Dbfetch

>IMGTLIGM:AF003293 AF003293.1 Mus musculus Ig kappa light chain variable region gene, partial cds.
cttaataatttgcataccctcactgcatcgccttggggacttctttatataacagtcaaa
catatcctgtgccattgtcattgcagtcaggactcagcatggacatgagggctcctgcac
agatttttggcttcttgttgctcttgtttccaggtaaaatgaactaaaattggaatttca
ctgttccactgtggttagtgttgactggcatttgggggatgtcctcttttatcatgctta
tctatgtggatattcattatgtctccactcctaggtaccagatgtgacatccagatgacc
cagtctccatcctccttatctgcctctctgggagaaagagtcagtctcacttgtcgggca
agtcaggacattggtagtagcttaaactggcttcagcaggaaccagatggaactattaaa
cgcctgatctacgccacatccagtttagattctggtgtgcccaaaaggttcagtggcagt
aggtctgggtcagattattctctcaccatcagcagccttgagtctgaagattttgtagac
tattactgtctacaatatgctagttctcct