spacer

EBI Dbfetch

>ENA|CH003588|CH003588.1 Leptospirillum sp. Group III LeptoIII_Scaffold44 genomic scaffold, whole genome shotgun sequence. 
CGTATTGTTCACGTCGTGCTGATGGCGGGAACGCTGTTCATGATGGGACTGTCCGTGTTT
TCCGTATCCCTGACATCCCTTGTGGGAGGACTGACCCATATCGGACTGGTCCGGATGGCA
AAGACCGATCCCCAGATGCGGGACGTCTATCTCGTGTTCCGCAAATACCGGACATTTTAC
CCTTCCCGCCAGGACGCCCGCGTGAACGGGAAACAAAACCATCGGGGTGCGCTTTAATGA
GCACGCTCCGCATCGATGACCTGAAGGATTCCAGGCCGGGTCTGGAAAGTCTCCTGAACT
GGGAGTCCCTGGTCGCTCCCGGCGTCCTCCGGAACAAGGACGGGTCGCTTCTGTCCGCCT
TCGAGTTTTCCGGGCCGGATCTCGAATCGTCGTCGCCGGAGGAACTGGCGGCGACATCCG
CCCGGATCAACGCCGCGTTTTCGAAACTCGGGTCGGGCTGGATGATCCATATCGACCTGT
TGCGGCTTCCTTCTCTCGATTATCTGCCGGAAGGGAACTTTCCCGATCCGGCCACCCGGG
CGATCGACTCCGAACGTCGTCGTCAGTTCGAACATGCGGACGCGCACTGGTTGTCCCGAC
GGGTTCTCGCGGTCACCTGGAGTCCCCCGGGCGAGACAGCCTCGAAGTTCGGCGAGCTCT
TCCTCAAGGAAAGCGGTCCCCGGGGTCCCCGGACTCATTTCCGACAGACCCTGGCCCGAT
TCCAATCCGATGTCGGCCGATTTTCCGATCTGCTCTCCGGTGGCATGACCCTCAAGCCCC
TGGGAGACGAAGACCTTCTCACGCACCTGCACACGTGTCTCACCGGGAAAACCCATCCGG
TCCGGGTTCCGCGGATCCCAACGGATCTCGACGCCCTTCTTGCGACCGGAGACCTGACCG
GAGGACTGGATCCCAAAATCGGACGGCTATGGTTTCGTGTCGTCACGATTTCCGGGTTCC
CTGAATCGAGTTTTCCGGGTTTTCTGGATGCGCTCGCCCAGGTTCCGTTCGCGATCCGTT
ACTCGATCCGGTTCATTCCACTGGATCCGCCCACGGCGGAACGGGAACTGGCCCGTCACC
GGAGACGGTGGCTTCAGCTTCGGATGGGGCTTCTGGGCATGATGACCGGGCGGGATCAGG
CGTCCGGAGCCCAGGCGTCCGCCTCGGAAAAAGGGCTGGACGTGGAAATGGCCCAGGCGG
AGAACGCCGACGGGTCGGTCCGGTTCGGATATGCCGCATTCAAAATCCTGATCTTCGACG
AAAACCCCTCCGTCCTTGCGGAGCGCGTCCGGATGGTCGAGAAAATCGTCAATAACTTGG
GATTCGGGACGATTCACGAAGAAATGAACTGTCTTTCGGCCTGGATCGAATCCCTTCCCG
GACATGCTTATCCGAATATCCGCAAACCACTGATGCACAGCCTGAACGTCTCGGATCTCA
TGCCCGTGACGACGGTCTGGTCCGGACGATCCGTGAATCCCTGTCCGTTTTATCCGCAGG
GGTCCCCCGCCCTCTTCCTGGCGTCCTCCTCCGGCACAACGCCGTTCTTCGGCAACATCC
ATGTGGGAGACCTTGGACATACCCTGATCCTGGGACCTCCCGGTATGGGAAAATCAGTTT
TGATGGCGTTCTTGGCCGCCCAGTTTTTCCGGTATCCCCGGGCCCAGGTGTTCGCATTCG
ACAAGGGATCCTCCTCCTACGTGCTTTGTACGGCATCCGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCTACGCGACCATGGGACTGTCGGA
GAGGTCGATCGAGATCATCGGCTCGCTTGTTCCCAAACGCCATTACTACGTCACCAGCAC
CGAAGGAAAAAGGGTCATCGATTTAGGGCTCGGAAAGGTGGCTCTGGCGTTTACCGGAGT
CTCGGATCAGGAAGAGCTGGGCATCGCCCGGAAGATTCTGAAAACGGGGAATATCTCCGA
TTTTTCCCCCCGTTGGCTCGAGCATAAAAATCTTCCGGACTGGGCCCGTCACGTTCGGGA
AATCTCCGGAAAGAATGTTTGAATCGGGGAGAGATCATGACAACACAGAGATTTGGAAAA
AGGCTCGCACTCATCGGAACACTTTGTCTGCTCCTCTCCGGAGGAGTTCCGGAGGTTTCC
GCTTCCGGAATGATGGGAACGGGATCGATCGTCTTCGACCCGACGAACCTGGTACAGAAC
ATGTCGACGGCGCTCAATACGGCCTCCGTGATCGCCAACCAGGCTTCCCAGCTCTACGAC
ATGTACCGGAACATGAAGAGCATGCCTTCCTCCGCCTGGTCCTCGACGTGCGGCATTATG
AGCCAGATGTCCATGATTGCCGGGCAACTTCCACAGTTCGGCGCCACGGCCCAGATGCTG
TCCAGCCAGTTTGCCGCCCAGAATCCGGGCTACACGCCGACCACCAACTACAATGCCCAA
TACGGCCAGTTGACGAACAATTTCAACAGCCAGCTCAACACTGACCTGAGCCAGGTCAGC
CTGGCGTCCAGCGCCTTATCCGCCGGTTCCTGCCAGCTCCAGTACCTGAACGGCATGAAT
ACCCAGGGATTCATGGGACGGATGCAGGCTCTCCAGACGGCAACACAGGTGGGCGTTCTG
GAAACGTCGACTCTCCAGCAGATGCAGTCCCTCCAGATGCAGCAGGCACAGGAACAGCGC
CTGTATATGGCCCACCAGGTCCAGACAAAGGCCGCCGTGAACGCGGCCGGAAACTGTTTC
GCCGAATCGGGCACCTACGGGGTCGGCCACGCCAACGGAACGGTCACGCCGCCTCCGGCT
GGATGCGGGGCCAATGGCGCCCCGTGCCAGCAAAGCACCAATGCGTTCGGCGACACGGTG
TACGTTCCGGCCACACCGCCTCCGGCGTGCGCGGGACAGGGTACCGGAACGGCCGTTCCC
TGACTCATTCTGAAAGGAGAACCAGATGATTCCGACCGGAACCGGATCGATTTTTCCGAC
TCTCCCTCCGCCCACATTTCCCGGGACGGATTTTGCGAACAACATTCTGAACACGATGCA
GACAGCGGCTTCCGGATGGGTTCCGACCGTTCTGGCCACGGCCCAGAAGCTCTTTCTTGA
TCTGGCCGGTCTCGAAGTCGTCTGGAGCACGGGAGAGTTCATCCTCCAGCGGGCCCAGAC
GGGGTGGGAAGGTCTGGCGATCGCAACGGCGAAACGGATCCTGCAATTGTCCCTTTTCTA
TTGGATCGTCTCCAATGCCAATTCGATCTTCTGGCTCATCTACAACCTCTTCCAGTCGGT
CGGAAGCGGAATGACCGGTATTTCCATGCTGTCGCCCGGGACGATCCTGCAAAACGGCAT
CAACTTCACGGCGCTCATCTCCGAAAACGTCAGCACGCTCGGGCTTCTGTCCCATCCGTT
CGGGGCCTTTGTCCTGGCGTTTTCGAACCTGCTCATTCTGCTGTCGTTCGTCGTCGTGGC
CGGCCAGTTCATGGTAACGATCGTCGAATCCTACATCGCGTCCTCCGCCGGCATTCTTCT
TCTTGGATTCGCCGGAAGCCGCTGGACCGCCACGTTCGCGGACAAGTACTTCGCCTACGC
GATCGGTATCGGCATCAAGCTTCTGATGTGCTTCGTCGTCATCAGCCTGGGAGAGAACAT
CACACTCAAACTGAACCAGATCATGGCAACGCCCGGATTTTTCCCCAGCGTTTTTTCCCC
TAATTTCGCGCCAACGCTCTATTCGAACCTCTTCGAGCTCGTGGGCATCTCGCTCATTTA
TGCCTTCATGGCGTGGAACATTCCCCAACTGGCCAGCTCGCTCGCGTCGGGATCGGTGGG
GATGACGCTCGGGGCATTCGCCGCGACCGGCGCATCGCTGGTCGGGTCCATGTTCGCTGC
GGGAAAGCTTGGCTCAAGCGCCGTGATGACGGGAACCAGCCTCCTGAAAAACGCCACCGG
AGCCGGAGCGGGAAGTCCGCTCCCCGGCTCTTCCCTGTTTTCTTCCCGGGCTCCCTCCTA
TGTCTCTCCGCCTTCGTCTCCCGGCGGAATTCCTTCCCCGCCTCCTGCAACTTCCGGCAC
GGATGTACAACCATCTCCCCCTGCTTCCGGAGGAACAACATCCGGAGCACCCGGACAACC
CGCCTCACCTCCGGGTTCAGGCGCTCGAACCGCTCCTGTTTTTTCCAGTCCTGCCGGAGC
TCCATCGGGATCGGTCCCGTCCTCCTCCCCGGGCTCGGGAAGCGGGATCGGACAGGCGCC
TTCCATGCCCTCCGACAAGGCGGACGTGTCCCCCGGCGGCCCCCAGTTCCGGCACGGAGA
CGGTGAGTGATGGCAACTCCTCACGAATCGTCCGAAAACCCCTACCTTTCCGTCGAACGA
AAATACCTGGACCGGATGGGTGAATTCCAGCAGCGGGAACGGATGTGGATGTATGCGGCA
TTCCTGGCGTTTGTCTCCTGTATCGTTCTGGCGGCCGCCCTGGCCCACGAGGCGCAAAAG
TCCCGGGTCGTTCCGTTTGTCGTCGAAGTGAACAGGCTCGGGAAGACCGTTCCCGTCGAA
CCCCTTGGAGCGACGACCCTTTCCGACGACCGGATCGTGAAATACATGCTGGCGGAATGG
ATCCGTCATGCCCGGTCGGTCCTGGCCGACCCGATTCTGGAACGAAAATGGATGATGTTT
GTCCATAACCATACCGTGGGGGCGGGACGGGTGTTCATCGACCGATACTACGGGCGCATG
GACAGGAATCCCCTGATTGTCGGCCAAAAGACGCTCGTCGATGTCGAAATCTCGCAACTC
TTCAAGAAATCGGACCGGACCTGGTACGCGGAATGGACGGAGACTTCGTGGAGCATCAAG
GGAGAAAAGGGGGAGACCCACAAGTGGCAAGGATTCTTTTCCGTCGAAATCGTCCCGCCG
ACCACGTCGAACGAGATTCGGGAGAACCCTCTGGGTCAGTACCTGACCTATATTTCCTGG
AACAGGATGGATTGATCGTGTCGGAAGCATTCCCCCGTCCCGGGGTGACAAGGTCAAAGA
ACCACGGGAGGGAACACCTTTGCCGTATCCTTTTTTCCGTTCTTTTCCTTCTCTTTCTTC
CCGTCCCATCGTTTGCCGGTTCCCCACCCTCCGAATCGGACCGATCCGGTGTGGGGCTGG
CGCTCCACACTTACAAGCACACGGGGACCGCTCCCTACATTTACGATTCCGGACTCGTCA
AGATCCCGTTCGGTCACGGGCAACCGACCATCGTGACGGCCATCGGCCGAATCACCGATA
TCGAGCTCGAACCCGGCGAGAAGGTCTGGAAAGCCTCCCTGGGGGACACGTCCGACTGGG
AGGTGGCCGTCATCAAGGCCGGCGATCCGGGTCATCCGACCCGGCATGTTGTGATCAAGC
CCCTGAAGGAGAAACTGTTTACCAACATGCTGATCTATACCGACCGGCGGACGTATTTCA
TGAACCTCGAGTCGACAAAATCCCGGTATGTGCTCCAGATCCGGTTCTGGTATCCCGACG
ACCTGGTCCAATCGTTTGAATCGATGCGGAACGCCAGGAGAAGCTCCAGACAAAAGATCG
CCCGACAAACGCTCGCCCGGCTCGATCATCCGTTCCTGCCGCATTTTGGATACACGATTG
AAGGGTCGGAATTCTGGAAACCGGAAGAAGTTTACGACGACGGCACCCGGACCTACATCG
TCATGCCGCACCAGGTGGCCACCTCGCAGCATTTGCCGGTCTTTGCCGTCCTGGATGGCG
ACGGACAAACCGAGATCGAGAACTATGCCGTCAAGGGAAACATATTCGTCGTTCCCCGGA
TCTTCCGGAAAGCGGTCCTGTTCTGGAATGTCGGACGAAGACGCGAACAGGTCACGATCG
TTCACAAGGGATCGGATGCCGGCTCCTGGTTCGGAGGAGGATCCCCGTGACGGACTCTCC
CAAAACCATGATCTCCCCCACCGGCCCCGTCCGGAGCGTCGGGAAGTTCCCGATCGTTCT
GGTCCTGCTCTTTATCGGTGTGGTCGTCGGAGCCGTTGTATACACCTCCCTCCACAAACC
CCAAAAAGTCCGTACGGAATCTCCGGACGACAAAATGAAATCGGCCATCAGGCAGGACCA
ATCCACGAAAAATCAGGATCCTGGCTACATGAACGTTCATGTTCCCTTTCCCGGACAGAA
TGCGCTTCCTCCAGGCGTTCCGAACCTGTCCAATCCACATCAAACCTCATCCGGTCCGAT
AGGTCCGTCCACCAAGAACACCCCAAAACCCTCTCGATCCTTCTCTCTCAAGCCTCCTCC
CCTTCCTTCCCCTCCGGTTCCTCCACAGGCCTCATCCGGCCTGTTCGTCGGCTCCGTCGA
CGGAGGACTGGAGAACGGAACGTCCACGCCTCCTCCCCTTCCGGAAGAACCTCATCCGGC
GACCGCCGTATTGCCTCCTGCGCTTCCCAATCTCTCGGGAGGCGGGCAAAACACGCCCCA
GGGAAAGCCCTCCAGCTACGAACAGACGAACATGCAGGACCAGAAGACCCGGTTTCTCAA
GGATTCCCAAAAAAAACAGTCCGATATTCTGCCCAATCCGGTCCGGGATCCGGTCTCTCC
TTTCGAGGTTCAGGCCGGTTCCGTCATCCATGCGGAACTCGTGGACGGAATCAATTCGGA
CCTCCCTGGAGAAGTGACCGCCCAGGTGACCGGAAACATCTACGACTCGATCGACGAACA
ATTTCTCCTCATCCCCCAGGGTTCGAAGATCGTCGGGAAATACGATTCGAAAGTGGCCGT
GGGACAGACACGCGTCCTGATGGCCTGGGAGCGGATCATTTTTCCGGACGGCCGCAGCAT
CGACCTTTCCGGGATGCCGGGCGTCGATCTGGAGGGCTATGCGGGATTCCACGACCTGGT
CGACAATCACTATCTCAAAATTTTTGGAAACGCTATACTTATGAGCCTGGTGATGGCCGG
AGCCCAGATGTCTCAGCCGGGTGGAGGGTACGGCATGGGCGGAATGAACAGCTTTTCCAA
CCCCTCGATGGGACAGGCGGCGATCGGATCGGTGGGGCAGAACATGAGCATGACCATGGA
ACAGTATCTGGGGAACACGATGAACATCCAGCCGACGCTCAAAATACGTCCGGGGTACCG
CTTCGATATCACGGTGACAAAAGACATGGTCTTTCCGGGACCTTATCTCGTGAAGGGAGA
ATGATGGGACGACGGAAATCGTTTGCAGACCTGGCCGAACAGCCGATCGTGACCCGTGTT
CCGGATTCCGCCCGGTCCCGACTGAAAGAGTTGTCCAAGAAACCGCCCCGGAAAACGTTA
AACGCCCTCCTGACCGAGATCATGACCTATTTCCTGAAAGAAAAGCCCTACGAGAAAGGT
CTCAAGTTCCGGATTCCCCGGTTCACGATCCGCTTTGAAAACGGAAATCCCGTCCGGACC
GGATGGATGCAGTTCAACGTCTACCTGACGGTGGATGTGAAGTCGGAGATGATGACCGAG
ATCGAGCGCCTACAGACTGAAGAGAAACTCCTCGTCACCCCCGCGAATTTCACCTTCTCG
GCGATCTTCTGGTGGCTGAACACCGTCGAGCCGGAAGGAGAAGAGAGTCTGGCCTACTAC
GACTACCTGAAAAAGGTTCACGGAGCGTGGAAAAAGGAAGAAGGGTGAATCCTTATACTC
CTGGAACGCTCCCTCCTGTAGGATTGGGAACAGATTTTATTACTCGATCCGGAATTCCGA
CCAGACCAACGGCTTCTTCGATTCTTCGTCAAATGCAGAGTGCAAGAATTCTTATTCCAT
TGGAAGAGTCGAGCGGGCGGCGGCTGGCAACACTCTGTTTTCAGGAACTCATCAACCTGA
CAGAAGGTCGGAAAGTTGTGTAAAGCAAAATATCCACAAGCTCATTTGCTGAAAATAAAA
CGCGATATACTTTAAACAAAGTTCATCCTGGGGCAATCGTTCGTTATTGATCTATGGTCG
AGCCGGAAGGAAAAGAGAGCCTGGCCACTACGACTACCTGAAGAAGATGCATGGATCGTG
GAAGAAGGGTGAATCCTCACATTCCAGAAACGCTCCCTCCAGGAGGATTGGATTATGGCC
ACTACCTCCTTCTGGAAACAATTTACGCCAGGATCAGTGGTATTTTTAGGATGAAGCTCA
TCGTGCCTTTTGCCACAAAACCACGCATTTCCTTACATCACAAAGGAGAGGACAATGGCC
GAAAAGACCCAGAAGACACATGGCAAGGCGAGCCCTGTTTCAACGAAAACGGCAACAAAG
ACAAAAGGCGCCGAGAAATCATCTCCTTCAAAGGTTTTATCCCGGGCCCATGGGGAAGAA
TCCGGGGGAATCCCTCTTCCGGAGGATCGCTATCGGATGGTCGCCGAGGCGGCGTATTTC
ATTGCCGAAAGTCGGGGGTTTGCGAACGGAAGATGCGAAGAGGACTGGTACGAAGCGGAG
CGTCTGGCCGGGAACAACTGGAAAGCAGAATGATCTGACCGTTTTGGACGAGATGGGCTA
AAGGATCCTGTTGAGTCTTTCACTGCGTATTCCGGCGAAATTTGCCACTTGATTCTTACC
AAATGCCATCCAGATCAACCCCAGATTGGTTACATGAGGTTGATCCGGGGGAAGAGGAAC
GCAGGCGTTTTCGCCATCTCACCGTCCAAATTCACGATAGAACTGATGTATCGAGTTTTT
CTTGAAGCATTGTCTCCCTTGGAATCAAATCTTTCAGAACTCGATCTATGGGTTTAGGAT
CAGAATTTCTACACGCCGATTTTTTCCCCGCCCGTCCCTCGTAAGGTTTGTTTCAATCGG
ACCAGATTCATGACGACCCCCTATTGTCGAACGACAATCCTCCGTCAATTCATGGTTCTT
CGATAAAAAGACCGATAAATCCCTCCATAGGAAAGATCTCTTCCAGAAGCCCGTCCTCAT
CCGATCGGATTTTGCGTTCAAAAATGGCCGGGTTCCCCAACTTCAGAAAATGATCGACAA
CCTCCGGGTCATAAAGAACACCCGTCTGCAATGATAAGTCCATTATGGCTTCTTCTGCAG
TTTTGACCGTGTTATAGGATCGCTGGTTGGTCATTGCATCATAACTGTCTGCAACAGCAA
AGATTCGAGCTTCCTTTACAAATCATTACCTGACAATCCATCCGGATATCCGCTTCCATC
CCATCGTTCCTGATGTTGGCGAACCATTTCTCTGGCAAATCGCAGAGAGGGGAAACGGTC
CAGTATCTCCCCTCCCAATTGAGGATGACATCGCATAATAACCCACTCATCCTCCGTCAA
CTTGTCTGGTTTAACCAGGATCTCCCTGGGAACCCTCGTTTTTCCGATGTCATGCAAAAG
CGATCCGACTCCCAGCACAAACAGATCGCGTGACGACAGTCCCATGTTTTCCCCGATCAT
CAGGGAAAGGCGAGCGACGCGATAGGAATGGGAGCGCCTTTCAAAGGTCCACCGATCCAG
CATTTCCATGAATTCATCGACCAGGGAAATTGTGGTCCGGTAGAGCTGGCGGGTGACAGC
GGCAAATGTTCTGGGATTGAAATCCTGAAGAGCTAATTCT


spacer
spacer