spacer

EBI Dbfetch

>IPDMHC:MHC00001 MHC00001 Aona-DQA1*27:01, Non-Human Primate MHC Class II sequence (partial)
ctgaccatgttgccgcttacggtataaacttgtaccagtcttatggtctctctggccagt
acacccacgaatttgatggagatgaggagttctacgtggacctgggaagaaaggagactg
tctggcgattgcctgtgttcagcaaatttgcaggttttgaccctcagggtgcactgacaa
acatcgctgcgggaaaacacaacttggacatcctgattaaacgctc


spacer
spacer