spacer

EBI Dbfetch

>ENA|J00231|J00231.1 Human Ig gamma3 heavy chain disease OMM protein mRNA. 
CCTGGACCTCCTGTGCAAGAACATGAAACANCTGTGGTTCTTCCTTCTCCTGGTGGCAGC
TCCCAGATGGGTCCTGTCCCAGGTGCACCTGCAGGAGTCGGGCCCAGGACTGGGGAAGCC
TCCAGAGCTCAAAACCCCACTTGGTGACACAACTCACACATGCCCACGGTGCCCAGAGCC
CAAATCTTGTGACACACCTCCCCCGTGCCCACGGTGCCCAGAGCCCAAATCTTGTGACAC
ACCTCCCCCATGCCCACGGTGCCCAGAGCCCAAATCTTGTGACACACCTCCCCCGTGCCC
NNNGTGCCCAGCACCTGAACTCTTGGGAGGACCGTCAGTCTTCCTCTTCCCCCCAAAACC
CAAGGATACCCTTATGATTTCCCGGACCCCTGAGGTCACGTGCGTGGTGGTGGACGTGAG
CCACGAAGACCCNNNNGTCCAGTTCAAGTGGTACGTGGACGGCGTGGAGGTGCATAATGC
CAAGACAAAGCTGCGGGAGGAGCAGTACAACAGCACGTTCCGTGTGGTCAGCGTCCTCAC
CGTCCTGCACCAGGACTGGCTGAACGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGC
CCTCCCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGACAGCCCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGAGGAGATGACCAAGAACCAAGTCAGCCTGACCTG
CCTGGTCAAAGGCTTCTACCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCC
GGAGAACAACTACAACACCACGCCTCCCATGCTGGACTCCGACGGCTCCTTCTTCCTCTA
CAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACATCTTCTCATGCTCCGT
GATGCATGAGGCTCTGCACAACCGCTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAA
ATGAGTGCCATGGCCGGCAAGCCCCCGCTCCCCGGGCTCTCGGGGTCGCGCGAGGATGCT
TGGCACGTACCCCGTGTACATACTTCCCAGGCACCCAGCATGGAAATAAAGCACCCAGCG
CTGCCCTGG


spacer
spacer