTGGGTGGCCAGGGAATACTCGGATCCCCTCCCCCACGGCATAACCCACGTGGGGGA
CCTGGGCTTCCCCATTGGTTCCGTGCATGCCCTGAAGATGGCGCTAGACACACTGAAGATCCATGTCCCT
CGCGGAGTGGGGGTCCCTGGCTATGAGGGTCTCTGTGGGACCACCACCATCAAAGCCCCCCGACAATATC
GGCTCCTGACCACTGGAGTTTTCACCAAAAAAGATCTGAAAAGAACACTTCCAGAACCATTCTTCAGCCG
ATTTTTTAACCAAACTCCCGAAGTTTGTGCCATCAAGACTGGCAAAAATCCGTTTTCTACAGAAATTTGG
TGTATGACTCTCGGCGGGGATAGCCCCGCCCCCGAGAGAAATGAACCCAGAAATCCCCATTCTCTCCAAG
ATTGGGCAAGACTGGGTGTCATGGAAACCTGCCTACGTATGAGTAGGCGGGGACTCGGGTCTCGGCACCA
CCCCTACCATTCTCTGTAACCAATCCCTGAATAAAGATTTGCATAACAGAACTTTGACTCCTCCTTTTAT
GTGGGTGGGGTAATGGGCGGCACTTGGGGGTAATGGCGGTTCCTATTGGATGGGTAACACCGACTCCGCC
CTACAAAGTTAATGATTGATTTTTCGGACTTAGAAAAATTTCGACTGTCACCTGGATGTTTTTCCCCACT
TAACCTCTAGGGGGAGATAGATCGCGTCCAAGGGGAGGAGCTCAATACCGGACCGCCTATTAGGTGTGGC
TTCGGGCTCCGCCTAGTGGGAGGAGACAGGAAAACCACGCCTAGTGACGCTGGGTCAAAGTCCAAGGGGA
GTGGTTTATGCGCACCGCCTTGGGGCGTGGTTTGGGCGGCGCAAGGTAACCCTTGGACTGGGAGGAGACT
TCTGTCCCTTGGGCGTGTCAAACAGGTAAACCCCACCCGCGCGATTAATGATTAATTTTTCGGACTTAGA
AAATTTTCAACCTGATACTTTATTTTCAAGCTTTTCCCGCCGACGGGCAAGCCTCCTATCTCTCCGTCTA
TGACTCCACAGAGCCTCATCTGAATATGTAAATGTGCTGAACCGCAACCCCGTAGACCGCGCCCACCCCA
GCATCAAAGGTAACGCCCCCGATGCCACAATGTAATTACCCACTGTTAAATTAGGATCCTTACACCAATC
ATTTCTGTACAATTTAAACCACCGCCCACGCGGGACTTTCCCGTGGTGGTAGAAAAAGGTTTTGAAAAAC
GCGCGCATTATTTTCGTGGCTTCATTAATAGCGGACATGCGCAGATCCAGAAAGGTCAGACACACCACCA
CGGTCACATGACATTTGCATGGAGACAGGGATTGGATACCGACACAATACGCCATCGGATACTGAATGTC
CACATTGGTCCGTGCATATACAGTGTGCCACCTCCTCTTGACCGCAGCCACGAATCCCCAGAAGAGTTCT
TCCCGCCACAAAATCGAAACCGGGGCGGCGGCCCCAAAGCACAAATACAAAGGCATCCTCCTGAGGCTCT
AGAAAAAACAACTCATTAACAGGCATCCCGCTCATAGGTACATTCGTGTAAACAGGGCTGCATGCCAACC
AATGCCCCGCGTTTTACAAAGTGACGGGCCACCCTATTGGCGGAGGGGGTCCACGTATTGCGCACCGCGT
AAATAGAAGCCACCCCTCGCGGAACCTGTGTACATTCAAATCTCCTCCAAATACATTCGCGCAGTAAAGC
CACCGCCCTTTTCAAGAAAGTCCAATCAACCTTATGCGTGGGCAAAAAAATAGAAGCTGAATATACCCCC
GCAAACTCCTCCAATCGGAACAGGTAATCTACACTATAGTGGGACAGCATCTCAACAGTTAAACTTTCCC
AGGCATTTATCACCGTCAATTTCAGATCATGGAATACGGCCAAGTTAGGCTCCATCAAGGTCACGCGGAG
GTGGAAGTAATACATCCCGAAATACCCTGTTAAAAAAAATAGAAAAATGAACTAACCGACAATAAGATCG
GCAGTACCCAGTTTCGATCTGGGGACCTCCGGAGTGCAAGTCCGACGCTCTTACGGCTGAGCTACACTGT
CGATCTTGATCCGCTAGGGTACGCAGTCCGGAGAAGAAATATACTAAGTGAGACCCGGTCCTATATATAC
AGGTTGGTTCAAAGGAACCTTTGTACCCATTAAAACAGGTGCGTGACTGTAGAAGCCACACCCCTACCTG
TACCGATAAGGCACACCCTGAGCAAACAAACCATAAAGGTATACTTCCTTATTCAGACAGGTATAAATGG
AACCTCCGCACAACAGTCCGGTACCATTTTCCATCGCGAAAATGGGCAACCCTACTCTGCTCCTTCTTTC
AGGTCTCCTTTCTCTGACCCAGGCCATTTCCATCGGAGAACACGAAAACAAAACCCGGCATGTGATTGTA
TGGCGGCACTCCTCCTCCCACCAATGCTCTGATTGGAGAACAGTCACGGAATGGTTCCCGCCCCAAAAAG
GCAACCCGGTGAGACCACCCTACACCCAGCGGGTTTCCCTGGATACGGCAAACAATACCCTCACGGTAAA
ACCCTTCGAGACAAACAACGGGTGTTGGGAAACTACGTCACAAGGCATTAACCATCCACCAACCACCATT
CAGTACCGGGTATGGAACATCACCACCACGCCCACCATACAGACAATCAACATTACCAAAATAACTGTTC
GGGAGGGGGAGGACTTTACCTTATACGGACCTGTGTCCGAAACCATGAGTATTATCGAATGGGAATTCAT
CAAGGATGTCACGCCCCAGTTCATCCTCCAATACTATCTCTCCATTAACTCTACTATTGTGTACGCAAGC
TACCAAGGGAGAGTTACCTTTAACCCCGGTAAAAACACACTAACCTTAAAAGGCGCGAAGACCACCGACA
GCGGCACCTACAAGTCCACGGTGAACCTCGACCAGGTATCCGTCCACAACTTCCGAGTAGGAGTCACGCC
CATCGAGAAAAAAGAAGAAGCTACCGCAGAGACACCTGCCAGCAAGCCCACGCCCATACCACGTGTCCGA
GCGGATGCTCGAAGTACTGCCCTATGGGTTGGACTTGCCCTTTGCATCCTGACTGTTATACCCGCCCTTA
TTGGGTGGTACTTCAGAGATAGGCTCTGTGTTCCCGATCCAATCATTGAACTGGAAATCCCCGGACAACC
CCATGTAACAATACACATATTGAAAGGTCCCGATGATGATTGCGAAACTTAATGATTGACAAACGTAATA
AAAAAGCTGTGACGCACATAAGTACGTGTCTGTGTCATTCATCCATACCTATATATGGTGATAGCCCCTT
CCTCAATACACACCGAGCCGCGATGGACCCCAGACCACTTGTTCTGCTCCTCCTCCTAGCGTCCCATATA
AGTACATTCCGGCAAATGTACTTTGAAGGGGAAACCATCCATTTCCCTATGGGCATATATGGAAATGAGA
CCACCCTCTATATGAATGACATCATCCTGGAAGGAACACGCGCCAATACGACCACCCGTACAATCAGCCT
CACGACCACCAAGAAGAATGCGGGAACTAACCTGTACACTGTGATCTCCGAAACGGGACACAACGCCACC
TATCTGATAACTGTACAACCGCTGGGACAATCGATACACCACGCCTACACTTGGGCTGGAAATACTTTTA
CCTTACAAGGACAGGTATTTGAACACGGTAATTATACACGATGGGTGCGGCTGGAGAATGCGGAACCGAA
ACTCATTATCAGCTGGGCATTGTCCAACAGAACAATAAACAAAGGACCGGCCTATACTGCAAACATGGAC
TTTGATCCCGGAAACAACACCCTCACTCTCCACCCTGTGCTGATAACAGATGCCGGGATTTTCCAATGCG
TCATTGATCAGCAAACAAACCTAACCCTCACCATAAACTTTACAGTCTCCGAGAATCCACCAATCGTAGC
ACACCTGGATATCCATAAAACTATTTCTAGAACAATTGCCATTTGTAGCTGTTTGCTTATCGCGGTAATT
GCGGTCTTGTGTTGCCTACGTCAGCTCAATGTAAACGGGCGGGGAAATTCCGAAATGATATAAAACAATA
AAGCAGTGTGCGTCATGGAAACTTTTCTCAGGTGCTTCCTCATTCACACAGGTATATATAGGGAATGGAA
AATTAGACAGATACCCACACCGGAACAATGCTACTTCTCACAGTAGTTCTGTTGGTGGGGGTCACCCTCG
CTGCGGACCATCCTACTCTATACGCTCCGAAAGGGGGCAGTATAGAATTGGGTGTGGGGGCTAAACAGAA
AGGGCAATACAAATTTGAATGGCGGTTTGGAAATCTAAAAATTGTGATAGCCGAAATGTCATCCACTAAC
CAATTAGAAATCAAATTTCCCGATAACGGTTTCCAAAATCGATCCGAGTTTAACCCCACCAAACATAACT
TAACCATTCATAATGCCAGCTACGAGGACAGCGGAACCTACTCACTCCACCAGGAAGAAAATGATGGCAC
GGAACACACGGACAACTTCAAAGTGATTGTTCAAGGTATGTCATTATATACATATTTACAATATGCATTA
ATATCACCTATCTAATAGAGCATTAATTATCCAGACCCGATTCCACGCCCTGAAGTCAAGGGAACCACTA
TGCAAATCAACGGGAAAACTTTCACCAATATATCCTGCCATCTACCGGCCGGTTCCTACGGCAATGTCTC
CTGGCATTGGAATTATACCGACCCAATCATAGTCGGGTACGAAAATCAGAGCATGCTCGTTGGACCTTTA
GGGGTAATGTATTCATGTACGGCATCCAATCAAGTCTCAAAAAACTCCAGTGCAATAAGTATGGACACCG
CCGAACCATCAGAGAGTAAGTAGCGCCCTCTATAGACATTATATAGAATATAACTGAACACATTAAGAAA
CCTCTGTAATTATTTATAGGAGCGGAGTGCGCATATACAGGATACATTGCGGGCATTATAATCTTAGGAG
TGCTTTGCATATTGTTCATTTACCTATATGCAAATACCCCTGAAGTGCGGCAGAGAATAACCGACCAATT
AGAAAAGCTTCTCGGAACATTCTGTGACGTCAGTATAGAAGACGGAATACCGGAACGCACCAGAAGAAAC
AAAAAAAGAATCATCTTAAAGGAGCCCTCCCATAGGTGGATCTGGATTCAGTCATTTGCATAATATGCTG
TGTCATAACCGCCACCATCACCATAGCAATCATTGGGCGTAAGTATTGTGACGTAAGAAAAGGCATGTCT
AAAAAAACGGTCACTCACCATAATGCTGCCCCCGATAGGTTGCGACCGCCTTCCGGAGTTTGACGTAGTA
TGCCCGCGAGACTGGATCGGATTTCAAAGCAAGTGCTACTACTTTTCGGAGTCAGAGTCCAATTGGAGTG
AAGCCGAAAAATTTTGTAGACAGCAAGAGGCGGAGCTAGCAGTTCGGCGTTCCGAGGAGGAAAAGGTAAA
AAGTTAAATTCCAGGAAACTCCTAATTCCCCGAAAAATTACAAAAATTAACGGAGACCCTTTACAGGAGT
TCCTTCTGCGCCAATGCGGAACAGGAACTAACTGGCTGGGCGTAACCAGGAAGTCGAAGGACGGAGCTGA
TTGGGTGGATGCATCGTACGATGATTACGTACCATGGTGAGTCATGTTATACGTCACATCCGGGATGTGA
CGTATGCGGAAGTTGATCCGGGAGTGAAAACCCGGAAGTAACCTGTTAATTTGCATACAGGTATGAAATT
CGGGGAGGCGGAGACTGCGTGTATTTAAATGGAGACCGAGTGACGTCAGCCTACTGTGATACCCAGAAGC
TATTTGTCTGTTCCTGTCAAGATTCGTATTCGTATTGGTTAGAAAACAAATAAATCAATAAACTAATTTA
TGATATCATTCATATTTATGGGTGTGGTTTTATTATGCGTCATAAAACTATTTTGCGTATAGCGACACGC
TGCGGTTATGGCCGGTTATGACTGCGTTAGTTTTTGAGGTTATTATACATCATC



spacer
spacer