Dbfetch

>AC_000022.2 Rattus norvegicus strain Wistar mitochondrion, complete genome
GTTAATGTAGCTTATAATAAAGCAAAGCACTGAAAATGCTTAGATGGATTCAAAAATCCCATAAACACAA
AGGTTTGGTCCTGGCCTTATAATTAATTGGAGGTAAGATTACACATGCAAACATCCATAAACCGGTGTAA
AATCCCTTAAAGATTTGCCTAAAACTTAAGGAGAGGGCATCAAGCACATAATATAGCTCAAGACGCCTTG
CCTAGCCACACCCCCACGGGACTCAGCAGTGATAAATATTAAGCAATGAACGAAAGTTTGACTAAGCTAG
TACCTCTCAGGGTTGGTAAATTTCGTGCCAGCCACCGCGGTCATACGATTAACCCAAACTAATTATTTTC
GGCGTAAAACGTGCCAACTATAAATCTCATAATAGAATTAAAATCCAACTTATATGTGAAAATTCATTGT
TAGGACCTAAGCCCAATAACGAAAGTAATTCTAATCATTTATATAATGCACGATAGCTAAGACCCAAACT
GGGATTAGATACCCCACTATGCTTAGCCCTAAACCTTAATAATTAAACCTACAAAATTATTTGCCAGAGA
ACTACTAGCTACAGCTTAAAACTCAAAGGACTTGGCGGTACTTTATATCCATCTAGAGGAGCCTGTTCTA
TAATCGATAAACCCCGTTCTACCTTACCCCTTCTCGCTAATTCAGCCTATATACCGCCATCTTCAGCAAA
CCCTAAAAAGGCACTAAAGTAAGCACAAGAACAAACATAAAAACGTTAGGTCAAGGTGTAGCCAATGAAG
CGGAAAGAAATGGGCTACATTTTCTTTTCCCAGAGAACATTACGAAACCTTTATGAAACTAAAGGACAAA
GGAGGATTTAGTAGTAAATTAAGAATAGAGAGCTTAATTGAATAGAGCAATGAAGTACGCACACACCGCC
CGTCACCCTCCTCAAATTAGATTGACATTCACATATACATAATTTCACTAACAAATTTATGAGAGGAGAT
AAGTCGTAACAAGGTAAGCATACTGGAAAGTGTGCTTGGAATAATCACAGTGTAGCTTAATCACAAAGCA
TCTGGCCTACACCCAGAAGAATTCATAAAAAATGAACACTTTGAACTAACCCTAGCCCTACAACCAACCA
ACATAACTAAACCCCCACATAAACTAAAACATTTAACTCAAAAAGTATTGGAGAAAGAAATTTACTTACC
AAGAGCTATAGAGAAAGTACCGCAAGGGAAATGATGAAAGACTAATTTAAAGTAAAAACAAGACAAAGAT
TAAACCTGTACCTTTTGCATAATGAATTAACTAGAAAATCCTTAACAAAAAGAATTTAAGCTAAGAACCC
CGAAACCAAACGAGCTACCTAAAAACAATTTCATGAATCAACCCGTCTATGTAGCAAAATAGTGGGAAGA
TTTTTAGGTAGAGGTGAAAAGCCTATCGAGCTTGGTGATAGCTGGTTGCCCAAAAAAGAATTTCAGTTCA
AACTTTAAGCTTCCATCAGAACAACAAATCAAAATGTAAACTTAAAATATAGCCAAAAGAGGGACAGCTC
TTTAGGAAACGGAAAAAACCTTAAATAGTGAATAAACAACTACAATCACTTAACCATTGTAGGCTTAAAA
GCAAGCCATCAATAAAGAAAGCGTCAAGCCACATCATCTTACACACACACTAATTCCACAAACCTCAAAA
ATTCCAAAATTACAAATTGGGCTAAATCTATGATCCTAGTGAATACTGTTAATATGTGAACAAGAACCAA
TCCACCAAGCACAAGTGCTAAGACAACCGGATAACCATTGTTAATTATTGAATCATAGGCATAACCCAAC
AATAGAATTACCTATCCCTAACTCGTTAGCCCAACACAGGCGTGCTTTAAGGAAAGTTTAAAAAAGTAAA
GGAACTCGGCAAACACGAACCCCGCCTGTTTACCAAAAACATCTCCTCTAGCATAACAAGTATTAGTGGC
ATCGCCTGCCCAGTGACTAAAGTTCCACGGCCGCGGTATCCCGACCGTGCAAAGGTAGGATAATCACTTG
TTCCTTAATTAGGGACTAGAATGAATGGCTAAACGAGGGTCCAACCGTCTCTTACTTGCAATCAGTGAAA
TTGACCTTCCAGTGAAGGGGCGGACTCATAATAAAAGACGAGAAGACCCTATGGAGCTTTAATTTACTAA
TTTCAATTTATATAAAAAAACCTAATGGGCGAAAACAACAAAATTATGAACTACCAAATTTCGGTTGGGG
TGACCTCGGAGAATAAAAAATCCTCCGAATGATTATAACCGAGTCGGTAACCGTGTCCGACCCAGTCAAG
TAATACTAATATCTTATTGACCCAATTATTGATCAACGGACCAAGTTACCCTAGGGTAACAGCGCGACCT
ATTTAAGAGTTCATATCGACAATTAGGGTTTACGACCTCGATGTTGGATCAGGACATCCCAATGGTGCAG
AAGCTATTAATGGTTCGTTTGTTCAACGATTAAAGTCCTACGTGATCTAAGTCCGGCAATCCAGGTCGGT
TTCTATCTATTTACAATTTCTCCCAGTTACGAAAGGACAAGAGAAATGGAGACCAACCAATCCTAGGCTT
CCAACCAATTTAGAAAAACTTAATAAAGTATATATGTACAATAAATAACCTTAGACCCAAGTTATTAGGG
TGGCAGAGCCAAGTAATTGCGTAAGACTTAAAACCTTGTTCCCAGAGGTTCAAATCCTCTCCCTAATAGT
GTACTTTATTAATATCCTAACACTCCTAATCCCAATCTTAATTGCCATAGGCCTTCTCACCCTAGTAGAA
CGGAAAATCCTAGGCTACATACAATTACGCAAAGGCCCCAACAACGAAGGCCCATATGGTAAACTACAAC
CATTTGCAGATGCCATAAAACTATTCATAAAAGAACCCATACGCCCTCTAACCACCTCAATATCACTATT
TATTATCGCCCCAACCCTCTCCCTTACACTAGCTCTAAGCCTATGAATTCCCTTACCAATACCCCACCCC
CTTATCAACCTCAACCTAGGCATACCATTTATTCTAGCCACATCCAGCCTTTCGGTCTACTCCATTCTAT
GATCGGGATGAGCCTCAAATTCAAAATACTCCCTATTCGGAGCCCTACGAGCCGTTGCCCAAACCATCTC
TTACGAAGTCACAATAGCCTTATACCTCTTATCCGTCCTCCTAATAAGCGGCTCCTTCTCCCTACAAATA
CTTATCACTACACAAGAACATATCTGACTATTAATCCCCGCCTGACCAATAGCCATAATATGATACATTT
CAACCCTCGCAGAAACAAATCGAGCTCCCTTCGACTTAACAGAAGGAGAATCAGAATTAGTCTCAGGCTT
TAACGTCGAATACGCCGCAGGACCATTCGCCCTATTCTTCATAGCCGAGTACACCAACATTATTCTAATA
AACGCCCTAACATCAATTGTATTCCTAGGCCCCTTATATCATATCAATTACCCTGAATTATACTCAACCA
GCTTCATAACAGAAACACTACTTCTATCCACAACTTTCCTATGGATTCGAGCATCCTACCCCCGTTTTCG
ATATGACCAACTAATGCACCTCCTATGAAAAAATTTCCTCCCACTAACACTAGCATTCTGCATATGATAC
ATTTCCCTGCCAATTTTCCTAGCAGGAATTCCACCCTACACATAGAAATATGTCTGACAAAAGAGTTACT
TTGATAGAGTAAATAATAGAGGTTTAAATCCTCTTATTTCTAGGACAATAGGAATTGAACCTACACCTAA
GAATTCAAAATTCTCCGTGCCACCAATACACCCTATCCTACATAGTAAGGTCAGCTAACTAAGCTATCGG
GCCCATACCCCGAAAATGTTGGTTAAACCCTTCCCGTACTAATAAATCCAATTACCCTAACCATTATTTA
CTTAACCACCTTTAAAGGCCGCCTAATCACGACACTTAGCACCAACTTACCACCAATATGAGTAGGATTG
GAAATAAGCCTTTTAGCTATCATCCCACTTCTAGCCAACAAAAAAAGCCCACGATCAACTGAAGCAGCAA
CAAAATATTTTCTAACCCAAGCTACAGCCTCAATAATTATCCTACTAGTCATCATCCTCAACTACAAACA
ATCAGGAATATGAACCCTTCAACAACAAACCAATAACATACTACTCAACATAATACTCATTTCACTGGCC
ATAAAACTTGGACTAGCCCCATTCCACTACTGACTACCCGAAGTCACCCAAGGAATTCCCCTACACATTG
GATTAATCTTACTAACATGACAAAAAATTGCTCCACTATCAATTCTATACCAATTTTATCAACTCCTAAA
CCCAACTATCACCACCATTCTCGCAATTTCATCAGTCTTTGTTGGCGCCTGAGGAGGACTTAACCAGACC
CAAACACGAAAAATCATAGCATACTCATCAATTGCCCACATAGGATGAATAACAGCAATCCTTCCATACA
ACCCTAACTTAACCCTCCTAAACTTAACAATTTACATCCTACTTACTGTTCCAATATTCAATTACATCAT
AACAAACTCAGCAACAACAATCAACACACTCTCACTCGCATGAAATAAAACTCCCATAATCCTAACCATA
GCATCCATCATCCTCCTATCACTAGGAGGACTCCCCCCTCTCACAGGATTTTTACCAAAATGAGCAATTA
TCTCCGAGCTTCTAAAAAACAACTGCTCAACCCTATCAACACTAATAGCTATCATAGCCCTATTAAGCCT
ATTCTTCTATACTCGACTAATTTACTCTATATCCCTCACCACATTCCCAACCAACAACAACTCCAAAATA
ATCTCCCACCACCAAAACCCAAAACATAATTTTATCCTCCCAACCCTCACAGTATTAAGTACCCTAACCC
TACCGCTTTCCTCCCAACTAATCACATAGAAGTTTAGGATATACAGTTCAAGAGCCTTCAAAGCCCTTAG
AAAACAAACAAGTTTAACTTCTGATAAGGACTGTAAGACTATATCTTACATCTGTTAAATGCAAATCAAC
TGCTTTAATTAAGCTAAATCCTCAACTAGATTGGAAGGAATCAAATTCCTACGAAAATTTAGTTAACAGC
TAAATACCCTACTTACTGGCTTCAATCTACTTCTCCCGCCTATCAGAAAAGAGGCGGGAGAAGCCTTAGT
AGAGGAGATTCTCTACACCTTCGAACTTGCAATTCGACATGATAATCACCTTAAGGCTTTTTGGTAAAAA
GGGGGCTCAACCCCTGTCTTTAGATTTACAGTCTAATGCTTACTCAGCCATTTTACCTATGTTCGTAAAC
CGTTGACTCTTTTCAACTAACCACAAAGATATCGGAACCCTCTACCTATTATTTGGAGCCTGAGCAGGAA
TAGTAGGGACAGCTTTGAGTATTCTAATTCGAGCTGAACTAGGACAGCCAGGCGCACTCCTAGGAGATGA
CCAAATCTATAATGTCATCGTCACAGCCCATGCATTCGTAATAATTTTCTTTATAGTAATACCTATAATA
ATTGGAGGCTTCGGAAACTGACTTGTACCACTAATAATTGGAGCCCCTGATATAGCATTCCCACGAATAA
ATAACATAAGCTTTTGACTGCTTCCTCCATCATTTCTACTCCTTTTAGCATCCTCCATAGTAGAAGCTGG
AGCTGGAACAGGATGAACAGTATATCCCCCCTTAGCCGGAAACCTAGCCCATGCTGGGGTATCCGTAGAT
TTAACTATTTTTTCCCTCCACCTAGCCGGGGTGTCTTCTATCTTAGGAGCTATCAACTTTATCACCACTA
TCATTAATATAAAACCCCCTGCTATAACCCAATATCAGACACCTCTCTTTGTATGATCCGTACTAATTAC
AGCCGTCCTACTACTTCTCTCACTGCCAGTATTAGCAGCAGGTATCACTATACTCCTTACAGACCGAAAT
CTAAATACTACTTTCTTCGACCCCGCTGGAGGTGGAGACCCAATTCTTTATCAACACCTATTCTGATTCT
TCGGCCACCCAGAAGTGTACATCTTAATTCTTCCAGGGTTTGGAATTATTTCACATGTAGTTACCTATTA
CTCTGGAAAAAAAGAACCCTTCGGATATATAGGTATGGTATGAACCATAATATCTATTGGCTTCCTAGGA
TTTATTGTATGAGCACATCACATATTCACAGTAGGCCTAGATGTAGACACCCGAGCCTACTTTACATCTG
CCACTATAATTATCGCAATTCCTACAGGCGTAAAAGTATTCAGCTGACTCGCTACACTACATGGAGGAAA
TATCAAATGATCCCCCGCCATATTATGAGCCTTAGGGTTTATCTTCTTATTCACAGTAGGGGGCCTAACA
GGGATCGTACTATCTAACTCATCCCTTGACATTGTACTTCATGATACATACTACGTAGTAGCTCACTTCC
ACTATGTCTTATCTATAGGAGCAGTATTCGCCATCATAGCTGGCTTCGTCCACTGATTCCCACTATTCTC
AGGCTATACCCTAAATGACACATGAGCAAAAGCCCACTTTGCCATTATATTTGTAGGTGTAAACATAACA
TTTTTTCCTCAACACTTCCTAGGATTAGCAGGGATACCTCGTCGTTACTCTGATTATCCAGATGCTTATA
CCACATGAAATACAGTCTCCTCTATAGGCTCATTCATCTCACTTACGGCCGTCCTTGTAATGATCTTCAT
GATTTGAGAAGCCTTCGCATCAAAACGAGAAGTGCTCTCAATTTCCTACTCTTCAACTAACCTAGAATGA
CTGCATGGATGCCCCCCACCTTACCACACATTCGAAGAACCTTCCTATGTAAAAGTTAAATAAGAAAGGA
AGGAATCGACCCCCTACAACTGGTTTCAAGCCAATTTCATAACCATTATGTCTTTCTCAATGAGATATTA
GTAAAATAATTACATAACCTTGTCAAGGTTAAGTTATAGACCTAATCCTATATATCTTACATGGCTTACC
CATTTCAACTTGGCTTACAAGACGCTACATCACCTATCATAGAAGAACTTACAAACTTTCATGACCACAC
CCTAATAATTGTATTCCTCATCAGCTCCCTAGTACTTTATATTATTTCACTAATACTAACAACAAAACTA
ACACACACAAGCACAATAGACGCCCAAGAAGTAGAAACAATTTGAACAATTCTCCCAGCTGTCATTCTTA
TTCTAATTGCCCTTCCCTCCCTACGAATTCTATACATAATAGACGAGATTAATAACCCAGTTCTAACAGT
AAAAACTATAGGACACCAATGATACTGAAGCTATGAATATACTGACTATGAAGACCTATGCTTTGACTCC
TACATAATCCCAACCAATGACCTAAAACCAGGTGAACTTCGTCTATTAGAAGTTGATAATCGGGTAGTCT
TACCAATAGAACTTCCAATTCGTATACTAATCTCATCCGAAGACGTCCTGCACTCATGAGCCATCCCTTC
ACTAGGGTTAAAAACCGACGCAATCCCCGGCCGCCTAAACCAAGCTACAGTCACATCAAACCGACCAGGT
CTATTCTATGGCCAATGCTCTGAAATTTGCGGCTCAAATCACAGCTTCATACCCATTGTACTAGAAATAG
TGCCTCTAAAATATTTCGAAAACTGATCAGCTTCTATAATTTAAACTCATTGCGAAGCTTAGAGCGTTAA
CCTTTTAAGTTAAAGTTAGAGACAACAAATCTCCACAATGACATGCCACAACTAGACACATCCACATGAT
TTATTACAATCATCTCCTCAATAGCCACACTATTTATTTTATTTCAATTAAAAATTTCTTCCCAAACCTT
TCCTGCACCTCCCTCACCCAAAACTATAGCCACAGAAAAAACGAATAACCCTTGAGAATCAAAATGAACG
AAAATCTATTTGCCTCTTTCATTACCCCCACAATAATAGGTCTACCAATTGTTGTGACCATTATTATGTT
CCCATCAATTCTATTCCCATCATCAGAACGCCTAATCAGCAACCGACTACACTCATTTCAACACTGACTA
ATCAAACTTATCATCAAACAAATAATGTTAATTCACACACCAAAAGGACGAACCTGAGCCCTAATAATTG
TATCCCTAATTATATTTATTGGCTCAACCAACCTTCTAGGGCTTCTTCCCCATACATTTACCCCTACCAC
TCAGCTATCTATAGACCTAAGCATAGCCATCCCCCTATGAGCAGGAGCCGTAATTCTAGGTTTCCGACAC
AAACTAAAAAATTCTTTAGCCCACTTCTCACCGCAAGGAACCCCCATCTCACTAATTCCCATACTAATCA
TCATCGAAACTATCAGCCTATTTATTCAACCGATAGCACTAGCAGTACGACTAACAGCAAACATTACAGC
AGGCCATCTATTAATGCATCTAATCGGAGGAGCTACCCTAGTACTTATAGACATCAGCCCACCAACCGCT
ACAATTACATTTATTATTCTACTTCTACTTACAGTACTTGAATTTGCCGTAGCCTTAATTCAAGCCTATG
TATTCACCCTTCTAGTCAGCCTGTACCTACATGATAACACATAATGACCCACCAAACCCATGCATACCAT
ATAGTAAACCCAAGCCCATGACCACTAACAGGAGCCCTATCAGCTCTTCTACTCACATCCGGCTTAGTAA
TATGATTCCATTACAACTCCACAATTCTCCTATCATTAGGCCTCCTGACAAACATCCTAACTATATATCA
ATGATGACGAGATATCATCCGTGAAGGAACATACCAAGGCCACCACACCCCTATTGTACAAAAAGGCCTC
CGATACGGAATAATCCTGTTTATTGTCTCCGAAGTATTCTTCTTTGCCGGATTTTTCTGAGCATTTTATC
ATTCCAGCCTAGTTCCTACCCACGACCTAGGCGGTTGCTGACCCCCAACAGGAATCACCCCTTTAAATCC
CCTAGAAGTACCCCTTCTAAATACATCAGTCCTCTTAGCATCAGGAGTCTCAATTACATGAGCCCATCAC
AGCCTAATAGAAGGCAACCGAAACCATATAAACCAAGCCCTACTAATCACCATTCTCTTAGGATTATATT
TCACTATCTTACAAGCCTCAGAGTATTTCGAAACATCATTTTCTATCTCAGACGGAATTTACGGCTCAAC
ATTCTTCATAGCAACGGGATTTCATGGCCTCCACGTAATTATTGGCTCAACTTTCCTAATTGTCTGTCTA
CTACGACAACTAAAATTCCACTTCACATCAAAACATCATTTCGGATTTGAAGCCGCAGCATGATACTGAC
ACTTCGTAGATGTAGTTTGACTATTCCTATACGTTTCTATCTATTGATGAGGATCCTACTCCCTTAGTAT
AAACAATACAACTGACTTCCAATCAGTTAATTCTGAAAAAACTCAGAAGAGAGTAATTAACCTACCCATT
ATCATCACAATTAACATCACCTTATCCTTTATCCTCATTTCAATTGCATTCTGATTGCCTCAAATAAACT
TATACTCCGAAAAAGCAAACCCATATGAATGTGGCTTCGACCCAACAAGTTCTGCACGCCTTCCTTTTTC
AATAAAATTTTTCTTAGTAGCCATTACATTTCTACTATTCGACCTAGAAATCGCCTTACTACTTCCCCTC
CCATGAGCGATTCAAACAACCAATACCACTACAATAATAGCAACTGCCTTTATTTTAGTCACTATTTTGT
CTCTTGGCCTAGCCTACGAATGAACACAAAAAGGACTAGAATGAACAGAATAATTGGTAATTAGTTTAAA
TAAAATTAATGATTTCGACTCATTAGATTATGATAATAATCATAATTACCAACAATGACATCTGCTTTCC
TAAATTTAACTATAGCCTTTACATTATCTCTACTAGGTACTTTTATATTTCGCTCCCACCTAATATCCAC
TCTCCTCTGCCTAGAAGGAATAATACTATCACTATTTGTCATAACTTCAACATCCACATTAAACTCCAAC
TCCATAATCTCCATAACCATCCCAATTACCATTCTAGTTTTTGCAGCCTGCGAAGCAGCAGTAGGTTTAG
CCTTACTAGTAAAAATTTCAAATACTTACGGAACAGACTACGTACAAAACCTCAACCTTCTACAATGTTA
AAAATTATTTTCCCATCTATCATACTCCTCCCACTAACATGACTCTCAGCCAACAAAAAAATCTGAACCA
ATGTCACCTCCTACAGCTTTCTAGTGAGCCTATTAAGCTTATCACTCCTATGACAAAATGACGAAAATTA
CCTAAATTTCTCAGTTATATTCTCCTCCGATCCATTATCCACCCCACTAATCATTCTAACAACTTGACTC
CTCCCACTAATAATGCTCGCTAGCCAAAATCACATAAAAAAAGAAAATATAATGCATCAAAAACTTTACA
TCTCAATACTTATTAGCCTCCAAATTTTACTCATCATAACATTCTCCGCAACAGAACTAATTTTATTTTA
TATCCTGTTCGAGGCCACTCTAATCCCAACACTAATTATCATTACACGATGAGGCAACCAAACAGAACGC
TTAAATGCAGGAATTTATTTCCTGTTTTATACACTAATTGGCTCCATCCCACTCTTAATTGCCCTCATTT
CAATCCAAAACTCAATAGGAACACTCAACTTCCTAATCCTTTCCCTCACAACACACCCCCTACCCTCAAC
ATGATCCAACACCATTCTATGACTAGCATGTATAATAGCATTTATAATCAAAATACCATTATACGGAGTC
CATCTATGATTACCAAAAGCCCACGTAGAAGCTCCAATTGCAGGCTCTATAATTTTAGCAGCAATTCTCC
TAAAGCTAGGGGGTTATGGGATAATACGAGTTTCCATCATTCTAGACCCCCTAACAAAATCTTTAGCCTA
CCCATTCATCATCCTCTCATTATGAGGCATAATTATAACTAGCTCAATCTGCCTACGCCAAACAGATCTA
AAATCATTAATTGCTTACTCATCAGTAAGCCATATAGCCCTAGTCATCACAGCCATTATAATCCAGACAC
CATGAAGCTTCATGGGAGCCACAATACTAATAATCGCCCACGGCTTAACCTCATCACTCTTATTCTGCCT
AGCAAACACCAACTACGAACGAATTCACAGCCGAACTATAATTATAGCTCGAGGATTACAAATAATCTTT
CCATTGATAGCAACATGATGACTATTAGCAAGCTTAGCCAACCTAGCACTACCACCCCTAATTAACCTCA
TAGGCGAGTTATTCATTGTTATAGCAACATTTTCCTGATCGAACCCCTCTATCATCCTTATAGCAACTAA
CATTGTCATCACAGGAATATACTCAATATATATGATTATCACAACCCAACGAGGAAAACTAACCAGCCAC
ATAAACAACCTCCAACCTTCCCACACACGAGAATTAACACTCATAGCTCTACACATTATTCCCCTCATAC
TATTAACAATCAACCCTAAACTCATCACAGGCCTAACAATATGTAGATATAGTTTACAAAAAACATTAGA
CTGTGAATCTAACAACAGGAAATCAAATTCCTTATTTACCAAGAAAGTATGCAAGAACTGCTAATTCATG
CACCCATACCTAAAACATATGGCTTTCTTACTTTTATAGGATAGAAGTAATCCATTGGTCTTAGGAACCA
AAAACCTTGGTGCAACTCCAAATAAAAGTAATAAATATAATAACAATCCTAATCCTCATAATTCTTGATT
TACTTACAACACCAATCACATTTTCAATAACAATCTTAACCAAACTTATGTACTTCCGTCATATGCTCAT
TACATCAATTAAATTCTCATTCCTCCTTAGCCTCTTACCTTTACTACTATTCTTCCACCACAACACAGAA
TACATAATTACTAACTGACATTGACTAACTATTAATTCTATTAAACTTACTATAAGTTTCAAAATTGACT
ATTTCTCAATCCTATTCCTATCAGTATCCCTATTCGTAACATGATCAATTATACAATTCTCTTCATGATA
TATACACTCTGACCCCCACATTAACCGATTCATTAAGTACTTAATAATATTCCTGAATAACATACTAATC
CTAACCTCAGCTAACAATCTATTCCAACTCTTTATTGGATGAGAAGGGGTAGGAATTATATCCTTCTTAT
TAATCGGATGATGATATGGCCTTGCAGACGCCAACACAGCGGCCCTCCAAGCAATCCTCTACAACCGAGT
CGGAGACATTGGTTTCATCCTAGCTATAACCTGATTCTGCCTAAACATAAACTCCTGAGAACTCCAACAA
ATTTTCTTAACCAACACCAACAACAATCTAGTCCCTCTCACAGGACTACTAATTGCAGCCACAGGAAAAT
CCGCCCAATTCGGACTTCATCCATGACTCCCATCAGCTATAGAAGGCCCAACTCCCGTCTCTGCCCTACT
ACACTCAAGCACAATAGTTGTAGCAGGGATCTTCCTAATAATCCGATTCCACCCCCTAACCTCAAACAAT
AGTACTATTATAACAGCCATACTATGTCTTGGTGCAATCACCACATTATTCACAGCAATCTGTGCTCTCA
CCCAAAACGACATCAAAAAAATCGTAGCTTTCTCAACATCCAGCCAACTAGGCCTTATAATAGTCACATT
AGGGATTAACCAACCCTACCTTGCTTTCCTCCACATTTGCACCCATGCATTCTTCAAAGCCATATTATTC
ATATGCTCCGGATCAATCATCCATATCCTCAACGATGAACAAGACATTCGAAAAATAGGCAATATAATAA
AAGCAATACCATTCACATCATCTTGTCTCATTATCGGAAGCCTAGCCCTTACCGGAATACCTTTCCTCAC
AGGATTCTATTCAAAAGATCTCATCATCGAAGCCATCAACACGTGTAACACCAACGCCTGAGCCCTAATA
ATCACTTTAATCGCCACATCCATAACTGCTGTGTACAGCATACGGATCATCTACTTCGTCACCATGACAA
AACCACGATACTCCCCACTAATTACTATTAATGAAAACAACCCAAACCTCATTAATCCAATCAAACGCCT
AGCATTAGGAAGCATCCTAGCAGGCTTCCTTATCTCACTAAATATTCCTCCAACTAACATTCAAATTCTC
ACAATACCCTGACATTTAAAAATAACAGCCCTACTTATTACAATCCTAGGATTTGCCATTGCCCTAGAAC
TTAACAATTTAACACTAAATCTATCAATAAGCAAACCCACCAAACTATCATCATTCTCAACCTCCCTAGG
CTACTACCCACCAATTATACCCCGAATTATTCCTCAAAAAACTCTAAATTCTAGCTACAAATTATCCTTA
AACCTACTAGACCTAATCTGATCAGAAAAGACAATCCCAAAATCAACCTCAATCACCCAAACCCAACTAT
CTAAAATAATATCCAACCAAAAAGGACTAATCAAACTATATTTCCTATCATTTCTCATCACTATTTCACT
AATTTTTATCTTACACACACTTAATCCCGAGTGATTTCAATAATAATAAAAATCCCCGCAAACAATGACC
ACCCAGCCACCACTATCATTCAAGTAGCACAACTATAAATAGCCGCAACCCCAATCCCCCCCTCCAACAT
AACCCCAACATCATCAATCTCATACATTAATCAATCGCCTAGACTATCAAAATCAACTAACTCCACCTTA
TTATTCAAACTAAACAAGTAGAACACTACCAACTCCATAAAAAGCCCTAAAACAAAAAAACTAAAAATAA
ACCAATTAGACCCTCAAGTTTCCGGATATTCCTCAGTAGCCATAGCAGTTGTATACCCAAATACAACCAA
CATCCCACCCAAATAAATTAAAAATACTATTAAACCTAAAAACGAACCCCCAAACCCTAAAACTATTAAG
CACCCAATACATCCACTAACAATCAATCCAAACCCACCATAAATAGGTGAAGGCTTCAACGCCAACCCTA
GACAACCAGTCAAAAACAGTAAACTTAAAATAAACATATAATTTGTCATTATTTCTACACAGCATTTAAC
TGTGACTAATGACATGAAAAATCATCGTTGTAATTCAACTATAGAAACATCTAATGACAAACATCCGAAA
ATCTCACCCCCTATTCAAAATCATCAACCACTCCTTTATCGACCTACCGGCCCCATCTAACATCTCATCA
TGATGAAACTTCGGTTCTCTACTAGGAGTATGCCTCATAGTACAAATCCTCACAGGCTTATTCCTAGCAA
TACACTACACGTCTGATACCATAACAGCATTCTCATCAGTCACCCACATCTGCCGAGACGTAAACTACGG
CTGACTAATCCGATACCTACAAGCCAACGGCGCCTCAATATTTTTCATCTGCCTATTCCTCCATGTGGGA
CGAGGACTATACTATGGATCCTACACTTTCCTAGAAACCTGAAACATTGGGATCATCCTACTATTTGCAG
TCATAGCAACTGCATTCATGGGCTATGTACTCCCATGAGGACAAATATCATTCTGAGGAGCTACAGTAAT
TACAAACCTATTATCAGCTATCCCTTACATTGGGACTACCCTAGTCGAATGAATCTGAGGAGGCTTCTCA
GTAGACAAAGCAACCCTAACACGCTTCTTCGCATTCCACTTCATCCTCCCATTCATTATCGCCGCCCTTG
CAATTGTACATCTTCTTTTCCTCCACGAAACAGGATCAAATAACCCCACAGGATTAAACTCCGACGCAGA
CAAAATCCCATTCCATCCATATTATACAATTAAAGACCTCCTAGGTGTATTTATATTACTATTATTCCTA
ATAACCCTAGTACTATTCTTCCCAGACCTACTAGGAGACCCAGACAATTATACACCCGCTAACCCCCTCA
ACACCCCACCCCACATCAAACCAGAATGATACTTTCTCTTTGCCTACGCTATTCTACGCTCCATTCCCAA
CAAACTAGGAGGGGTCGTAGCCCTAATCTTATCAATCCTAATCTTAGCCTTCCTACCATTCCTGCATACC
TCAAAACAACGCAGCTTAACATTCCGCCCAATCACCCAAATCCTTTACTGAATCCTAGTAGCCAACCTCC
TAGTCTTAACATGAATCGGAGGCCAACCAGTAGAACACCCATTTATCATTATTGGTCAACTAGCCTCCAT
CAGTTATTTTTCAATTATCCTCATTCTCATACCAATCTCTGGAATTGTTGAAGACAAAATGTTAAAATGA
AATTAATGTCCCGATAGTATAAAAATTACTCTGGTCTTGTAAACCAAAAATGAAGAGTCAGTCTTCTCAG
GACAATCAAGAAGAAGGAACTACCTCCCCACCATCAACACCCAAAGCTGATATTCTACTTAAACTACTTC
TTGTCAGTACATAAAATGATATGGACATTAAAACATTTATGTATATCGTACATTAAATTATTTTCCCCAA
GCATATAAGCATGTAATATATATCTAATGATTTAGGACATACATTTAAACTCAACTATAAATTCACAACA
ACATGTCTATTCTCAAATACATTAAGATAATGCTTATTAGACATATCTGTGTTATTAGACATGCACCATT
AAGTCATAAACCTTTCTCTTCCATATGACTATCCCTGTCCCCAATTGGTCTCTATTTCTACCATCCTCCG
TGAAATCAACAACCCGCCCACTCGTCCCCCTCTTCTCGCTCCGGGCCCATTCGTCCTGGGGGTGACTATA
CTGAAACTTTACCAGGCATCTGGTTCTTACTTCAGGGCCATCAATTGGTTCATCGTCCATACGTTCCCCT
TAAATAAGACATCTCGATGGTAACGGGTCTAATCAGCCCATGATCAACATAACTGTGGTGATATACATTT
GGTATTTTTTAATTTTCGGATGCCTTCCTCAACATAGCCGTCAAGGCATGAAGGTCAGCACAAAGTCCTG
TGGAACCTTTTAGTTAAGGGTCATTTATCCTCATAGACAAAGCTCGAAAGACTATTTTATTCATGTTTGT
AAGACATAAATATTTATAAATACTGAAAAATCTGTCAACAAACCCCCCCACCCCCTACACCTGAAACTTC
AATGCCAAACCCCAAAAACATTAAAGCAAGAATTAAATAAAACAAAAAGCTACTTAATTCTTAAAAGGCT
TCTCCATTCTAGTAGACCACAAAATTTTAACTTAAATCTTAGCATTGGTAAAATTTCCCGACACAAAATC
TTTCCTCCTAACTAAACCCTCTTTACTTGCCTACCCTCAGAAAATTCCACATACACCAAA