spacer

EBI Dbfetch

>IMGTHLA:HLA00001 HLA00001.1 HLA-A*01:01:01:01, Human MHC Class I sequence
caggagcagaggggtcagggcgaagtcccagggccccaggcgtggctctcagggtctcag
gccccgaaggcggtgtatggattggggagtcccagccttggggattccccaactccgcag
tttcttttctccctctcccaacctacgtagggtccttcatcctggatactcacgacgcgg
acccagttctcactcccattgggtgtcgggtttccagagaagccaatcagtgtcgtcgcg
gtcgctgttctaaagtccgcacgcacccaccgggactcagattctccccagacgccgagg
atggccgtcatggcgccccgaaccctcctcctgctactctcgggggccctggccctgacc
cagacctgggcgggtgagtgcggggtcgggagggaaaccgcctctgcggggagaagcaag
gggccctcctggcgggggcgcaggaccgggggagccgcgccgggaggagggtcgggcagg
tctcagccactgctcgcccccaggctcccactccatgaggtatttcttcacatccgtgtc
ccggcccggccgcggggagccccgcttcatcgccgtgggctacgtggacgacacgcagtt
cgtgcggttcgacagcgacgccgcgagccagaagatggagccgcgggcgccgtggataga
gcaggaggggccggagtattgggaccaggagacacggaatatgaaggcccactcacagac
tgaccgagcgaacctggggaccctgcgcggctactacaaccagagcgaggacggtgagtg
accccggcccggggcgcaggtcacgacccctcatcccccacggacgggccaggtcgccca
cagtctccgggtccgagatccaccccgaagccgcgggactccgagacccttgtcccggga
gaggcccaggcgcctttacccggtttcattttcagtttaggccaaaaatccccccgggtt
ggtcggggcggggcggggctcgggggactgggctgaccgcggggtcggggccaggttctc
acaccatccagataatgtatggctgcgacgtggggccggacgggcgcttcctccgcgggt
accggcaggacgcctacgacggcaaggattacatcgccctgaacgaggacctgcgctctt
ggaccgcggcggacatggcagctcagatcaccaagcgcaagtgggaggcggtccatgcgg
cggagcagcggagagtctacctggagggccggtgcgtggacgggctccgcagatacctgg
agaacgggaaggagacgctgcagcgcacgggtaccaggggccacggggcgcctccctgat
cgcctatagatctcccgggctggcctcccacaaggaggggagacaattgggaccaacact
agaatatcaccctccctctggtcctgagggagaggaatcctcctgggtttccagatcctg
taccagagagtgactctgaggttccgccctgctctctgacacaattaagggataaaatct
ctgaaggagtgacgggaagacgatccctcgaatactgatgagtggttccctttgacaccg
gcagcagccttgggcccgtgacttttcctctcaggccttgttctctgcttcacactcaat
gtgtgtgggggtctgagtccagcacttctgagtctctcagcctccactcaggtcaggacc
agaagtcgctgttcccttctcagggaatagaagattatcccaggtgcctgtgtccaggct
ggtgtctgggttctgtgctctcttccccatcccgggtgtcctgtccattctcaagatggc
cacatgcgtgctggtggagtgtcccatgacagatgcaaaatgcctgaattttctgactct
tcccgtcagacccccccaagacacatatgacccaccaccccatctctgaccatgaggcca
ccctgaggtgctgggccctgggcttctaccctgcggagatcacactgacctggcagcggg
atggggaggaccagacccaggacacggagctcgtggagaccaggcctgcaggggatggaa
ccttccagaagtgggcggctgtggtggtgccttctggagaggagcagagatacacctgcc
atgtgcagcatgagggtctgcccaagcccctcaccctgagatggggtaaggagggagatg
ggggtgtcatgtctcttagggaaagcaggagcctctctggagacctttagcagggtcagg
gcccctcaccttcccctcttttcccagagctgtcttcccagcccaccatccccatcgtgg
gcatcattgctggcctggttctccttggagctgtgatcactggagctgtggtcgctgccg
tgatgtggaggaggaagagctcaggtggagaaggggtgaagggtggggtctgagatttct
tgtctcactgagggttccaagccccagctagaaatgtgccctgtctcattactgggaagc
accttccacaatcatgggccgacccagcctgggccctgtgtgccagcacttactcttttg
taaagcacctgttaaaatgaaggacagatttatcaccttgattacggcggtgatgggacc
tgatcccagcagtcacaagtcacaggggaaggtccctgaggacagacctcaggagggcta
ttggtccaggacccacacctgctttcttcatgtttcctgatcccgccctgggtctgcagt
cacacatttctggaaacttctctggggtccaagactaggaggttcctctaggaccttaag
gccctggctcctttctggtatctcacaggacattttcttcccacagatagaaaaggaggg
agttacactcaggctgcaagtaagtatgaaggaggctgatgcctgaggtccttgggatat
tgtgtttgggagcccatgggggagctcacccaccccacaattcctcctctagccacatct
tctgtgggatctgaccaggttctgtttttgttctaccccaggcagtgacagtgcccaggg
ctctgatgtgtctctcacagcttgtaaaggtgagagcttggagggcctgatgtgtgttgg
gtgttgggtggaacagtggacacagctgtgctatggggtttctttgcgttggatgtattg
agcatgcgatgggctgtttaaggtgtgacccctcactgtgatggatatgaatttgttcat
gaatatttttttctatagtgtgagacagctgccttgtgtgggactgagaggcaagagttg
ttcctgcccttccctttgtgacttgaagaaccctgactttgtttctgcaaaggcacctgc
atgtgtctgtgttcgtgtaggcataatgtgaggaggtggggagagcaccccacccccatg
tccaccatgaccctcttcccacgctgacctgtgctccctctccaatcatctttcctgttc
cagagaggtggggctgaggtgtctccatctctgtctcaacttcatggtgcactgagctgt
aacttcttccttccctattaaaa


spacer
spacer