Dbfetch

>IMGTLIGM:A00673 A00673.1 Artificial sequence for plasmid pSV-V-NP gamma-SNase
tcatcagctcctaacctcgaggatccaacagtatatagtgcaact