spacer

EBI Dbfetch

>ENA|AJ242600|AJ242600.1 Loligo opalescens mRNA for glutamate receptor (gluR gene), splice variant 1 
CACGAGCGAGCATGTAACGTCACGAAGGCACCACCCAGACTATGGAGGATCTGATCCCAG
TTTTTCCGCGTGACCCTTACGACCAGTGACAACGATTACAACACCGTGTAGTTCTACTGT
GGTACCACCAACAGACCCAGGATGGCTCCAGCCATCGGACTACCACCGGCCAGCACGTTC
CCCCAGCTGTGTTTCGTTATTCTCGCTCTATCCGGATCTGCAATAGCAGCTAAGGGGTCT
ACAAAACGCATATCAATAGGCTCAGTATTCGACGTTGAATCGGAAAAAATCCAGACGGCG
TTTCGCTTTGCTGTGGATCGCTTTAACACAATCGAGAATTCCGCCCAACTGAAATTGAAC
CCCCTTTCGCGAGGAAATCGACGAACAGATAGTTTCTCCCTCGGCAATGCACTCTGTTCC
ATTATGTCCAAGGGTGTTTTTGCTGTATTCGGAAAGGCGAACTCTTCAATGCTGGCGACA
GTCAAGTCGTACAGTGACACCTTCCAAATTCCGTATCTAACTACAAGTATGGCCATGAAC
ACAACAGATCAGTCGCCCTACATGCTATTTTTGCGTCCCATTAACATCCGGGCTATTGTC
GACCTCATAGAGCACTTGGGGTGGAGGGTGGTTCATTACATATATATTTCGAACGAAGGT
TTAATGCGTGTTCAGCAACTGTTTCAGGTGATGGGGAAGAGCGATCTTCAAATGACCCTG
AACGTCAAACGTGCGTCCGATGTCACTAGTTACGTAATTCTTAAAGAACTTCATCATACC
AACCCCGAGTTGGACATTCATGCCGTGCTGGATATGTCAATACCTATGGCGAGTGAACTA
ATGAATCTGCTGAGTGAGGATCCACGAGTCCACAACAGACGATTTCACTTCTTGCTAGTA
GAGCCAGGAATCCAAGAATTGGACTTTGCCAAGATTGGATTGTATGGCTACAATGTAAGT
GGCTTCCAACTGGTCGACTTCAATAATATGACTGTTCGGCTATTTCTCTCGGACTGGACG
AAAATCGACCCAGCAGAATGGCCCGGGGCTGGGGTGAAAACAATCACGTACGAGGCGGCG
TTGGCAGTCGACGCCGTCAGCTTGTTTACGCGTGCAATGAAGAATTTGTCCAATCTCGGT
TTATTTGAGTCCCTTTTCATCCGCGCTAGGAGTGGAGCCAACAGCAGCAAAACTTGTGCA
GCCGAGCGTCTGAATGTGTGGAACAAAGGTAAACATGTGCTCAAGGCAATGAAAGAGACG
GAGTTTGATGGCCTTACTGGTCGAGTGGCATTTGACGATAGAGGTCACCGCAAAGAGTTC
ACTCTGGATGTTCTTGATATAGGAATTACCCGCGGCGCAGTCAAGATTGGTTACTGGACC
CCGAGGGATGGATTGACTATGCTCAAGCGTAAAATGGTCCGCCCTATTAATGCGCCCAGC
TCTGAGAACAGAACAAGGATTGTGACTACGATCCAGACTCCTCCTTACATAATGAAGAAA
CCGAAGCCGATAGACGGTCACCCTCTTATAGGCAATGACAAGTACGAAGGATATTGTGTA
GACCTTGCTCGAAAGGTTGCGCATGAAGTTGGCTTTGACTACGTGTTCCAGATGGTAAAA
GATGGCGCCTACGGTTCGAAGCTCGCAAATGATTCGTGGAATGGTATGGTAGGAGAACTA
ATAAGGCTGGAGGCGGATATGGCCATTGCCCCACTGACGATCTCAGCTGTGCGGGAGAGG
GTCATTGATTTCTCCAAACCCTTTATGAGCCTGGGAATCAGTATCATGATAAAAAAACCA
GCGGACCAGAAAGCTCACGTGTTCTCGTTCCTCGACCCGTTATCCTACGAGATCTGGATG
TGCATCTTGTTTGCCTTCATTGGAGTCAGCGTGGTCTTGTTTTTGGTCAGTCGCTTCAGC
CCTAGCGGGTGGCACGTGGAAGATGAGTCGAATATTACGAATGATTTTACCATTTCCAAC
AGCCTCTGGTTTTCGCTGGGCGCCTTCATGCAACAGGGATGTGATTTCTCACCTCGATCG
ATTTCTGGACGTATAGTCGGAAGCGTATGGTGGTTCTTCACCCTGATCATTATTTCGTCT
TACACTGCCAACCTGGCCGCCTTCCTCACAGTGGAAAGAATGTCCACTCCGATTGAATCC
GCTGAGGATCTTGCCAAACAGACGGAAATCGAATATGGAACTTTAAGGTCAGGCACAACA
GAAGCTTTCTTTAAGACTTCTAAGGTAGCGGTCTATGAGCGAATGTGGGCTTATATGACA
TCAAAGACCCCTAGTGTCTTTACGGATAAAATCCAAGATGGCATAACCAGCGTTCGAGAT
TCCAACGGAAAGTATGCTTTCCTCGTCGAATCCTCTACTAACGATTATATCAACAACCGT
TTGCCCTGTGATACAATGAAAGTCGGATCAAATCTTGACTCAAAAGGTTTCGGCATCGCT
ACACCAGCCGGCTCCGACTTAGGAGATAAACTCACACTTGCTGTTCTCAAGTTGCGCGAA
GATGGAGAGTTAGATAAGCTGCAAAAATTCTGGTGGGTGGGGAAAGGTCAGTGTACGCCA
CAGGACAAGAATACTGATGGAGGCCAAAGTGCCCTTACATTGTCCAACGTGGCTGGCATT
TTCTACATCCTTATCGGAGGACTCATATTAGCCATCATCGTCGCAGTCGCGGAATTCCTT
TATAAATCTAAAGTTGACAGTAAAAAATCAAAGACATCATTTGGACTTGCCCTGAAATCA
AAAGCCAGACTTTCTTTCCGAAGCCATCCTGCTCGGGAAGATAGCAGCTCGGGAACCCTT
CTCAGAAAGTCCATGTCAAGGTATACCTACACGGGCCCATCCCAGAGTATGGGATTTGAC
ACGGTACCGGAAGGTAACACTCACACTCAAGTGTGAGATGTTAAATTGACCAACTGCAGT
GAACCAGCGAGTGACACTCAGTCGTTACCTGCCATTCAGGACATTTTTTTGCTCATTATA
AACACAATTCAGAACGAAAGAAGAAAAAATTGTTTAATGAAAGGAAGAAAAGAAACAGGA
TCGAAACCCTGTTCGTAAATGCTCACTGGAAAGGGAGACACTTGTTCGCCTAAAACAAAA
GGGAATTCTAATGTTCAGGTGGAAACACGAATGAGTGTATCCGCGTGTGGGTCAGCTGGG
ATTATTGTTAGCAAGATGGCAGCGTACCCACACTGGCAAAAAAAAAAAAAAAAA
>ENA|D87894|D87894.1 Rhizopus oligosporus DNA for chitinase, complete cds. 
AATAATGAAACCACTAATTCAAGAGTATTGTGTGTATGCCTTGTTATTTCTTCATGATCC
AAGGGTTTCTCGCGTCAACAGTATGTTCTGAGCTTTTTGTTGTTGTCATATCTACTTATT
CATGTTTGGAATGAAATGTCAATTGTCTCATCTTCCTAAAGTGTATACAAGTTTTTGTTC
TACAATAGAACTCTACAACAGCTGAATATAATGATAAAAATAGATATTTTCTTGGCTCTT
TTTTTCATTTTACTTTTCTTGACTTCTCATATGGAACCACCTCCAGCAACAAACGGACCT
GTTATTGCAGGTTACTTTGCTAATTGGTAACATTGCATAACAAAGGCAAAAGGGGAGCTT
AACTCAACTAACTAGAATGTAATAGGGGAATCTACGATAGAAAATACAATGTTGTTGATG
TAGCTACTCAAGCCAATAAGTTGACTCATATTTTATATGCATTTGCTAATGTCCAACCGG
ATGGTCAAGTTGTTCTTGGGGTAGTATAAATTATTGCAAGATATAGAATATAATAATAAT
AATTATAAATATAGGACGCTTATGCAGATATTGAAAAGCATTTTCCAGCAAGTAAAAAAA
TAATAATAAACAAATATAAAACCTCTCCCTAATTCATACATAATATGTAGACCAAGCAGT
CAACCGAAAAGAAGATGGATGGAATGATCCAGGCAAGAACCTTTACGGTAACTTTAAGCA
GTTCTATTTACTCAAGCAACAACACCGTCATCTCAAAGTGTCGCTTAGCATTGGCGGATA
TACATGGTCCACTCATTTTGGCCCGGTTGCGCGTGATCCTCAGAAACGCAGATTGTTTGT
AGATAGCAGCATCAAACACCTAGCCAACTTGGGTCTGGACGGGCTAGATATTGACTGGGA
GTACCCCAAAGATGATGAGGAAGCGTTTTATTATGTGCATCTGCTCTATGAGTTGCGACT
GGCGCTTGACAGATATCAACAACAGTGCCAACAACTGATTCAGTCGCGACTATTACTCAC
AGTAGCCGTGCCTTGTGGCCCTGACCATTATCGTAAATTGAGATTGACCGAAATGCAACC
TTACGTGGACCTATTTTACCTCATGGCATACGACTATGCTGGTTCATGGGATTCTTTCGC
AGATCATCAAGCGGCTGTTTATGGTGGCAGATTGAATACAGAACAAGCAGTACAGCACTA
TATCGCCTGTGGTATCCCTCCATATAAGCTAGTCGTAGGCATGCCTTTATATGGTCGAGG
ATTCTGCAATACGGCGGGGCCAGGTCATCCTTTCCAAGGACTGCCTCGCGGTACCTGGGA
AGAGGGTCAATTTAATTACAAGACATTGCCAAAACCGGGCGCTGTAGAATACCACGACTT
TAATCGACTAGCCTCATGGTCTTATGACCCTCAGGCTCGTGAATTTATCACCTATGATAC
ACCTCAGATGGTTGCTGCAAAGTGCAATTACATACAACAAAGACGGTTGGGTGGTGCCAT
GTTTTGGGAACTAAGTGCGGATTGTCCTCAGAGAAGCCTGATCAACGCGGCCTATGACGG
CTTAGGAAGGCGATTAGATCAGGTACCTAATCATTTAGATTATCCAATGAGTGAGTATGA
CAATGTACGAAACGGTATGAAATAAAGCATCCCTTTTGGCAGGTGGTTCTCAAA
>ENA|J00231|J00231.1 Human Ig gamma3 heavy chain disease OMM protein mRNA. 
CCTGGACCTCCTGTGCAAGAACATGAAACANCTGTGGTTCTTCCTTCTCCTGGTGGCAGC
TCCCAGATGGGTCCTGTCCCAGGTGCACCTGCAGGAGTCGGGCCCAGGACTGGGGAAGCC
TCCAGAGCTCAAAACCCCACTTGGTGACACAACTCACACATGCCCACGGTGCCCAGAGCC
CAAATCTTGTGACACACCTCCCCCGTGCCCACGGTGCCCAGAGCCCAAATCTTGTGACAC
ACCTCCCCCATGCCCACGGTGCCCAGAGCCCAAATCTTGTGACACACCTCCCCCGTGCCC
NNNGTGCCCAGCACCTGAACTCTTGGGAGGACCGTCAGTCTTCCTCTTCCCCCCAAAACC
CAAGGATACCCTTATGATTTCCCGGACCCCTGAGGTCACGTGCGTGGTGGTGGACGTGAG
CCACGAAGACCCNNNNGTCCAGTTCAAGTGGTACGTGGACGGCGTGGAGGTGCATAATGC
CAAGACAAAGCTGCGGGAGGAGCAGTACAACAGCACGTTCCGTGTGGTCAGCGTCCTCAC
CGTCCTGCACCAGGACTGGCTGAACGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGC
CCTCCCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGACAGCCCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGAGGAGATGACCAAGAACCAAGTCAGCCTGACCTG
CCTGGTCAAAGGCTTCTACCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCC
GGAGAACAACTACAACACCACGCCTCCCATGCTGGACTCCGACGGCTCCTTCTTCCTCTA
CAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACATCTTCTCATGCTCCGT
GATGCATGAGGCTCTGCACAACCGCTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAA
ATGAGTGCCATGGCCGGCAAGCCCCCGCTCCCCGGGCTCTCGGGGTCGCGCGAGGATGCT
TGGCACGTACCCCGTGTACATACTTCCCAGGCACCCAGCATGGAAATAAAGCACCCAGCG
CTGCCCTGG
>ENA|K00650|K00650.1 Human fos proto-oncogene (c-fos), complete cds. 
GCAGGAACAGTGCTAGTATTGCTCGAGCCCGAGGGCTGGAGGTTAGGGGATGAAGGTCTG
CTTCCACGCTTTGCACTGAATTAGGGCTAGAATTGGGGATGGGGGTAGGGGCGCATTCCT
TCGGGAGCCGAGGCTTAAGTCCTCGGGGTCCTGTACTCGATGCCGTTTCTCCTATCTCTG
AGCCTCAGAACTGTCTTCAGTTTCCGTACAAGGGTAAAAAGGCGCTCTCTGCCCCATCCC
CCCCGACCTCGGGAACAAGGGTCCGCATTGAACCAGGTGCGAATGTTCTCTCTCATTCTG
CGCCGTTCCCGCCTCCCCTCCCCCAGCCGCGGCCCCCGCCTCCCCCCGCACTGCACCCTC
GGTGTTGGCTGCAGCCCGCGAGCAGTTCCCGTCAATCCCTCCCCCCTTACACAGGATGTC
CATATTAGGACATCTGCGTCAGCAGGTTTCCACGGCCTTTCCCTGTAGCCCTGGGGGGAG
CCATCCCCGAAACCCCTCATCTTGGGGGGCCCACGAGACCTCTGAGACAGGAACTGCGAA
ATGCTCACGAGATTAGGACACGCGCCAAGGCGGGGGCAGGGAGCTGCGAGCGCTGGGGAC
GCAGCCGGGCGGCCGCAGAAGCGCCCAGGCCCGCGCGCCACCCCTCTGGCGCCACCGTGG
TTGAGCCCGTGACGTTTACACTCATTCATAAAACGCTTGTTATAAAAGCAGTGGCTGCGG
CGCCTCGTACTCCAACCGCATCTGCAGCGAGCAACTGAGAAGCCAAGACTGAGCCGGCGG
CCGCGGCGCAGCGAACGAGCAGTGACCGTGCTCCTACCCAGCTCTGCTTCACAGCGCCCA
CCTGTCTCCGCCCCTCGGCCCCTCGCCCGGCTTTGCCTAACCGCCACGATGATGTTCTCG
GGCTTCAACGCAGACTACGAGGCGTCATCCTCCCGCTGCAGCAGCGCGTCCCCGGCCGGG
GATAGCCTCTCTTACTACCACTCACCCGCAGACTCCTTCTCCAGCATGGGCTCGCCTGTC
AACGCGCAGGTAAGGCTGGCTTCCCGTCGCCGCGGGGCCGGGGGCTTGGGGTCGCGGAGG
AGGAGACACCGGGCGGGACGCTCCAGTAGATGAGTAGGGGGCTCCCTTGTGCCTGGAGGG
AGGCTGCCGTGGCCGGAGCGGTGCCGGCTCGGGGGCTCGGGACTTGCTCTGAGCGCACGC
ACGCTTGCCATAGTAAGAATTGGTTCCCCCTTCGGGAGGCAGGTTCGTTCTGAGCAACCT
CTGGTCTGCACTCCAGGACGGATCTCTGACATTAGCTGGAGCAGACGTGTCCCAAGCACA
AACTCGCTAACTAGAGCCTGGCTTCTTCGGGGAGGTGGCAGAAAGCGGCAATCCCCCCTC
CCCCGGCAGCCTGGAGCACGGAGGAGGGATGAGGGAGGAGGGTGCAGCGGGCGGGTGTGT
AAGGCAGTTTCATTGATAAAAAGCGAGTTCATTCTGGAGACTCCGGAGCGGCGCCTGCGT
CAGCGCAGACGTCAGGGATATTTATAACAAACCCCCTTTCAAGCAAGTGATGCTGAAGGG
ATAACGGGAACGCAGCGGCAGGATGGAAGAGACAGGCACTGCGCTGCGGAATGCCTGGGA
GGAAAAGGGGGAGACCTTTCATCCAGGATGAGGGACATTTAAGATGAAATGTCCGTGGCA
GGATCGTTTCTCTTCACTGCTGCATGCGGCACTGGGAACTCGCCCCACCTGTGTCCGGAA
CCTGCTCGCTCACGTCGGCTTTCCCCTTCTGTTTTGTTCTAGGACTTCTGCACGGACCTG
GCCGTCTCCAGTGCCAACTTCATTCCCACGGTCACTGCCATCTCGACCAGTCCGGACCTG
CAGTGGCTGGTGCAGCCCGCCCTCGTCTCCTCTGTGGCCCCATCGCAGACCAGAGCCCCT
CACCCTTTCGGAGTCCCCGCCCCCTCCGCTGGGGCTTACTCCAGGGCTGGCGTTGTGAAG
ACCATGACAGGAGGCCGAGCGCAGAGCATTGGCAGGAGGGGCAAGGTGGAACAGGTGAGG
AACTCTAGCGTACTCTTCCTGGGAATGTGGGGGCTGGGTGGGAAGCAGCCCCGGAGATGC
AGGAGCCCAGTACAGAGGATGAAGCCACTGATGGGGCTGGCTGCACATCCGTAACTGGGA
GCCCTGGCTCCAAGCCCATTCCATCCCAACTCAGACTCTGAGTCTCACCCTAAGAAGTAC
TCTCATAGTTTCTTCCCTAAGTTTCTTACCGCATGCTTTCAGACTGGGCTCTTCTTTGTT
CTCTTGCTGAGGATCTTATTTTAAATGCAAGTCACACCTATTCTGCAACTGCAGGTCAGA
AATGGTTTCACAGTGGGGTGCCAGGAAGCAGGGAAGCTGCAGGAGCCAGTTCTACTGGGG
TGGGTGAATGGAGGTGATGGCAGACACTTTTACTGAATGTCGGTCTTTTTTTGTGATTAT
TCTAGTTATCTCCAGAAGAAGAAGAGAAAAGGAGAATCCGAAGGGAAAGGAATAAGATGG
CTGCAGCCAAATGCCGCAACCGGAGGAGGGAGCTGACTGATACACTCCAAGCGGTAGGTA
CTCTGTGGGTTGCTCCTTTTTAAAACTTAAGGGAAAGTTGGAGATTGAGCATAAGGGCCC
TTGAGTAAGACTGTGTCTTATGCTTTCCTTTATCCCTCTGTATACAGGAGACAGACCAAC
TAGAAGATGAGAAGTCTGCTTTGCAGACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAA
AACTAGAGTTCATCCTGGCAGCTCACCGACCTGCCTGCAAGATCCCTGATGACCTGGGCT
TCCCAGAAGAGATGTCTGTGGCTTCCCTTGATCTGACTGGGGGCCTGCCAGAGGTTGCCA
CCCCGGAGTCTGAGGAGGCCTTCACCCTGCCTCTCCTCAATGACCCTGAGCCCAAGCCCT
CAGTGGAACCTGTCAAGAGCATCAGCAGCATGGAGCTGAAGACCGAGCCCTTTGATGACT
TCCTGTTCCCAGCATCATCCAGGCCCAGTGGCTCTGAGACAGCCCGCTCCGTGCCAGACA
TGGACCTATCTGGGTCCTTCTATGCAGCAGACTGGGAGCCTCTGCACAGTGGCTCCCTGG
GGATGGGGCCCATGGCCACAGAGCTGGAGCCCCTGTGCACTCCGGTGGTCACCTGTACTC
CCAGCTGCACTGCTTACACGTCTTCCTTCGTCTTCACCTACCCCGAGGCTGACTCCTTCC
CCAGCTGTGCAGCTGCCCACCGCAAGGGCAGCAGCAGCAATGAGCCTTCCTCTGACTCGC
TCAGCTCACCCACGCTGCTGGCCCTGTGAGGGGGCAGGGAAGGGGAGGCAGCCGGCACCC
ACAAGTGCCACTGCCCGAGCTGGTGCATTACAGAGAGGAGAAACACATCTTCCCTAGAGG
GTTCCTGTAGACCTAGGGAGGACCTTATCTGTGCGTGAAACACACCAGGCTGTGGGCCTC
AAGGACTTGAAAGCATCCATGTGTGGACTCAAGTCCTTACCTCTTCCGGAGATGTAGCAA
AACGCATGGAGTGTGTATTGTTCCCAGTGACACTTCAGAGAGCTGGTAGTTAGTAGCATG
TTGAGCCAGGCCTGGGTCTGTGTCTCTTTTCTCTTTCTCCTTAGTCTTCTCATAGCATTA
ACTAATCTATTGGGTTCATTATTGGAATTAACCTGGTGCTGGATATTTTCAAATTGTATC
TAGTGCAGCTGATTTTAACAATAACTACTGTGTTCCTGGCAATAGTGTGTTCTGATTAGA
AATGACCAATATTATACTAAGAAAAGATACGACTTTATTTTCTGGTAGATAGAAATAAAT
AGCTATATCCATGTACTGTAGTTTTTCTTCAACATCAATGTTCATTGTAATGTTACTGAT
CATGCATTGTTGAGGTGGTCTGAATGTTCTGACATTAACAGTTTTCCATGAAAACGTTTT
ATTGTGTTTTTAATTTATTTATTAAGATGGATTCTCAGATATTTATATTTTTATTTTATT
TTTTTCTACCTTGAGGTCTTTTGACATGTGGAAAGTGAATTTGAATGAAAAATTTAAGCA
TTGTTTGCTTATTGTTCCAAGACATTGTCAATAAAAGCATTTAAGTTGAATGCGACCAAC
CTTGTGCTCTTTTCATTCTGGAAGTCTTGTAAGTTTCTGAAAGGTATTATTGGAGACCAG
TTTGTCAAGAAGGGTAGCTGCTGGAGGGGGACACACCCTCTGTCTGATCCCTTATCAAAG
AGGACAAGGAAACTATAGAGCTGATTTTAGAATATTTTACAAATACATGCCTTCCATTGG
AATGCTAAGATTTTCTACTGCTTCTGGGGACGGGAAACCGCTGTGTAACAGCTTTTGTGG
GAATACATTTTTTCTGTTTCAGTACTCGCAGGGGGAAATATTTAAATTTTGTTGTGCTAA
TATTAAATTCAGATGTTTTGATCTTAAAGGAACCCTTTAAGCAAACAGAACCTAGCTTTG
TACAGACTATTTTAACTTTTTATTCTCACAAAATCACGTGGAGGGTTATTCTACTTCAAA
GATGAGCAAATTGAAGAATGGTTAGAATAAACAACTTTCTTGATATTCCGTTATCGGCAT
TAGAATCTTCCTGCTCGTTATCGTATCCAGCAGGCTGAACTGCCTCTTGATACTTGGTTA
AAAAAAATTTTCAGGCCGGGCGCGGTGGCCCATGCCTGTAATCCTAGCACTTTGGGAGGC
CGAGGCAGGCGGATCACCTGAGGTCGGGAGTTCGAGACCAGCCTGACCAACATGGAGAAA
CCCCGTCTTTACTAAAAATACAAAATTAGCCTGGTGTGGTGGTGCATGCCTGTAATCCTA
GCTACTTGAGAGGCTGAGACAGGAAAATCACTTGAACTCGGGAGGCGGATGTTGCAGCGA
ACTGAGATTGCGCCATTGCACTCCAGCCTGGGCAACAAGATTGAAACTCTGTTTAAAAAA
AAAAGTTTTCACTAATGTGTACATTTTTTTGTACTCTTTTATTCTCGAAAGGGAAGGAGG
GCTATTGCCCTATCCCTTATTAATAAATGCATTGTGGTTTCTGGTTTCTCTAATACCATA
TGCCCTTCATTCAGTTTATAGTGGGCGGAAGTGGGGGAGAAAAAGTTGCTCAGAAATCAA
AAGATATCTCAAACAGCACAAATAATGGCTGATCGTTCTGCAAACAAAAAGTTACATAAT
AGCTCAAGAAGGAGAAGTCAACATGACTCTGAACAAGCTTTAACTTAGAAACTTTATCAT
CTTAAGGAAGAACGTGACCTTTGTCCAGGACGTCTCTGGTAATGGGGCACTTACACACAC
ATGCACACGTACAAACCACAGGGAAAGGAGACCGCCCTTCTGCCTCTGCTCGCGAGTATC
ACGCAGGCACCATGCACTATGTTTTCACACACACTGGGTGGAAGAAGAGCTTCAGCGCCA
GTCTTCTAATGCTTTGGTGATAATGAAAATCACTGGGTGCTTATGGGGTGTCATATTCAA
TCGAGTTAAAAGTTTTAATTCAAAATGACAGTTTTACTGAGGTTGATGTTCTCGTCTATG
ATATCTCTGCCCCTCCCATAAAAATGGACATTTAAAAGCAACTTACCGCTCTTTAGATCA
CTCCTATATCACACACCACTTGGGGTGCTGTTTCTGCTAGACTTGTGATGACAGTGGCCT
TAGGATCCCTGTTTGCTGTTCAAAGGGCAAATATTTTATAGCCTTTAAATATACCTAAAC
TAAATACAGAATTAATATAACTAACAAACACCTGGTCTGAAATAACAAGGTGATCTACCC
TGGAAGGAACCCAGCTGGTGGGCCAGGAGCGGTGGCTCACACCTGTAATTCCAGCACTTT
GGGAGGCTGAGACAGGAGGATCACTGGAGTCCAGGAGTTTGAGACCAGCCTGGGCAACAT
GGCAAAACCCAGTGTGCTTCTGTTGTCCCAGCTACACTACTCAGGAGGCTGAGGCAGGAG
TATGACTTGAGCCTGGGAGGGGGAGGTTGCAGAGAACTGATATTGCACCACCACTGCACT
CCAGCCTGGGTGACACAGCAAAACCCTATCTCAAAAAAAAAAAAAAAAAAAAGGAACCCA
GCTGGTTCCTGTAGGTGTGCAATAATAACAACCAGAGGAAGAAAAGGAAGACGATTTCCC
AGATGAAGAAGGGCAGCTGGACCTTCGGAC


spacer
spacer