spacer

EBI Dbfetch

>ENA|M10051|M10051.1 Human insulin receptor mRNA, complete cds. 
GGGGGGCTGCGCGGCCGGGTCGGTGCGCACACGAGAAGGACGCGCGGCCCCCAGCGCTCT
TGGGGGCCGCCTCGGAGCATGACCCCCGCGGGCCAGCGCCGCGCGCCTGATCCGAGGAGA
CCCCGCGCTCCCGCAGCCATGGGCACCGGGGGCCGGCGGGGGGCGGCGGCCGCGCCGCTG
CTGGTGGCGGTGGCCGCGCTGCTACTGGGCGCCGCGGGCCACCTGTACCCCGGAGAGGTG
TGTCCCGGCATGGATATCCGGAACAACCTCACTAGGTTGCATGAGCTGGAGAATTGCTCT
GTCATCGAAGGACACTTGCAGATACTCTTGATGTTCAAAACGAGGCCCGAAGATTTCCGA
GACCTCAGTTTCCCCAAACTCATCATGATCACTGATTACTTGCTGCTCTTCCGGGTCTAT
GGGCTCGAGAGCCTGAAGGACCTGTTCCCCAACCTCACGGTCATCCGGGGATCACGACTG
TTCTTTAACTACGCGCTGGTCATCTTCGAGATGGTTCACCTCAAGGAACTCGGCCTCTAC
AACCTGATGAACATCACCCGGGGTTCTGTCCGCATCGAGAAGAACAATGAGCTCTGTTAC
TTGGCCACTATCGACTGGTCCCGTATCCTGGATTCCGTGGAGGATAATCACATCGTGTTG
AACAAAGATGACAACGAGGAGTGTGGAGACATCTGTCCGGGTACCGCGAAGGGCAAGACC
AACTGCCCCGCCACCGTCATCAACGGGCAGTTTGTCGAACGATGTTGGACTCATAGTCAC
TGCCAGAAAGTTTGCCCGACCATCTGTAAGTCACACGGCTGCACCGCCGAAGGCCTCTGT
TGCCACAGCGAGTGCCTGGGCAACTGTTCTCAGCCCGACGACCCCACCAAGTGCGTGGCC
TGCCGCAACTTCTACCTGGACGGCAGGTGTGTGGAGACCTGCCCGCCCCCGTACTACCAC
TTCCAGGACTGGCGCTGTGTGAACTTCAGCTTCTGCCAGGACCTGCACCACAAATGCAAG
AACTCGCGGAGGCAGGGCTGCCACCAATACGTCATTCACAACAACAAGTGCATCCCTGAG
TGTCCCTCCGGGTACACGATGAATTCCAGCAACTTGCTGTGCACCCCATGCCTGGGTCCC
TGTCCCAAGGTGTGCCACCTCCTAGAAGGCGAGAAGACCATCGACTCGGTGACGTCTGCC
CAGGAGCTCCGAGGATGCACCGTCATCAACGGGAGTCTGATCATCAACATTCGAGGAGGC
AACAATCTGGCAGCTGAGCTAGAAGCCAACCTCGGCCTCATTGAAGAAATTTCAGGGTAT
CTAAAAATCCGCCGATCCTACGCTCTGGTGTCACTTTCCTTCTTCCGGAAGTTACGTCTG
ATTCGAGGAGAGACCTTGGAAATTGGGAACTACTCCTTCTATGCCTTGGACAACCAGAAC
CTAAGGCAGCTCTGGGACTGGAGCAAACACAACCTCACCACCACTCAGGGGAAACTCTTC
TTCCACTATAACCCCAAACTCTGCTTGTCAGAAATCCACAAGATGGAAGAAGTTTCAGGA
ACCAAGGGGCGCCAGGAGAGAAACGACATTGCCCTGAAGACCAATGGGGACAAGGCATCC
TGTGAAAATGAGTTACTTAAATTTTCTTACATTCGGACATCTTTTGACAAGATCTTGCTG
AGATGGGAGCCGTACTGGCCCCCCGACTTCCGAGACCTCTTGGGGTTCATGCTGTTCTAC
AAAGAGGCCCCTTATCAGAATGTGACGGAGTTCGATGGGCAGGATGCGTGTGGTTCCAAC
AGTTGGACGGTGGTAGACATTGACCCACCCCTGAGGTCCAACGACCCCAAATCACAGAAC
CACCCAGGGTGGCTGATGCGGGGTCTCAAGCCCTGGACCCAGTATGCCATCTTTGTGAAG
ACCCTGGTCACCTTTTCGGATGAACGCCGGACCTATGGGGCCAAGAGTGACATCATTTAT
GTCCAGACAGATGCCACCAACCCCTCTGTGCCCCTGGATCCAATCTCAGTGTCTAACTCA
TCATCCCAGATTATTCTGAAGTGGAAACCACCCTCCGACCCCAATGGCAACATCACCCAC
TACCTGGTTTTCTGGGAGAGGCAGGCGGAAGACAGTGAGCTGTTCGAGCTGGATTATTGC
CTCAAAGGGCTGAAGCTGCCCTCGAGGACCTGGTCTCCACCATTCGAGTCTGAAGATTCT
CAGAAGCACAACCAGAGTGAGTATGAGGATTCGGCCGGCGAATGCTGCTCCTGTCCAAAG
ACAGACTCTCAGATCCTGAAGGAGCTGGAGGAGTCCTCGTTTAGGAAGACGTTTGAGGAT
TACCTGCACAACGTGGTTTTCGTCCCCAGAAAAACCTCTTCAGGCACTGGTGCCGAGGAC
CCTAGGCCATCTCGGAAACGCAGGTCCCTTGGCGATGTTGGGAATGTGACGGTGGCCGTG
CCCACGGTGGCAGCTTTCCCCAACACTTCCTCGACCAGCGTGCCCACGAGTCCGGAGGAG
CACAGGCCTTTTGAGAAGGTGGTGAACAAGGAGTCGCTGGTCATCTCCGGCTTGCGACAC
TTCACGGGCTATCGCATCGAGCTGCAGGCTTGCAACCAGGACACCCCTGAGGAACGGTGC
AGTGTGGCAGCCTACGTCAGTGCGAGGACCATGCCTGAAGCCAAGGCTGATGACATTGTT
GGCCCTGTGACGCATGAAATCTTTGAGAACAACGTCGTCCACTTGATGTGGCAGGAGCCG
AAGGAGCCCAATGGTCTGATCGTGCTGTATGAAGTGAGTTATCGGCGATATGGTGATGAG
GAGCTGCATCTCTGCGTCTCCCGCAAGCACTTCGCTCTGGAACGGGGCTGCAGGCTGCGT
GGGCTGTCACCGGGGAACTACAGCGTGCGAATCCGGGCCACCTCCCTTGCGGGCAACGGC
TCTTGGACGGAACCCACCTATTTCTACGTGACAGACTATTTAGACGTCCCGTCAAATATT
GCAAAAATTATCATCGGCCCCCTCATCTTTGTCTTTCTCTTCAGTGTTGTGATTGGAAGT
ATTTATCTATTCCTGAGAAAGAGGCAGCCAGATGGGCCGCTGGGACCGCTTTACGCTTCT
TCAAACCCTGAGTATCTCAGTGCCAGTGATGTGTTTCCATGCTCTGTGTACGTGCCGGAC
GAGTGGGAGGTGTCTCGAGAGAAGATCACCCTCCTTCGAGAGCTGGGGCAGGGCTCCTTC
GGCATGGTGTATGAGGGCAATGCCAGGGACATCATCAAGGGTGAGGCAGAGACCCGCGTG
GCGGTGAAGACGGTCAACGAGTCAGCCAGTCTCCGAGAGCGGATTGAGTTCCTCAATGAG
GCCTCGGTCATGAAGGGCTTCACCTGCCATCACGTGGTGCGCCTCCTGGGAGTGGTGTCC
AAGGGCCAGCCCACGCTGGTGGTGATGGAGCTGATGGCTCACGGAGACCTGAAGAGCTAC
CTCCGTTCTCTGCGGCCAGAGGCTGAGAATAATCCTGGCCGCCCTCCCCCTACCCTTCAA
GAGATGATTCAGATGGCGGCAGAGATTGCTGACGGGATGGCCTACCTGAACGCCAAGAAG
TTTGTGCATCGGGACCTGGCAGCGAGAAACTGCATGGTCGCCCATGATTTTACTGTCAAA
ATTGGAGACTTTGGAATGACCAGAGACATCTATGAAACGGATTACTACCGGAAAGGGGGC
AAGGGTCTGCTCCCTGTACGGTGGATGGCACCGGAGTCCCTGAAGGATGGGGTCTTCACC
ACTTCTTCTGACATGTGGTCCTTTGGCGTGGTCCTTTGGGAAATCACCAGCTTGGCAGAA
CAGCCTTACCAAGGCCTGTCTAATGAACAGGTGTTGAAATTTGTCATGGATGGAGGGTAT
CTGGATCAACCCGACAACTGTCCAGAGAGAGTCACTGACCTCATGCGCATGTGCTGGCAA
TTCAACCCCAAGATGAGGCCAACCTTCCTGGAGATTGTCAACCTGCTCAAGGACGACCTG
CACCCCAGCTTTCCAGAGGTGTCGTTCTTCCACAGCGAGGAGAACAAGGCTCCCGAGAGT
GAGGAGCTGGAGATGGAGTTTGAGGACATGGAGAATGTGCCCCTGGACCGTTCCTCGCAC
TGTCAGAGGGAGGAGGCGGGGGGCCGGGATGGAGGGTCCTCGCTGGGTTTCAAGCGGAGC
TACGAGGAACACATCCCTTACACACACATGAACGGAGGCAAGAAAAACGGGCGGATTCTG
ACCTTGCCTCGGTCCAATCCTTCCTAACAGTGCCTACCGTGGCGGGGGCGGGCAGGGGTT
CCCATTTTCGCTTTCCTCTGGTTTGAAAGCCTCTGGAAAACTCAGGATTCTCACGACTCT
ACCATGTCCAGTGGAGTTCAGAGATCGTTCCTATACATTTCTGTTCATCTTAAGGTGGAC
TCGTTTGGTTACCAATTTAACTAGTCCTGCAGAGGATTTAACTGTGAACCTGGAGGGCAA
GGGGTTTCCACAGTTGCTGCTCCTTTGGGGCAACGACGGTTTCAAACCAGGATTTTGTGT
TTTTTCGTTCCCCCCACCCGCCCCCAGCAGATGGAAAGAAAGCACCTGTTTTTACAAATT
CTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCTGGTGTCTGAGCTTCAGTATAAAAGACAA
AACTTCCTGTTTGTGGAACAAAATTTCGAAAGAAAAAACCAAA


spacer
spacer