spacer

EBI Dbfetch

>IMGTLIGM:A00673 A00673.1 Artificial sequence for plasmid pSV-V-NP gamma-SNase; unassigned DNA; unknown configuration; Ig-Heavy; regular.
tcatcagctcctaacctcgaggatccaacagtatatagtgcaact


spacer
spacer